10 Best Books for Biomathematics and Biostatistics
For anyone looking for a readable alternative to the usual unwieldy calculus text, here's a concise, no-nonsense approach to learning calculus. Following up on the highly popular first edition of Understanding Calculus, Professor H. S. Bear offers an expanded, improved edition that will serve the needs of every mathematics and engineering student, or provide an easy-to-use refresher text for engineers.
10 Best Books for Fish and fisheries
Understanding fish and fisheries is essential for appreciating our aquatic ecosystems and ensuring sustainable practices for future generations. Whether you’re an aspiring aquaculturist, a passionate angler, or simply a nature enthusiast, delving into literature on this subject can enhance your knowledge and skills. In this article, we present the 5 Best Books for Fish and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
10 Best Books for Instrumentation and Biotechniques
This best-selling undergraduate textbook provides an introduction to key experimental techniques from across the biosciences. It uniquely integrates the theories and practices that drive the fields of biology and medicine, comprehensively covering both the methods students will encounter in lab classes and those that underpin recent advances and discoveries.
10 Best Virology Books of All Time - Top Books for Virology
Here in this article, I will share a list of the Best Books on Virology. Under virology, you will study about Nature and Properties of Viruses, Bacteriophages, Viral Transmission, the Salient features of viral nucleic acids and Replication, Viruses and Cancer, Prevention & control of viral diseases, Applications of Virology. Here is the list of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
100 Laboratory Equipment Names and Uses
Laboratory equipment is the different tools, instruments and devices used in a laboratory for doing experiments and research work. It is used to measure, observe and handle samples, chemicals and biological specimens in a proper way. It includes measuring instruments, heating and cooling devices, glassware and plasticware, sterilization equipment, microscopes, separation devices, safety equipment and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
11 Best books for Advances in Microbiology (Practical)
This collection of diverse articles by the pioneers of modern genomics takes stock of the current state of the field and elucidates the contribution that sequencing genomes has made to our understanding of microbial metabolism and evolution.
11 Best Books for Inheritance Biology
Principles of Genetics is one of the most popular texts in use for the introductory course. It opens a window on the rapidly advancing science of genetics by showing exactly how genetics is done. Throughout, the authors incorporate a human emphasis and highlight the role of geneticists to keep students interested and motivated.
11 Best Books For Research Methodology
Research methodology is a critical aspect of any research endeavor, providing a systematic framework for conducting rigorous and reliable studies. For researchers, students, and professionals engaged in academic or scientific pursuits, having a solid understanding of research methodology is essential for designing studies, collecting and analyzing data, and drawing valid conclusions. To aid in acquiring ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
11 Types of Algae With their example.
In this article, we will learn about different types of algae and their characters such as; Chlorophyceae (Green algae), Phaeophyceae (Brown Algae), Rhodophyceae (Red Algae), Xanthophyceae (Yellow-Green Algae), Chrysophyceae (Golden Algae), Bacillariophyceae (Diatoms), Cryptophyceae, Dinophyceae, Chloromonadineae, Euglenineae, and Cyanophyceae or Myxophyceae (Blue-green algae). What is Algae? Types of Algae F.E. Fritsch divides the algae into ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
12 Best Books for Agriculture and Soil Microbiology
This fifth edition of the classic textbook in plant pathology outlines how to recognize, treat, and prevent plant diseases. It provides extensive coverage of abiotic, fungal, viral, bacterial, nematode and other plant diseases and their associated epidemiology. It also covers the genetics of resistance and modern management on plant disease.
12 Best Books for Plant Pathology
Plant Pathology, Fifth Edition, is the most comprehensive resource and textbook that professionals, faculty and students can consult for well-organized, essential information. This thoroughly revised edition is 45% larger, covering new discoveries and developments in plant pathology and enhanced by hundreds of new color photographs and illustrations.
12 Best Books on Bacteriology and Virology
Maintaining an emphasis on the principles of microbiology, this second edition of the text has been expanded to cover biodiversity as well as integrating more molecular detail
13 Best Books for Ethology (Animal Behaviour)
Ethology, the scientific study of animal behavior, offers valuable insights into the fascinating world of animal interactions, communication, and social dynamics. Aspiring ethologists, researchers, and animal enthusiasts seeking to delve deeper into this captivating field can greatly benefit from the knowledge and expertise shared in books dedicated to ethology. These books provide a comprehensive understanding ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
13 Best Books for Non-chordates
The enchanting world of non-chordates, the diverse and fascinating array of organisms that lack a backbone, has captivated the curiosity of naturalists and enthusiasts alike for centuries. From intricate invertebrates thriving in the depths of the oceans to delicate insects fluttering through sunlit meadows, non-chordates encompass an astounding range of species, each with its own ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
13 Difference Between Binary Fission and Budding
Budding and Binary Fission are two different forms of asexual reproduction in fungi and bacteria, and. Binary fission can be present in prokaryotes. Budding can be found in the eukaryotes. The primary difference between binary fission as well as budding is that, during binary fission, the parent organism is split into two daughter organisms through ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
13 Difference Between Heterozygous and Homozygous
Homozygous Definition Heterozygous Definition What is the difference between heterozygous and homozygous individuals? Characters Homozygous Heterozygous Definition Homozygous is the presence of two copies of the same allele which codes for a particular trait. Heterozygous is the presence of two different copies of alleles of a particular gene. Alleles Homozygous individuals have either dominant or ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
14 Common Glassware used in A Microbiology Laboratory
Microbiology laboratories require well-built rooms that are equipped with tools, glassware and equipment. Test tubes, culture tubes, Petri dishes and Erlenmeyer flasks are the most important types of glassware in a microbiological lab. 1. Test tube Test tube is a common laboratory apparatus used for holding, mixing and heating small amount of chemicals. It is ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
14 Difference Between Brightfield and Phase-contrast Microscopy
14 Difference Between Brightfield and Phase-contrast Microscope Topic Brightfield Microscope Phase Contrast Microscope Invented by Antonie van Leeuwenhoek (1632–1724) Frits Zernike (1888-1966) in 1932 Staining The Specimen Must be Stained before their observation under bright field Microscope. Staining is not required. Changes in refractive index This Microscope has no ability to alter the refractive index. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
14 Differences between Primary and Secondary Immune Response
Primary Immune response is a type of immune reaction which occurs when the antigen comes in contact with the host's immune system for the first time.
15 Best Books for Bioinformatics
A First Course In Computers 2003 Edition (With Cd). Foundations of Computing (English, Paperback, Sinhs Pradeep K.)
15 Best Books for Microbial Biotechnology
List of 15 Best Books for Microbial Biotechnology
15 Best Books For Microbiology Practical
List of 15 Best Books For Microbiology Practical
15 Difference Between Antiseptic and Antibiotic
What is antiseptic? Types and examples of Antiseptics Antiseptics, integral to infection control, are classified into various types based on their chemical composition and specific applications. Uses of antiseptics Antiseptics play a crucial role in preventing and controlling infections in various settings. Their applications are diverse, ranging from medical procedures to everyday first aid. What ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
15 Differences Between Archaea and Bacteria - Archaea vs Bacteria
Bacteria are primitive single-celled organisms which form a wide range of diverse organisms in terms of shape, size, and structure and even habitats.
16 Best Books for Zoogeography
Are you a zoogeography enthusiast looking to expand your knowledge on the subject? Look no further! In this article, we have curated a list of the 16 best books for zoogeography. Whether you are a student, researcher, or simply curious about the distribution of animals across geographical regions, these books offer valuable insights into the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
16 Difference Between Brightfield and Fluorescence Microscope.
In My previous notes i have already discussed about Brightfield Microscope and Fluorescence Microscope, their working principle, parts, definition, application, advantages, disadvantages and light path. You can check them out. Difference Between Brightfield Microscope and Fluorescence Microscope. Topic Brightfield Microscope Fluorescence Microscope Invented by Antonie van Leeuwenhoek (1632–1724) Antonie van Leeuwenhoek (1632–1724) Fluorochromes Not required ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
17 Best Books for Soil and Environmental Microbiology
List of 17 Best Books for Soil and Environmental Microbiology
17 Best Genetics Books of All Time - Top Books for Genetics
In this article i will share best and top recommended books for Genetics and Microbial genetics. The best buying link also provided at the end of each book. Our goal: Find the Top Books for Genetics, based on expert recommendations and thorough research—not just one random opinion. Here’s what we did: As an Amazon Associate, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
17 Best Microscope for Students
Each understudy who is seeking after an examination in science or some other field, besides, probably had an experience with a Microscope. Indeed, large numbers of you will utilized them at school or at home. While utilizing the gadget, similarly as you persist and battle for accuracy, a specific change of center handles makes the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
18 Best books for Immunology
In this article i share a list of 18 Best books for Immunology
18 Best Books for Medical Microbiology
List of 18 Best Books for Medical Microbiology
18 Best Books for Recombinant DNA Technology
List of 18 Best Books for Recombinant DNA Technology
18 Types of Centrifuges with their Principle and Uses
Centrifuge is a laboratory device that is used to separate different components of liquid or gas mixture on the basis of their density. It is commonly operated by an electric motor. The sample tubes are placed inside a rotor and the rotor rotates very rapidly around a fixed central axis. This rapid rotation produces centrifugal ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
19 Differences Between Transudates and Exudates
The major difference between transudates and exudates Pleural effusion is that transudate pleural effusion causes the formation of a clear fluid that has a low level of protein and cell. This is due to higher capillary hydrostatic pressure as well as the lower capillary pressure oncotic.
20 Difference between Antigen and Antibody - Antigen vs Antibody
Antigens are any substances that stimulate the immune system. Foreign antigens originate from the outside of the body and may be pathogens (such as disease-causing viruses or bacteria), allergens (such as pollen), or toxins (such as venom or chemicals). Autoantigens originate within the body and typically do not elicit an immune response, except in people ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
20 Difference Between Bacteria and Fungi
Definition of Bacteria Bacteria are unicellular, prokaryotic organisms, that lack a true nucleus and contain a few membrane-less cell organelles. Definition of Fungi Fungi are multicellular eukaryotic organisms that don’t produce their food on their own and are characterized by the chitinous cell wall. Key Differences Between Bacteria and Fungi Topic Bacteria Fungi Definition Bacteria ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
20 Difference Between Darkfield and bright Field Microscope
What is Bright Field Microscope? What is Dark Field Microscope? Difference Between Bright Field Microscope and Dark Field Microscope Feature Bright‑Field Microscope Dark‑Field Microscope Image Background Bright Dark Specimen Appearance Dark/stained specimens appear visible Unstained specimens appear bright against dark Illumination Transmitted white light through specimen Oblique/scattered light; direct light blocked Contrast Mechanism Light absorption ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
20 Difference Between Transmission and Scanning Electron Microscope
In my previous notes, I have already discussed Transmission Electron Microscope and Scanning Electron Microscope, their working principle, parts, definition, application, advantages, disadvantages, and light path. You can check them out. 20 Difference Between Transmission and Scanning Electron Microscope Topic Transmission Electron Microscope Scanning Electron Microscope 3D/2D Image 2D projection image of the inner structure ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
20 Differences between Pili and Flagella
Flagella also known as flagellum, which is a lash-like appendage, emerges from the cell body of cells known as flagellates. One cell can contain one or several flagella.
20 Instruments used in Microbiology Lab With their uses - Top Microbiology Lab Instruments
The most commonly used equipment is inoculation needles, transfer loops, inoculation, Bunsen burner, autoclave (or pressure cooker) incubators, hot air oven centrifuge, spectrophotometer magnetic stirrer electric shaker and rotary shaker heating plate, heating mantle distillation plant, UV-lamp carbon dioxide cylinder, water-bath and a single-pan balance that has weights (for general use) chemical balance, fine analytical ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
20 Types of Chromatography - Classification of Chromatography
Chromatography is a laboratory technique used for separation of components from a mixture. It is also used for identification and purification of the separated components. It is used in both analytical and preparative work. In analytical purpose, chromatography is used to determine the chemical composition and concentration of a sample. In preparative purpose, it is ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
21 Best Books for Industrial and Food Microbiology
This edition provides various aspects of biotechnology and microbiology written in a simple and lucid style to help the reader grasp the information quickly and easily. The book contains 22 chapters and each chapter presents updated material sufficient to meet the students expectations from a basic textbook. Chapters 14, 16, 18, and 20 have been updated including some new additional material. Two new chapters, 21 and 22, have been added that deal with the microbial pesticides and biofertilisers, respectively. All the previous chapters have been revised and updated. An updated index has been included to give more importance to the book. This edition of the book will prove to be very useful reading material for all students, teachers, professionals, researchers, industrialists, scientists involved in chemical engineering, biochemical engineering, environmental science, microbiology, biotechnology and life science. All the tables and figures have been newly redrawn to give full clarity to and good understanding of the topics. Most importantly, this book has been printed in two colours, it will give more impact to the students. The book also caters to the requirement of the syllabus prescribed by various Indian universities for undergraduates and postgraduates who are pursuing these courses.
21 Types of microscopes With Principle, Uses, Diagrams
Microscope is an instrument that is used in science laboratories to visualize very minute objects, such as cells and microorganisms. It gives a contrasting image that is magnified, so the structures can be observed. The term microscope is derived from Greek words “mikrós” meaning “small” and “skópéō” meaning “look at”. Microscopes are made up of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
22 Differences Between Endonuclease and Exonuclease - Endonuclease vs Exonuclease
Definition of Endonuclease Mechanism of Endonuclease The mechanism of endonuclease involves the cleavage of the phosphodiester bond within the polynucleotide chain. Here is an overview of the mechanism: The mechanism of endonuclease activity plays a crucial role in DNA repair processes, as it specifically targets and removes mismatched or damaged nucleotides within the DNA molecule. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
23 Difference Between Batch and Continuous Culture
Batch culture refers to a technique used to grow microorganisms in a limited supply of nutrients, which declines when these are used up, or some other factor becomes limiting.
28 Difference Between Spermatogenesis and Spermiogenesis in human cells.
Spermatogenesis is the process of the formation of haploid sperms from a diploid stem cell known as spermatogonium.
3 Domains of Life - Bacteria, Archaea, Eukarya
What is 3 Domains of Life? The intricate tapestry of life, as we understand it today, is a culmination of extensive scientific research and discoveries. Historically, the living world was bifurcated into two primary domains: Eukaryotes (Eukarya) and Prokaryotes (Bacteria). This classification was rooted in microscopic observations, particularly the presence or absence of membrane-bound nuclei ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
30 Comparison between Gram-Positive and Gram-Negative Bacteria
Quick Comparison between Gram-Positive and Gram-Negative Bacteria Serial Characteristics Gram Positive Gram Negative 1 Gram staining Stained purple or blue color (color of primary stain, crystal violet) Stained pink or red (Color of counterstain or secondary stain, safranin) 2 Thickness of cell wall 20-30 nm thick 8-12 nm thick. 3 Smoothness of cell wall The ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
36 Types of Spectroscopy with Principle, Uses
Spectroscopy is a study of interaction of matter with electromagnetic radiation. It is used to study the atoms and molecules when they are exposed to different wavelength of light or energy. In this process, the atoms and molecules absorb, emit, reflect or scatter the radiation. These radiation are absorbed or emitted only at some specific ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
4 Best Books For Chordates
Are you looking for the best books to deepen your knowledge and understanding of chordates? Look no further! In this comprehensive guide, we have curated a list of the top books for chordate enthusiasts. Whether you’re a student, researcher, or simply an avid learner, these books are sure to provide you with valuable insights into ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
41 Best Biology Movies and Documentary for Students
ll share a list of the best biology movies and documentaries for students. All of these books are enlisted according to their IMDB rating. You can watch these movies along with your current study, it will help you keep you entertained during exam pressure. All of these movies are related to science and biotech.
5 Best Books for Developmental Biology
Developmental biology is a fascinating field of study that explores the intricate processes by which organisms grow, differentiate, and develop from a single cell into complex multicellular organisms. It encompasses a wide range of topics, including embryology, morphogenesis, cell signaling, and genetic regulation. Whether you are a student, researcher, or simply an avid learner seeking ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
5 Best Books for Economic Botany
Discover the essential reads that will deepen your understanding of economic botany, the study of plants and their economic significance. This curated list features five highly regarded books that cover a range of topics, from the historical use of plants in various cultures to the modern applications in agriculture, medicine, and industry. Whether you’re a ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
5 Best Books for Endocrinology
Endocrinology is a branch of medicine that focuses on the study of the endocrine system, which comprises glands that secrete hormones directly into the bloodstream. These hormones regulate various bodily functions, including metabolism, growth and development, tissue function, sleep, mood, and sexual function. Key glands in the endocrine system include: Endocrinologists diagnose and treat conditions ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
5 Best Books for Ethnobotany
Unlock the world of ethnobotany with our curated list of the 5 best books on the subject. This comprehensive guide features must-read titles that delve into the intricate relationship between plants and cultures. Whether you’re a student, researcher, or passionate about traditional plant knowledge, these essential books offer deep insights into ethnobotanical studies, cultural heritage, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
5 Best Books for Physiology
Physiology, the branch of biology that delves into the intricate workings of the human body, has fascinated scholars and readers alike for centuries. From unraveling the complexities of our cardiovascular system to deciphering the intricacies of cellular function, the study of physiology serves as a gateway to understanding the remarkable mechanisms that keep us alive. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
5 Best Books For Plant Anatomy and Embryology
Explore the fascinating world of plant structure and development with our top picks for the best books on plant anatomy and embryology. This collection features essential texts that delve into the intricate details of plant tissues, organs, and developmental processes. Ideal for students, researchers, and anyone interested in plant science, these books offer clear explanations, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
5 Best Books for Plant Physiology and Metabolism
Unlock the secrets of how plants function with our curated list of the top books on plant physiology and metabolism. These essential readings cover everything from the fundamental processes of photosynthesis and respiration to the complex biochemical pathways that sustain plant life. Whether you’re a student, researcher, or enthusiast, these books provide in-depth insights into ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
5 Best Books for Protistology (Protists)
Welcome to our comprehensive guide on the best books for protistology (protists)! Protistology, the study of protists, encompasses a fascinating and diverse field of scientific exploration. As unicellular organisms, protists exhibit remarkable adaptations and play crucial roles in ecosystems around the world. Whether you’re a student, researcher, or simply intrigued by the world of microscopic ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
5-Fluorocytosine (5-FC) Solution Preparation
5-fluorocytosine (5-FC) also known as Flucytosine. 5-Fluorocytosinewas first synthesized in 1957 as anti-tumor drug. It is an antifungal medication which is used with amphotericin B against Candida infections and cryptococcosis. This drug is mainly taken by mouth and by injection into a vein.
5' Capping and Polyadenylation - Definition, Mechanism
What is 5′ capping? The unique cap structure of eukaryotic mRNA is composed of 7-methylguanosine residues connected by a 5′-5′ triphosphate bridge. Structure of 5′ cap 5’ Capping process The starting point for capping with 7-methylguanylate is the unmodified, triphosphate-terminated 5′ end of an RNA molecule. Following the last nucleotide are three phosphate groups connected ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
50 Sources of Scientific Literature
What is Scientific Literature? Scientific literature refers to written works that document and communicate scientific research, findings, and advancements in various fields of study. It encompasses a wide range of publications, including research articles, review papers, conference proceedings, book chapters, and scientific books. Scientific literature serves as a vital source of knowledge and information for ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
500+ Biology Crossword Puzzle With answer Key Pdf Free Download
Dive into the fascinating world of biology with our engaging crossword puzzle designed to test and enhance your knowledge of cellular concepts! This crossword puzzle covers key terms, processes, and structures related to biology, making it a great educational tool for students, teachers, and enthusiasts alike. Whether you’re preparing for an exam, looking for a ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
56 Pioneers in Microbiology and their Great Contribution
Here is the list of Top 56 Pioneers in Microbiology and their Great Contribution Antonie van Leeuwenhoek (1632–1723): The First Microbiologist Antonie van Leeuwenhoek was a Dutch scientist who is often considered the father of microbiology. He was the first to observe bacteria and other microorganisms using a microscope that he designed and built himself. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
6 Best Books for Plant Ecology and Taxonomy
Discover the essential reads for anyone passionate about plant ecology and taxonomy with our curated list of the best books in these fields. Whether you’re a student, researcher, or simply a plant enthusiast, these books provide comprehensive insights into plant interactions with their environment and the classification systems used to categorize them. From foundational texts ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
65 Best Biology Movies and documentary on Netflix
Hi everyone, I am here again with an exciting article. In this article, I will share a list of Top and Best Biology Movies and documentaries which are currently streaming on Netflix. I hope you will like all these movies;
7 Best Books For Anatomy Of Vertebrates
The study of vertebrate anatomy is a fascinating and essential field that delves into the intricate structures and systems of animals with backbones. From mammals and birds to reptiles, amphibians, and fishes, understanding the anatomy of vertebrates is crucial for students, researchers, and professionals in various disciplines such as biology, zoology, veterinary medicine, and paleontology. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
7 Best Books for Animal Biotechnology
What is Animal Biotechnology? Animal biotechnology is a field of science that involves the application of biotechnological techniques to improve animal production and health. It encompasses various methods and technologies aimed at enhancing the genetic, reproductive, and nutritional characteristics of livestock and other animals. Here are some key aspects of animal biotechnology: List of 7 ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
7 Best Books for Ecology
Ecology, the scientific study of the interactions between organisms and their environment, has become increasingly important in today’s world. As our planet faces numerous environmental challenges, understanding ecology has never been more crucial. Whether you are a student, a professional in the field, or simply an avid reader interested in learning more about the natural ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
7 Best Books for Genetics and Plant Breeding
Embarking on a journey into the fields of genetics and plant breeding requires a solid foundation of knowledge and resources. This article explores the top books that provide comprehensive insights into these dynamic disciplines. From foundational texts that cover fundamental genetic principles to specialized volumes focusing on advanced plant breeding techniques, this curated list offers ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
7 Best Books For Microbial Metabolism
List of 7 Best Books For Microbial Metabolism
7 Best Books for Parasitology
Parasitology is the branch of biology that focuses on the study of parasites, which are organisms that live on or in a host organism and derive nutrients at the host’s expense. This field examines the biology, ecology, evolution, and interactions of parasites with their hosts, as well as the diseases they cause. Key areas of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
7 Best Books on Evolutionary Biology
Evolutionary biology stands as one of the most captivating and illuminating fields of study, unraveling the intricacies of life’s diversity and the remarkable processes that have shaped it. As an interdisciplinary science, evolutionary biology combines genetics, paleontology, ecology, and more to explore the origins and development of species over time. To delve deeper into this ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
8 Best Books for Genetic Engineering and Biotechnology
List of 8 Best Books for Genetic Engineering and Biotechnology
8 Best books for Introduction and Scope of Microbiology
Tortora, Funke, and Case’s Microbiology, An Introduction brings a 21st-century lens to the #1 best-selling text on the market.
9 Best Books for Insect Biology
Insect biology is the study of insects, a diverse group of arthropods belonging to the class Insecta. This field encompasses various aspects of insect life, including: Insect biology is crucial for many fields, including agriculture, medicine, and environmental science, as insects are vital components of ecosystems and have significant impacts on human life. List of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
9 Best Books for Neuroscience
Neuroscience is the interdisciplinary scientific study of the nervous system, encompassing a variety of fields such as biology, psychology, medicine, and engineering. It aims to understand the structure and function of the brain and nervous system, including how neurons communicate, how neural circuits influence behavior and cognition, and how various factors can affect brain health ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
9 Best Books on Reproductive Biology
Reproductive biology is a fascinating field of study that explores the intricate mechanisms and processes involved in human reproduction. Whether you are a student, researcher, healthcare professional, or simply curious about the wonders of reproductive biology, delving into the world of books dedicated to this subject can provide valuable insights and knowledge. The best books ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
A Worm Under a Microscope
Under the lens of a microscope lies a world of wonder, and one of the fascinating creatures to observe is the humble worm. These ancient beings have been roaming the earth for hundreds of millions of years, evolving into the diverse forms we see today. In 2018, an article published in National Geographic unveiled the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
A- Z Microbiology Terms With Definitions - Microbiology Glossary
Microbiology Terms Starting With A Microbiology Terms Starting With B Microbiology Terms Starting With C Microbiology Terms Starting With D Microbiology Terms Starting With E Microbiology Terms Starting With F Microbiology Terms Starting With G Microbiology Terms Starting With H Microbiology Terms Starting With I Microbiology Terms Starting With J Microbiology Terms Starting With K ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
A-Z Botany Terms With Definitions – Botany Glossary
Botany Terms Starting With A Botany Terms Starting With B Botany Terms Starting With C Botany Terms Starting With D Botany Terms Starting With E Botany Terms Starting With F Botany Terms Starting With G Botany Terms Starting With H Botany Terms Starting With I Botany Terms Starting With J Botany Terms Starting With K ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
A-Z Zoology Terms With Definitions – Zoology Glossary
Zoology Terms Starting With A Zoology Terms Starting With B Zoology Terms Starting With C Zoology Terms Starting With D Zoology Terms Starting With E Zoology Terms Starting With F Zoology Terms Starting With G Zoology Terms Starting With H Zoology Terms Starting With I Zoology Terms Starting With J Zoology Terms Starting With K ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Abiotic Factors - Definition, Types, Importance, Examples
What are Abiotic Factors? Definition of Abiotic Factors Abiotic factors refer to the non-living physical and chemical elements in an ecosystem that influence and shape the conditions within which living organisms thrive and interact. Types of Abiotic Factors Here is the list of abiotic factors: Abiotic Factor Description Air A mixture of gases essential for ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Abiotic Stress (Stress Biology) - Definition, Environmental factors, sensing mechanisms,
What is Plant Stress? Acclimation and Adaptation Acclimation and adaptation are fundamental concepts in plant biology that describe how individual plants and entire populations respond to environmental stressors. These responses play crucial roles in enhancing survival and reproduction, allowing plants to thrive in challenging conditions. Environmental Factors and Their Associates Biological Impacts on Plants Environmental ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Absorption of Water In Plants - Path, Mechanism, Factors, Importance
Water absorption is a critical physiological process in plants, essential for their growth and various metabolic activities. In lower plants, such as algae and mosses, water absorption occurs across the entire plant surface through the process of osmosis. However, in higher plants, this function is specialized and occurs primarily through the root hairs. The primary ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Acetamide utilization Test - Principle, Procedure, Result, Uses
It is a biochemical test used for the identification and differentiation of non-fermentative Gram-negative bacteria. It is mainly applied for the confirmation of Pseudomonas aeruginosa. This test is based on the ability of the organism to utilize acetamide as the sole source of carbon and nitrogen. The test medium contains acetamide and a pH indicator ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Acetate Utilization Test - Principle, Procedure, Results
Acetate utilization test is a biochemical test used to determine the ability of an aerobic organism to use acetate as the sole source of carbon and energy. It is mainly employed in diagnostic microbiology for differentiation of Gram-negative bacteria especially members of Enterobacteriaceae family. This test is commonly used to differentiate Escherichia coli from Shigella ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Acetic Acid Production
What is Acetic Acid? Properties of Acetic acid-CH3COOH CH3COOH Acetic Acid Molecular weight/molar mass of CH3COOH 60.052 g/mol Density of Acetamide 1.05 g/cm³ Boiling Point of Acetamide 118 °C Melting Point of Acetamide 16.6 °C Structure of Acetic acid Ethanoic acid is the second-simplest carboxylic acid structurally (the simplest being formic acid, HCOOH), and is ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Acid Fast Stain - Principle, Reagents, Procedure, Result
Acid fast stain is a differential staining method that is used to identify the acid fast bacteria which retain the primary dye even after treatment with acid alcohol. It is the process where the organisms having a high amount of mycolic acids and waxes in their cell wall show resistance to decolourisation. These are hydrophobic ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Acridine Orange Staining - Principle, Procedure, Uses
Acridine Orange contains metachromatic properties, that’s why it is employed in fluorescence microscopy and flow cytometry study of cellular physiology and cell cycle state, including the fluorescent microscopic examination of microorganisms.
Actinomycetes - Morphology, Classification, Uses
What are Actinomycetes? Actinomycetes are a diverse group of Gram-positive, catalase-positive, nonmotile bacilli that exhibit characteristics bridging bacteria and fungi. Structurally, they resemble bacteria due to their cell walls containing muramic acid and prokaryotic nuclei, making them susceptible to antibiotics. However, their filamentous growth pattern, forming structures known as hyphae, is reminiscent of fungi. These ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Action Potential - Definition, Properties, Generation, Mechanism, Conduction
What is Action Potential? Definition of action potential An action potential is defined as a rapid, transient change in the electrical membrane potential of a neuron, characterized by a brief depolarization followed by repolarization. This process allows neurons to transmit signals over long distances. It occurs when the membrane potential reaches a critical threshold, leading ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Active Immunity - Definition, Characteristics, Types, Examples
What is Active Immunity? Definition of Active Immunity Active immunity refers to the immunity that is acquired when the body’s own immune system produces antibodies in response to exposure to a foreign antigen, such as a pathogen or vaccine. It provides long-lasting protection against specific antigens. Characteristics of Active Immunity Active immunity possesses several key ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Active Immunization - Definition, Mechanism, Advantages, Disadvantages, Examples
What is Active Immunization? Definition of Active Immunization Active immunization refers to the process of inducing immunity in an individual by administering a vaccine or exposing them to a specific pathogen, triggering an immune response and the development of lasting protection against future infections. Mechanism of Active Immunization Active immunization works by stimulating the immune ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Active Site For Enzymes - Definition, Features, Mechanism, Example
What is Active Site of an Enzyme? Definition of Enzyme’s Active Site The active site of an enzyme is a small region within the enzyme where substrate molecules bind and undergo a chemical reaction, leading to the formation of products. What is Binding site? Features that Determine Active Site Specificity The specificity of the active ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Active Transport - Definition, Types, Process, Functions, Examples
Ever wondered how the cells in your body get the nutrients they need to function? It’s not like they have a mini grocery store to pop into whenever they run low on sugars or amino acids, right? Welcome to the fascinating world of Active Transport. “Active Transport – the unsung hero of cellular operations, ensuring that ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Adaptation - Definition, Types, Reasons, Examples
What is Adaptation? Definition of Adaptation Adaptation is the process by which an organism adjusts to its environment through changes in behavior, physiology, or structure, enhancing its chances of survival and reproduction. Types of Adaptations Adaptations are the features and behaviors that help organisms survive in their environments. These adaptations can be physical, behavioral, or ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Adaptations in Fishes - Colouration, Sound production, Luminous Organs, Electric organs
Colouration Colouration in fish is a prominent and diverse characteristic that plays a critical role in their survival and interaction within aquatic ecosystems. The variety of colours and patterns found among different species of fish is typically linked to their habitats, behaviors, and ecological roles. Understanding the mechanisms behind fish coloration not only provides insight ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Adaptive (Acquired) Immunity
Features Adaptive (Acquired) Immunity Types of acquired immunity An acquired immunity against a microorganism may be produced through the host’s response to the bacterium or by the transfer of particular antibodies or lymphocytes. There are two types of immunity: active and passive. 1. Active immunity Types of Active immunity There are two varieties of active ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Adaptive Features In Plant - Xerophytes, Hydrophytes
What is Adaptations? Adaptations in hydrophytes Morphological Adaptations in Hydrophytes Hydrophytes, or aquatic plants, exhibit a wide range of morphological adaptations that allow them to thrive in water-rich environments. These adaptations vary depending on whether the plants are free-floating, submerged, or emergent. Below are the key structural adaptations of hydrophytes that aid in their survival: ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Adenosine triphosphate (ATP) - Structure, Synthesis, Functions
Because the body is complex, energy is required to ensure proper functioning. Adenosine triphosphate, or ATP, is the energy source for use and storage at cellular level. ATP’s structure is a nucleoside triophosphate. It consists of a ribose glucose, a nitrogenous base (adenine) and three serially bonded phosphate group. ATP is often referred to by ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Adrenal Gland - Location, Structure, Hormones, Functions, Diseases
What is Adrenal Gland? Definition of Adrenal Gland The adrenal glands, or suprarenal glands, are small, triangular-shaped endocrine glands located on top of each kidney. They consist of two main parts: the adrenal cortex, which produces steroid hormones such as cortisol and aldosterone, and the adrenal medulla, which produces catecholamines like adrenaline. These hormones play ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Afferent vs Efferent Neuron - Differences between Afferent and Efferent Neuron
What is Afferent Neuron? What is Efferent Neuron? Similarities Between Afferent and Efferent Difference Between Afferent and Efferent – afferent vs efferent S.No Afferent Neuron Efferent Neuron 1. Afferent Neuron is a types of neurons that carry sensory impulses towards the central nervous system (CNS). Efferent Neuron is a types of neurons that carry motor ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Affinity chromatography - Principle, Types, Steps, Applications
Affinity chromatography is a type of liquid chromatography technique which is used for separation and purification of biomolecules based on a highly specific and reversible interaction between the target molecule and a specific ligand. It is the process where the target molecule selectively binds with a ligand that is immobilized on a solid matrix. This ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Agarose Gel Electrophoresis Definition, Principle, Procedure, Applications
Agarose gel electrophoresis (AGE) is an approach that is used to distinguish DNA from RNA based on their molecular sizes.
The separation of RNA and DNA molecules is accomplished when nucleic acids that are negatively charged travel through an agarose structure under an influence of an electrical fields (electrophoresis).
Ageing - Definition, Theories, and models
What is Ageing? Different Types of Aging Aging is a complex process that can be categorized into different types based on various perspectives. Understanding these different types of aging can provide a comprehensive view of the aging process. Here are five common classifications: Overall, aging is a multifaceted process that encompasses various dimensions. By considering ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Agglutination Reaction - Definition, Types, Mechanism, Applications
In 1896, two bacteriologists, Herbert Edward Durham and Max von Gruber, independently discovered specific agglutination. In honour of the discoverers, this reaction was given the name GruberDurham reaction. Later, Gruber designated as “agglutinin” any chemical that induced an agglutination reaction (from the Latin). Fernand Widal (1862–1929) employed agglutination to diagnose typhoid disease in the same ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Agglutination Test - definition, Types, Uses, Advantages, Disadvantages
Agglutination Test is a serological test in which the antigen and antibody reaction is seen directly as visible clumping. It is the process where particulate antigen reacts with its homologous antibody and form aggregates called agglutinates. These aggregates can be seen with naked eyes. This reaction is specific because the antigen combines only with the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Agnatha - Characteristics, Classification, Morphology, Reproduction
Agnatha is the superclass of vertebrates in which true jaws are absent. It is the group that represent the most primitive and earliest craniates, and in this group the mouth parts are simple without any jaw elements. It is the condition where the animals show a very old vertebrate body plan which is already present ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Agrobacterium-Mediated Gene Transfer - Protocol, Applications, Advantages
What is Agrobacterium? There are many types of Gram-negative bacteria in the genus Agrobacterium. They can be harmful to plants and are also useful for genetic engineering. It causes tumours in plants by moving a piece of DNA known as T-DNA from its Ti or Ri plasmid into the plant genome. This causes cells to ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Agrobacterium-Mediated Gene Transfer in Plants - Protocolo
Agrobacterium is a rod-shaped, Gram-negative, aerobic soil bacterium which acts as a plant pathogen. It infects plants mainly through wound sites present in plant tissues. When the bacterium enters the plant through these wounded regions it causes diseases such as crown gall disease and hairy root disease. These diseases are characterized by tumor-like swellings or ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Agrochemical - Definition, Types, Mechanism, Measurement
What is Agrochemical? Types of Agrochemicals Agrochemicals play a significant role in modern agriculture and animal husbandry practices. Let’s explore the different types and uses of agrochemicals: While agrochemicals have contributed to increased crop yields and improved agricultural practices, their use can also have negative impacts on the environment and human health. Therefore, it is ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Air Displacement Pipetting - Principle, Procedure, Applications
An air displacement pipette (also known as a “volumetric pipette” or “mechanical pipette”) is a type of liquid handling tool commonly used in laboratory settings. It uses air displacement to draw a specific volume of liquid into the pipette’s barrel. The volume of liquid is determined by the calibrated volume markings on the barrel of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Air microbiology and Dispersal of Microbes
Air microbiology Indoor air microbiology 1. Aeromicrospora of Pharmacy 2. Aeromicroflora of Hospitals 3. Other Houses 4. Aeromicroflora of Storage Materials A number of important goods are held in houses, and staff members are assigned to protect them. However, aeromicroflora degrade these substances. Several instances are provided below: (i) Library (ii) Wall Paintings Outdoor air ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Albert Stain - Principle, Procedure, Result, Uses
Different stains have been developed over time to distinguish bacteria species, separating them morphologically and the specific characteristics they possess. The most popular stain is Gram staining, acid-fast staining, and endospore staining. Each stain aims at identifying and defining bacteria according to their forms and morphologies.
Alcohol Burner - Definition, Principle, Parts, Uses
What is Alcohol burner? Definition of Alcohol burner An alcohol burner is a small, portable laboratory device that uses denatured alcohol as fuel to produce a controlled flame for heating, sterilization, and experimental purposes. Working Principle of Alcohol burner Factors that affect the working of an alcohol burner Parts of a Alcohol burner Operating Procedure ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Alcohol Fermentation in Laboratory
Alcohol fermentation, also known as ethanol fermentation, is a sophisticated biotechnological procedure wherein specific sugars, namely glucose, fructose, and sucrose, undergo a transformation into ethyl alcohol (ethanol) and carbon dioxide. This transformation is facilitated by certain microorganisms, predominantly the yeast species Saccharomyces cerevisiae, as well as specific bacterial strains. Central to the realm of biotechnology, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Algae Bioreactor - Definition, Types, Feature, Uses
The Algae Bioreactor is a closed system that treats wastewater and produces biofuels using algae. The earliest commercial applications of algae bioreactors occurred in the 1960s for wastewater treatment. With the increasing global demand for alternative energy sources, the usage of algae bioreactors for biofuel production has risen to prominence in the 21st century. The ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Algae Under Microscope
What is Algae? Requirement for observation of Algae Under Microscope Algae Sample Collection Procedure Algae sample collection is a crucial step in studying these diverse organisms. To ensure a successful and accurate collection, follow this unique procedure: Tips: Safety Precautions: Storage: Processing: Identification: Following this comprehensive algae sample collection procedure ensures the acquisition of reliable ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Algal Cultivation - Methods, Factors, Feature, Types, Uses
Algal cultivation means growing algae (microalgae or seaweeds) in controlled or partly controlled environments for useful biomass. The algae are supplied with light, carbon (often CO₂), water and nutrients so growth is promoted. In open ponds (raceway ponds etc.), cultures are exposed to ambient conditions, and mixing is provided to avoid shading and settling. Photobioreactors ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Algal Morphology - Size, Shape, Cellular Components and Structure
Algal morphology is defined as the study of body structure and organization of algal cells and their thalli. Algae are observed in a diversity of sizes and shapes, from microscopic single-celled forms to large seaweeds several meters long. The science concerned with algae is termed Phycology, and a specialist is called an Algologist or Phycologist. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Algal Reproduction - Sexual, Asexual and Vegetative Methods
The reproduction in Algae is considered to be a fundamental biological process, and it is carried out by different modes which are usually classified into Vegetative, Asexual, and Sexual methods. By vegetative processes, new individuals are produced from somatic parts, and this happens without involvement of spores or gametes, which makes it simple yet very ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Alkaline Peptone Water - Preparation, Composition, Principle, Application.
Clinical materials containing small numbers of Vibrio should be inoculated into an enrichment medium prior to plating onto a selective medium, such as TCBS Agar (M189). Alkaline Peptone Water is a suitable enrichment broth for this purpose.
Alkaline Phosphatase Test of Milk - Principle, Procedure, Result, Uses
Alkaline Phosphatase (ALP) is an enzyme that is naturally found within all the raw milks that is utilized to determine the quality of pasteurization of milk. A complete pasteurization process can deactivate the enzyme below levels that can be detected by traditional methods. Because the stability of the heat of ALP is higher than the stability of pathogens that could be found in milk, it serves as a metric of security. However, failure for detection of ALP activity is not a mean an item is safe from pathogens.
Alleles - Definition, Characteristics, Types, Examples
What is Allele? Definition of Allele An allele is a specific variant of a gene that occupies a particular position (locus) on a chromosome, and different alleles can result in variations of a trait. Each individual inherits two alleles for each gene, one from each parent. Features of Alleles Types of Alleles There are different ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Alternaria alternata - Habitat, Life Cycle, Morphology, Pathogenesis
Alternaria alternata is a fungus that causes leaf spots, rots, blights, and other plant maladies. It is an opportunistic pathogen that affects over 380 plant species. Additionally, it can cause upper respiratory tract infections and asthma in immunocompromised humans. Classification of Alternaria alternata Kingdom Fungi Phylum Ascomycota Class Euascomycetes Order Pleosporales Family Pleosporaceae Genus Alternaria Habitat ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Alternative Pathway of Complement System
What is Alternative pathway of the complement system ? Activators of the alternative pathway Activators of the alternative pathway of complement activation include Steps of activation of alternative pathway Four serum proteins comprise the initial component of the alternative pathway: C3b, factor B, factor D, and properdin. 1. C3bB complex Formation 2. C3bB Cleavage 3. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Altitudinal Zonation - Definition, Factors, Importance, Examples
What is Altitudinal Zonation? Definition of Altitudinal Zonation Altitudinal zonation refers to the stratification of ecosystems in mountainous regions due to varying environmental conditions at different elevations, leading to distinct habitats that support specific vegetation and animal species. Factors of Altitudinal zonation Altitudinal zonation in mountainous regions is shaped by a myriad of environmental determinants. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Altruism among Animals - Definition and Evolution
What is Altruism? Evolution of Altruism The evolution of altruism has been a subject of fascination for socio-biologists, as seemingly selfless behavior can be observed in various animals, including humans. Over the past two decades, researchers have put forth three explanations to shed light on the evolution of altruistic behavior. The first explanation revolves around ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Amensalism - Definition, Types, Examples
What is Amensalism (Antagonism)? Amensalism is a sort of biological interaction in which one species harms another without incurring any costs or gaining any advantages. It is a form of interaction or competitive behaviour between organisms. Modes of Amensalism or Types of Amensalism 1. Competition Example 2. Antibiosis Example Examples of Amensalism In the Ocean, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Ames Test - Principle, Procedure, Result, Limitation, Applications
What is Ames Test? Ames test is a rapid biological assay which is used to determine whether a chemical compound can cause genetic mutations. It was developed by Bruce Ames in 1970s. It is used as an early screening test for carcinogenic property because chemicals causing DNA mutation are frequently carcinogenic. It is based on ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Amies Transport Medium - Composition, Principle, Preparation, Results, Uses
Amies Transport Medium, which contains charcoal to increase the viability and longevity of pathogenic organisms, is an improved transport medium. It is semisolid media that can be used in qualitative procedures to transport clinical swab specimens from the hospital to the laboratory. This modified Stuart's Transport Medium is made by adding charcoal to the medium and replacing the glycerophosphate. This modified medium produced a higher percentage positive results than Stuart's transport medium.
Amino Acid Formula
What is Amino Acid Formula? Amino Acid Formula Structure Amino acids are essential building blocks of proteins, and understanding their molecular structure is crucial in comprehending the functioning of biological systems. The amino acid formula and structure provide valuable insights into the composition and properties of these fundamental units. The molecular formula of an amino ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Amino Acids - Physical Properties, Structure, Classification, Functions
What are Amino Acids? Definition of Amino Acids Amino acids are organic compounds that serve as the building blocks of proteins. They consist of carbon, hydrogen, and nitrogen atoms and play essential roles in the proper functioning of living organisms. List of 20 Amino acids with the chemical formula Alanine C3H7NO2 Leucine C6H13NO2 Aspartic Acid ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Amniocentesis (Amniotic Fluid Test) - Principle, Procedure, Result
What is Amniocentesis? (Amniotic Fluid Test) Sample for Amniotic fluid Examination (Amniocentesis) The purpose of the test Amniocentesis, the examination of amniotic fluid, serves various purposes in prenatal diagnosis and assessment. The test provides valuable information about the fetus, allowing healthcare providers to make informed decisions regarding the health and well-being of both the mother ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Amoeba Cell - Labeled Structure, Characteristics, Movement, Nutrition, Reproduction, Disease, Habitat.
In this article, we will learn about the Habitat, structure, nutrition, characteristics, reproduction, locomotion of the Amoeba cell with diagram. Domain Eukaryota Phylum Amoebozoa Class Tubulinea Order Euamoebida Family Amoebidae Genus Amoeba Amoeba cell also known as the ameba or amoeboid. Amoeba is a unicellular eukaryotic organism which can alter their shape by extending and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Amoeba Staining - Principle, Methods, Procedure, Result, Uses
Amoeba staining is the process used in laboratories for observing the structural details of free-living and intestinal amoebae. It is needed because most amoebae are transparent in fresh samples, and their internal parts cannot be seen clearly without color contrast. It is the process that helps in identifying pathogenic forms like Entamoeba histolytica from non-pathogenic ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Amoeba Under The Microscope
What is Amoeba? Amoeba of Structure Amoebas, as eukaryotic organisms, possess a cellular structure that sets them apart in the microscopic world. Under the microscope, the architectural marvels of these single-celled wonders come to life, particularly when observed after staining. Their eukaryotic nature is characterized by a well-defined cell membrane encompassing their cytoplasm, housing the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Amoebiasis, Entamoeba Histolytica, Life cycle, Diagnosis
What is Entamoeba Histolytica? Definition of Entamoeba Histolytica Entamoeba histolytica is a single-celled, anaerobic parasitic organism that causes amoebiasis, a disease characterized by intestinal and sometimes extraintestinal infections. It exists in both active (trophozoite) and dormant (cyst) forms, the latter being responsible for environmental survival and transmission of the infection, particularly in tropical regions. The ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Amphibian - Characteristics, Origin, Morphology, Classification
What is Amphibian? Scientific Classification of Amphibian Category Classification Kingdom Animalia Phylum Chordata Clade Batrachomorpha Class Amphibia Order Anura, Caudata, Gymnophiona Amphibians are believed to have evolved from a population of osteolepid fishes during the later part of the Devonian period. These fishes began spending more time on land, moving from one pool to another. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Anabaena - Definition, Structure, Reproduction, Importance
What is Anabaena? Definition of Anabaena Anabaena is a filamentous cyanobacteria genus known for its nitrogen-fixing abilities and symbiotic relationships with certain plants, while also producing neurotoxins harmful to various organisms. History of Anabaena In the ancient annals of Earth’s story, the history of Anabaena and its fellow cyanobacteria weaves a tapestry that stretches back ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Anabaena Under Microscope
What is Anabaena? Requirement for Observation of Anabaena Under Microscope Procedure for observation of Anabaena Under Microscope This procedure outlines the steps for creating a wet mount slide and observing the prokaryotic alga Anabaena under a microscope. Structured Inquiry Step 1: Estimating Field of View Begin by placing a clear millimeter ruler on the microscope ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Anabolism - Definition, Stages, Functions, Regulation, Examples
What is Anabolism? Definition of Anabolism Anabolism is the metabolic process in which complex molecules are synthesized from simpler ones, typically requiring an input of energy. Stages of Anabolism Anabolism, a fundamental metabolic pathway, involves the synthesis of intricate molecules from simpler precursors. This process is central to the growth and maintenance of cells and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Anabolism vs Catabolism - Differences Between Anabolism and Catabolism
What is Anabolism? Anabolism Definition Anabolism is the metabolic process in which simpler molecules are synthesized into more complex ones, requiring energy input. Examples of Anabolic Reactions 1. Photosynthesis: Photosynthesis exemplifies an anabolic reaction quintessential to autotrophic organisms. Within the chloroplasts of plants, a sequence of biochemical transformations ensues, culminating in the conversion of carbon ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Anaerobic Blood Agar - Composition, Principle, Preparation, Results, Uses
Anaerobic blood agar is a solid media that can be used in qualitative methods for the isolation and cultivation anaerobic organisms. V.R. Dowell and T.M. Hawkins, Centers for Disease Control and Prevention Atlanta, Georgia. Anaerobic blood agar supports the growth of anaerobes with typical pigmentation, both fastidious and slow-growing, and other anaerobes that are of clinical significance.
Anaerobic Culture Media - Examples, Definition
Anaerobic Culture Media used in anaerobic bacteriology may be prepared in a fresh manner or bought from commercial vendors.
Media for anaerobic fermentation that is created in the laboratory should be used within two weeks after the time of preparation, as prolonged storage can degrade the quality of the medium due to peroxide accumulation and dehydration.
Analytical Balance - Diagram, Principle, Parts, Types, Uses
What is Analytical Balance? An Analytical Balance is a highly sensitive laboratory instrument that used for measuring very small mass with high precision and accuracy. Principle of Analytical Balance Types of analytical balance 1. Mechanical Analytical Balance – This type of balance works on beam and knife-edge mechanism. The sample weight is compared against known ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Anatomical Adaptations of Xerophytes
What are xerophytes? Morphological characteristics of xerophytes Xerophytes, adapted to arid environments, exhibit several distinctive morphological features to enhance their survival under water-scarce conditions. These adaptations are crucial for minimizing water loss and maximizing water use efficiency. The key morphological characteristics of xerophytes include: Types of Xerophytes Xerophytes, plants adapted to survive in arid environments, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Anatomical and Physiological Barriers of Immune System
What are Anatomical Barriers? Anatomical barriers serve as the first line of defense against invading microbes or parasites, preventing them from entering the body and causing infection. These barriers consist of physical structures that organisms must attach to and penetrate before gaining entrance into the body. Microbes or parasites can enter the body through active ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Ancylostoma duodenale - Structure, Life Cycle, Habitat, Characteristics
What is Ancylostoma duodenale? Characteristics of Ancylostoma duodenale Roundworms, belonging to the phylum Nematoda, encompass a diverse group of organisms with varied lifestyles. Among them, Ancylostoma duodenale stands out as a significant parasitic nematode, commonly known as the Old World hookworm. This species primarily infects the small intestine of its hosts, including humans, and is ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Anesthetic (MS222) Solution Preparation
Anesthetic Solution (Buffered MS222) is commonly used to temporarily immobilize fish and amphibians.
Angiosperms - Morphology, Classification, Life cycle, Economic and Ecological Importance
What are Angiosperms? Definition of Angiosperms Angiosperms are flowering plants that produce seeds enclosed within an ovary, typically forming a fruit. They have a well-developed vascular system for transporting water and nutrients and make up about 80% of all plant species, thriving in a wide range of environments. Characteristics of Angiosperms Classification of Angiosperms Angiosperms, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Animal Cell - Diagram, Structure, Types, Functions
Animal cell are considered to be the fundamental living species belonging to the kingdom Animalia. They are eukaryotic cells which means they possess an actual nucleus as well as organelles, which are special structures which perform various functions. Animal cells don't have specific organelles for plants, such as cell walls that support the plant cell or the chloroplasts, an organelle that is responsible for photosynthesis.
Animal Cell Culture - Types, Application, Advantages and disadvantages.
Tissue Culture is the term used to describe the process of removing tissues, cells or organs from either a plant or animal and their subsequent transfer into an artificial environment that encourages development.
Animal Models for Autoimmune Diseases
Animal models of autoimmune illnesses have provided invaluable insights into the mechanism of autoimmunity, human autoimmunity, and prospective therapies. Certain inbred animal breeds develop autoimmunity naturally, and autoimmunity can also be caused by certain experimental procedures. Autoimmunity Can Develop Spontaneously in Animals Autoimmunity Can Be Induced Experimentally in Animals
Anion Exchange Chromatography - Principle, Protocol, Applications
What is Anion Exchange Chromatography? Principle of Anion Exchange Chromatography The principle of anion exchange chromatography is based on the net surface charge of proteins, which changes with the pH and is determined by their isoelectric point (pI). The pI of a protein is the pH at which it carries no net charge. Below the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Anomer - Definition, Mechanism, Properties
What is Anomer? Definition of Anomers Anomers are a pair of stereoisomers or diastereomers that differ at the anomeric carbon, the carbon atom carrying the aldehyde or ketone functional group in the cyclic form of a sugar. Nomenclature of Anomers What is Anomerization? Mechanism of anomerization The mechanism of anomerization involves the interconversion between the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Anomer of Glucose
What is Anomer of glucose? Overview of Anomer Of Glucose Structure of Glucose Anomeric Carbon of Glucose Alpha-D-glucopyranose and beta-D-glucopyranose Significance The significance of the anomers of glucose lies in their impact on the chemical, physical, and biological properties of glucose. Here are some key points highlighting the significance of the anomers: In summary, the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Anther of a Flower – Types, Structure, and Functions
What is Anther? Definition of Anther The anther is the part of a flower’s stamen that produces and releases pollen grains, which contain the male gametes necessary for fertilization. Types of Anther Anthers exhibit considerable variation in structure and attachment, which influences their function and appearance in different plant species. Here, we outline the primary ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Antibiotic Resistance - Definition, Mechanism, Example.
Antibiotic resistance or Drug resistance to bacteria is a modern enemy of the new generation. Before we know about antibiotic resistance, we must first know what bacteria are? Bacteria is a type of germs, which is found inside or outside of human or animal bodies. Most of the bacteria are harmless, and some of them ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Antibiotics definition, Characteristics, Classification, Administration
Medicinal folklore was the primary treatment procedure for infections before the early 20th century. Over 2,000 years ago, a mixture of different antimicrobial properties was used to treat infections. The ancient Egyptians and ancient Greeks, and other ancient cultures used selected mold and plant materials for the treatment of infections. After the discovery of synthetic ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Antibody - Structure, Types, Functions and Properties
Antibodies are not found in a specific location, but anytime our immune system encounters antigen or a disease, B cells are activated and antibodies are quickly released into the bloodstream. These immunoglobulins undergo mitosis, resulting in cell division, and manufacture antibodies continually as a result of the production of additional cells. These antibodies linger in ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Anticodon - Definition, Principle, Functions, Examples
What is an Anticodon? Anticodons play a crucial role in protein production by ensuring that the correct amino acids are incorporated in the appropriate positions. These sequences of nucleotides are found within transfer RNA (tRNA) molecules. tRNAs act as carriers, bringing the specific amino acids that match the instructions encoded in the messenger RNA (mRNA) ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Antifungal Drug - Mode of Action
Treatment of an antifungal disease is quite difficult than a bacterial infection. The reason is quite clear that most of the eukaryotic fungal cells have a lot in common with human cells, so antifungal drugs can also damage the host body cells. Also, some fungi have detoxification properties that can modify antifungal drugs and as ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Antigen - Definition, Types, Structure, Detection, Properties
What is Antigen? Antigen Definition An antigen is a foreign molecule or substance that triggers an immune response in the body, leading to the production of antibodies. or An antigen is a substance that can stimulate an immune response in the body. It can be a molecule or a part of a molecule, such as ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Antigen Presenting Cells (APCs)
Antigen Presentation Definition Antigen-Presenting Cells Definition Types of Antigen-Presenting Cells Antigen-presenting cells fall into two categories: Antigen-presenting cells that contain MHC class II molecules, co-stimulatory molecules, and pattern recognition receptors are often referred to be “professional.” Non-professional APCs express molecules of MHC class I. 1. Professional Antigen-Presenting Cells a. Macrophages Activation of Macrophages For macrophages ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Antigen Processing and Presentation - Cytosolic Pathway and Endocytic Pathway
Antigen Processing and Presentation Types of Antigen Processing and Presenting Pathway Endogenous Antigens: Cytosolic Pathway 1. Peptides for Presentation Are Generated by Protease Complexes Called Proteasomes 2. Peptides Are Transported from the Cytosol to the Rough Endoplasmic Reticulum 3. Peptides Assemble with Class I MHC Aided by Chaperone Molecules Exogenous Antigens: Endocytic Pathway 1. Peptides ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Antigen Processing, and Presentation - MHC Class I, Class II,
What is Antigen Processing, And Presentation? Major histocompatibility complex Major histocompatibility complex I (MHC Class I) Structure of MHC Class I Major histocompatibility complex II (MHC Class II) Structure of MHC Class II Major Histocompatibility Class III (MHC Class III) Antigen Processing and Presentation 1. Cytosolic pathway – Endogenous antigen 2. Endocytic Pathway – Exogenous ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Antigen-Antibody Interaction Reaction - Definition, Types, Examples, Properties
Antigen-Antibody (Ag-Ab) Interaction refers to the biochemical reaction that occurs between antibodies and specific antigens when they come into close proximity, typically within a distance of several nanometers. This interaction plays a critical role in the immune response against foreign substances and pathogens in the body. The binding of antibodies to specific antigens is facilitated ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Antimicrobial Agent and Chemotherapy
Definition of Antimicrobial Agent Antimicrobial agent refers to those chemical or physical agents which are used to kill microorganisms or prevent their growth. There are present several types of microorganism which are responsible for infection or disease in animal or human body such as fungi, bacteria, virus, etc. Similarly, there are present different types of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Antimicrobial Susceptibility Testing (AST)
Antimicrobial Susceptibility Testing (AST) Techniques of Antimicrobial Susceptibility test Antimicrobial susceptibility tests in the laboratory can be done by using: Dilution susceptibility tests Disc diffusion susceptibility tests Kirby-Bauer NCCLS modified disc diffusion technique Stokes disc diffusion technique Disadvantages of antimicrobial susceptibility tests Susceptibility tests determine the antimicrobial effect against bacteria in conditions of laboratory (in ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Antiviral Chemotherapy
Vaccines have so far held the center position in efforts to stop viruses. They are inexpensive and secure, and the protection can last for a long time. But some viruses because of a number of reasons, aren't compatible with this method like retroviruses, influenza as well as rhinoviruses and arboviruses.
Antiviral Drug - Mode of Action
Antiviral drug referred to those drugs or chemical agents that are used for the treatment of viral infection. There are present several types of antiviral drugs that are used for the treatment of viral infections such as Amantadine, Acyclovir, Azidothymidine, Ganciclovir, Abacavir. Each of these antiviral drugs follows a different mechanism. The variation in their ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
AP Biology Study Notes - Get free AP Biology Study Notes
The AP Biology exam is a college-level biology test that is conducted by the College Board, and it is usually taken by high-school students who want to show that they have strong understanding in biology. It is the process where different parts of biology like molecules and cells, organisms, and ecosystems are studied, and the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
API (Analytical Profile Index) 20E Test Result, Principle, Procedure
What is API (Analytical Profile Index) 20E Test? The API (Analytical Profile Index) 20E test is a standardized biochemical identification system used for the identification of Enterobacteriaceae and other non-fastidious Gram-negative rods. It is developed as a miniaturized system where a number of biochemical reactions are carried out simultaneously in a single plastic strip. It ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Apomixis - Definition, Types, Functions, Examples
What is Apomixis? Definition of Apomixis Apomixis is a form of asexual reproduction in plants where seeds or embryos are produced without fertilization, resulting in offspring that are genetic clones of the parent plant. Characteristics of Apomixis Here is the Characteristics of Apomixis; Types of Apomixis Apomixis encompasses several distinct types of asexual reproduction in ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Apoptosis Pathway- Definition, Functions, Mechanism, Examples
Learn all about the apoptosis pathway: its definition, functions, mechanism, and examples in this comprehensive guide. Apoptosis, also known as programmed cell death, is a crucial process for maintaining healthy cell turnover and eliminating damaged or abnormal cells. Understanding the various components and steps involved in the apoptosis pathway can provide valuable insights into diseases ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Apoptosis vs. Necrosis - Definition, Types, Causes
Multicellular organisms experience a variety of cell development and death processes. Cellular death is crucial for the survival and development of all organisms. Our body is made up of several cell types situated in diverse body sections. There are two distinct methods by which a cell dies. Either the organism is exposed to an unfavourable ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Applications of Biotechnology in Different Sectors
What is Biotechnology? Biotechnology is the application of biological organisms, cells or their components in order to produce useful products. It is the branch of science where biology is combined with technology for human benefit. In this process living organisms are used to develop or modify products and improve different biological systems. The term biotechnology ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Applications of Fluorescence Spectroscopy
Fluorescence Spectroscopy is an analytical technique used to study the fluorescence emitted by a sample after excitation by light. It is also known as fluorimetry or spectrofluorometry. In this method, UV or visible light of definite wavelength is allowed to fall on the sample. The electrons of molecules absorb this energy and go to excited ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Applications of Plant Biotechnology
Plant biotechnology is the branch of applied science which deals with modification and improvement of plants using modern laboratory techniques. It is the process by which the genetic material of plant is identified and altered in order to develop desirable characters. This process is carried out in a more precise and faster way than traditional ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Applied Phycology - Role of algae in the environment, agriculture, biotechnology and industry
What is Phycology? Phycology, also known as algology, is the scientific study of algae. This branch of biology focuses on various aspects of algae, including their classification, physiology, ecology, and distribution. Here are some key points regarding phycology: Role of algae in the environment Algae play a crucial role in the environment, contributing to various ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Aquaculture - Definition, Types, Importance, Advantages
What is Aquaculture? Definition of Aquaculture Aquaculture is the farming of aquatic organisms, such as fish, shellfish, and aquatic plants, under controlled conditions to increase production for food, industry, and environmental restoration. Characteristics of Aquaculture Aquaculture is a highly productive practice with diverse benefits for agriculture, the environment, and the economy. Below are its key ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Aquatic Ecosystem - Definition, Types, Examples
What is the Aquatic Ecosystem? Features of Aquatic Ecosystem Detailed characteristics of the aquatic ecosystem are depicted in the graphic below — Types of Aquatic Ecosystem There are two types of Aquatic Ecosystems, including; 1. Freshwater Aquatic Ecosystem a. Lotic Ecosystems b. Lentic Ecosystems c. Wetlands 2. Marine Aquatic Ecosystem a. Ocean Ecosystems b. Coastal ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Arabinose Operon - Definition, Structure, Mechanism
What is Arabinose Operon? Structure of L-arabinose operon The linear structure of the arabinose operon consists of four unique genes and a catabolic active site. Structural genes Function of Structural genes Inducer Gene Regulatory gene Catabolic Active Site Operator Gene Promoter Gene In Summary Regulation of Arabinose Operon Negative regulation of araBAD Positive regulation of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Archaea - Habitat, Structure, Characteristics, Importance, Examples
What is Archaea? Definition of Archaea Archaea are a domain of single-celled prokaryotic organisms distinct from bacteria, characterized by unique genetic, metabolic, and cellular features, and often found in extreme environments. Habitat of Archaea The habitat of Archaea is remarkably diverse, spanning from some of the most extreme environments on Earth to more common and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Archaea vs Bacteria - Definition, Difference, Examples
What is Archaea? Examples of Archaea What is Bacteria? Examples of Bacteria Archaea vs Bacteria – Differences Between Archaea and Bacteria Bacteria and Archaea, both belonging to the prokaryotic realm, are single-celled microorganisms that lack a defined nucleus and other membrane-bound organelles. Despite these similarities, they exhibit distinct characteristics that set them apart in terms ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Archaea vs Bacteria vs Eukarya - 30 Differences, Definition, Examples
What is Archaea? Characteristics of Archaea Archaea are single-celled microorganisms that belong to the prokaryotic domain of life and share some characteristics with bacteria. However, they also possess unique features that distinguish them from bacteria. The main characteristics of Archaea include: These characteristics make Archaea unique and important microorganisms in the study of the evolution ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Archaebacteria - Definition, Types, Characteristics, Structure, Examples
What is Archaebacteria? Definition of Archaebacteria Archaebacteria, also known as Archaea, are a group of single-celled microorganisms that belong to one of the three domains of life. They are distinct from bacteria and eukaryotes in terms of their genetic, biochemical, and physiological characteristics. Archaebacteria are known for thriving in extreme environments such as hot springs, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Archaeopteryx A connecting link Between Reptiles and Birds (Aves)
What is Archaeopteryx? Discovery of Archaeopteryx Authenticity: Description of Archaeopteryx How Archaeopteryx is a connecting link Between Reptiles and Birds (Aves)? Archaeopteryx is considered a connecting link between reptiles and birds (Aves) due to its combination of characteristics from both groups. Here’s a description of how Archaeopteryx exhibits features that bridge the gap between reptiles ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Archegoniate - Unifying features of archegoniates, Transition to land habit, Alternation of generations
What is Archegoniate? Archegoniate is the group of plants in which the female sex organ called archegonium is present. It is a multicellular flask-shaped structure that is formed during the gametophyte phase, and it is the place where the ovum is produced and retained. It is the outer jacket layer of sterile cells that protect ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Are Viruses Living or Non-Living?
What are Viruses? Definition of Viruses Viruses are submicroscopic infectious agents that can only replicate within the living cells of a host organism, capable of infecting all forms of life. They consist of genetic material (DNA or RNA) encased in a protein coat and, in some cases, an external lipid envelope. Are Viruses Living or ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Arneth Count for Neutrophils - Principle, Procedure, Result, Uses
The Arneth count is a hematological method used for the classification of neutrophils based on the number of lobes present in the nucleus. It is the process in which neutrophils are grouped into different classes according to nuclear segmentation and this helps in understanding the age and functional status of the cells. In this method ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Artificial Selection - Theory, Types, Advantages, Examples
What is Artificial Selection? Artificial selection is a process by which humans are intentionally choosing certain organisms / traits for reproduction, it has been used for centuries actually even before the mechanism of genes was understood properly. In artificial selection, individuals that show desirable features (like color, yield, behavior etc.) are allowed to breed, while ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Ascaris lumbricoides - Morphology, Life Cycle, Diagnosis, Treatments, Prophylaxis
What is Ascaris lumbricoides? History and Distribution of Ascaris lumbricoides Ascaris lumbricoides has a long and complex history, having been recognized since ancient times. Its resemblance to the earthworm led to frequent confusion, contributing to its nomenclature. The specific name “lumbricoides” derives from the Latin word Lumbricus, meaning earthworm, highlighting this physical similarity. The following points ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Asexual Reproduction - Definition, Types, Advantages, Examples
What is Asexual Reproduction? Definition of Asexual Reproduction Asexual reproduction is a biological process in which a single organism produces offspring without the fusion of gametes, resulting in genetically identical progeny. Characteristics of Asexual Reproduction Asexual reproduction is a mode of reproduction that involves only one parent and does not require the fusion of male ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Asexual Reproduction in bacteria - Definition, Types, Advantages, Disadvantages
What is Asexual Reproduction? There are animals that are born with two parents. Some animals can come from a single parent. For instance, the Komodo dragon, as an instance is the only one with one mother and reproduces through parthenogenesis. Sexual reproduction is the process of generating offspring from only one parent. Are there male ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Asexual Reproduction in Plants - Definition, Methods
The type of reproduction that doesn’t require the union of female and male gametes, and creates individuals who have genetically identical traits to their parent is referred to as Asexual reproduction. In the article below we will be able to learn about the asexual reproduction of plants, the types of it techniques. Therefore, let’s start ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Ashdown’s Agar - Composition, Principle, Preparation, Results, Uses
Ashdown's medium can be described as a selective culture medium that allows for the identification and characterisation of Burkholderia pseudomallei (the bacteria which causes the disease melioidosis). The Ashdown's Medium was initially identified by LR Ashdown in 1979.
Aspergillosis - Causative Agent, Symptoms, Types, Treatment
Aspergillus species are responsible for a wide variety of diseases in humans, ranging from direct invasion to hypersensitivity reactions. The majority of human diseases are caused by Aspergillus fumigatus and Aspergillus niger, and less frequently by Aspergillus flavus and Aspergillus clavatus. Aspergillus, the mould (a type of fungus) that causes aspergillosis, is prevalent both inside ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Aspergillus clavatus - Morphology, Life Cycle, Pathogenesis
Habitat of Aspergillus clavatus Morphology of Aspergillus clavatus Cultural Characteristics of Aspergillus clavatus Culture media used for the growth of Aspergillus clavatus Life Cycle of Aspergillus clavatus Pathogenesis of Aspergillus clavatus Diseases caused by Aspergillus clavatus Treatment of Aspergillus clavatus diseases Prevention and control of Aspergillus clavatus FAQ
Aspergillus flavus - Definition, Structure, Characteristics, Habitat
Although Aspergillus flavus is widely distributed in soil and decaying plant material, it is most often associated with warm, humid agricultural environments where crops are produced. Aspergillus flavus is classified as a filamentous fungus within the genus Aspergillus. When stored grains (maize/peanuts,cottonseed) are exposed to moisture and heat, contamination is caused frequently by this fungus ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Aspergillus fumigatus - Characteristics, Structure, Pathogenesis
Kingdom: Fungi Division: Ascomycota Class: Eurotiomycetes Order: Eurotiales Family: Trichocomaceae Genus: Aspergillus Species: A. fumigatus Aspergillus fumigatus Aspergillus fumigatus can tolerates high temperatures and can thrives on decaying organic matter, Aspergillus fumigatus is widely distributed in soil, compost, indoor dust, and other environmental niches, where it is routinely detected by air sampling. Aspergillus fumigatus is classified ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Aspergillus niger - Structure, Habitat, Characteristics
Kingdom: Fungi Division: Ascomycota Class: Eurotiomycetes Order: Eurotiales Family: Trichocomaceae Genus: Aspergillus Species: A. niger Aspergillus niger is considered one of the most common species of the genus Aspergillus, which has been widely distributed in soil, decaying vegetation, and indoor environments. It is usually recognized as a black mold, and colonies are often appeared dark brown ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Assisted Reproductive Technology - Techniques, Importance
Wha do you mean by Assisted Reproductive Technology? Assisted Reproductive Technology (ART) refers to a range of medical procedures and techniques used to help individuals or couples conceive a child when they are facing fertility challenges. ART methods involve the manipulation of human eggs, sperm, or embryos in a laboratory setting to facilitate conception. There ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Atomic Absorption Spectrophotometer - Principle, Parts, Types
The Atomic Absorption Spectrophotometer (AAS) is referred to as an analytical instrument that measures the absorption of specific Light wavelength’s by free atom’s, which is required for determining metal concentration in a sample. It is considered a method where atoms in the Ground State absorbs radiation, leading to characteristic signals that are recorded by the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Atomic Force Microscope (AFM) - Principle, Parts, Procedure, Uses
The AFM, also known as the atomic force microscope (AFM) is a sort scanner probe. Its principal functions include measuring characteristics like height, magnetism and friction.
ATP Synthase - Structure, Mechanism, Inhibition, Diseases
What is ATP Synthase? ATP synthase is an essential enzyme complex responsible for the production of adenosine triphosphate (ATP), the primary energy currency in living cells. Often referred to as Complex V in the oxidative phosphorylation pathway, ATP synthase plays a critical role in cellular respiration and photosynthesis, utilizing the proton gradient generated by the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Auramine-Rhodamine Staining - Principle, Procedure, Result, Applications
Auramine–Rhodamine staining is the process used to demonstrate acid-fast bacilli from clinical specimens and it is considered a modified form of the Acid-Fast staining technique. It is the process where fluorochrome dyes bind with the mycolic acid of the bacterial cell wall and it is visualized under a fluorescent microscope. It is the preferred screening ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Autoclave - Principle, Parts, Procedure, Mechanism, Uses
Autoclave is a sterilizing instrument that is used to sterilize culture media, glasswares, surgical instruments and other materials by steam under pressure. It is a strong metallic chamber with a tight lid. The materials are kept inside the chamber. Then steam is passed into the chamber after removing air. Autoclave works at 121°C temperature and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Autoclave Bag - Application, Types, Applications, Advantages
Autoclave bag is a specialized single-use flexible container that is used to hold biohazardous waste, medical equipment and laboratory materials during steam sterilization process. It is made up of temperature-tolerant and puncture-resistant plastic materials like high-density polyethylene (HDPE), polyamide or virgin polypropylene. These materials allow the bag to withstand high temperature of autoclave without melting ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Autoclave Validation Methods - Objective, Procedure, Result
Autoclave validation is needed to prove that the autoclave is consistently giving effective sterilization of materials to a required Sterility Assurance Level (SAL). Sterility cannot be guaranteed only by testing the finished product. So, the process has to be validated and documented. Validation is done to check the correct physical parameters like temperature, pressure, and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Autoimmune Disease - Definition, Types, Diagnosis, Treatment, Examples
What is Autoimmune Disease? Signs and symptoms of Autoimmune Disease The signs and symptoms of autoimmune diseases can vary depending on the specific type of disease and the affected body part. While some autoimmune diseases may share similar symptoms, others have distinct manifestations. It is also possible for an individual to have multiple autoimmune diseases ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Autoimmunity - Definition, Types, Tolerance, Pathogenesis, Mechanisms
What is Autoimmunity? General Features Of Immunologic Tolerance Autoimmunity, encompassing more than 80 different conditions, affects approximately 5% of the population. While each autoimmune disease may have unique characteristics, there are several common features shared among them: Autoimmune diseases can be classified into two broad categories based on the nature of the targeted self-antigens: organ-specific ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Automated Cell Counter - Principle, Types, and Applications
Automated Cell Counter is an analytical laboratory instrument that is used to count the number and concentration of cells in a given sample. It is used to measure cell viability also, with minimum human interaction. It replaces manual counting by using physical and optical sensors. So it gives more accurate and reproducible result. Automated cell ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Autonomic nervous system - Definition, Structure, Functions
What is Autonomic nervous system? Definition of Autonomic nervous system The autonomic nervous system (ANS) is a division of the nervous system responsible for regulating involuntary bodily functions such as heart rate, digestion, respiration, and sexual arousal. It consists of the sympathetic, parasympathetic, and enteric divisions, which work together to maintain homeostasis and respond to ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Autotrophs - Definition, Types, Importance, Examples
What is An Autotroph? Definition of Autotroph An autotroph is an organism that can produce its own complex organic compounds (like carbohydrates) using simple substances such as carbon dioxide, typically through processes like photosynthesis or chemosynthesis, without relying on external sources for carbon or energy. Types of Autotrophs Autotrophs, which are organisms that make their ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Aves - Definition, Characteristics, Classification
Characteristics of Aves Aves, the class of birds, possesses numerous distinctive characteristics that set them apart from other animals. Here is a compilation of their key traits: These characteristics collectively make birds a unique and diverse group of animals, well-adapted to various environments and exhibiting a fascinating array of biological features. Flight Adaptations in Class ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Axon - Definition, Structure, Types, Functions
What is Axon? Definition of Axon An axon is a long, slender projection of a nerve cell (neuron) that transmits electrical impulses, known as action potentials, away from the neuron’s cell body to other neurons, muscles, or glands, facilitating communication within the nervous system. Characteristics features of Axon Axons are vital structures in the nervous ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
B cell or B lymphocytes - Definition, Function, Types
What are B cells or B lymphocytes? Definition of B cell (B lymphocyte) A B cell, or B lymphocyte, is a type of white blood cell that produces antibodies and plays a crucial role in the immune response against infections. Morphology of B cell (B lymphocyte) Structure of B cell (B lymphocyte) Stage-specific Markers Antigen-binding ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
B. Sc. Honours Microbiology Syllabus under CBCS
Structure of B. Sc. Honours Microbiology under CBCS Core Course C-1: Introduction to Microbiology and Microbial DiversityC-2: BacteriologyC-3: BiochemistryC-4: VirologyC-5: Microbial Physiology and MetabolismC-6: Cell BiologyC-7: Molecular BiologyC-8: Microbial Genetics and GenomicsC-9: Environmental MicrobiologyC-10: Food and Dairy MicrobiologyC-11: Industrial MicrobiologyC-12: ImmunologyC-13: Medical MicrobiologyC-14: Recombinant DNA Technology Discipline Centric Elective (Any Four) DSE-1: BioinformaticsDSE-2: Microbial BiotechnologyDSE-3: ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Bacillus cereus - Habitat, Morphology, Pathogenicity, Virulence Factors
Domain: Bacteria Phylum: “Firmicutes” Class: Bacilli Order: Bacillales Family: Bacillaceae Genus: Bacillus Species: B. cereus Definition of Bacillus cereus Bacillus cereus is a gram-positive, rod-shaped bacterium that produces toxins leading to foodborne illnesses. It can cause two main types of gastrointestinal disorders: emetic (vomiting) syndrome and diarrheal syndrome. This bacterium is commonly found in soil ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Bacitracin Susceptibility Test - Principle, Procedure, Result
The Bacitracin susceptibility test is one of the antimicrobial disc tests used to distinguish between group A and other -hemolytic Streptococci.
Backcross Method – Procedure, Applications, Advantages, Disadvantages
What is Backcross Method? Definition of Backcross Method The backcross method is a breeding technique where a hybrid or progeny is repeatedly crossed with one of its original parent plants to transfer specific traits from the donor parent to the recipient parent while preserving the recipient’s original characteristics. Requirements of a backcross programme To effectively ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Bacterial Capsule - Definition, Functions, Composition, Types, Demonstration, and examples.
The bacterial capsule is considered as the most important virulence factor among all factors that are present within the bacteria. Some examples of a capsulated strain are Neisseria meningitidis, Streptococcus pneumoniae, Klebsiella pneumoniae, Haemophilus influenzae, Escherichia coli, and group B streptococci al of them are virulent. While the Nonencapsulated mutated strain of these organisms is ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Bacterial Cell Wall Structure and Composition
What is Cell Wall? Definition of Cell Wall A cell wall is a rigid, protective layer that surrounds the cell membrane in plants, fungi, algae, and some prokaryotes, providing structural support, shape, and protection. Bacterial Cell Wall Types Based on the result of gram staining it is stated that there are two types of cell ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Bacterial Conjugation - Definition, Steps, Importance Examples
What is Bacterial Conjugation? Bacterial Conjugation Definition Bacterial conjugation is a process of genetic exchange where DNA is transferred from a donor cell to a recipient cell through direct contact, typically mediated by a pilus. It is a key mechanism of horizontal gene transfer, often involving plasmids, and contributes to genetic diversity and the spread ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Bacterial Culture Media Classification, Ingredients, Functions and Preparation.
What is Bacterial Culture Media? Ingredients of Bacterial Culture Media The formulation of bacterial culture media is a precise science that involves combining various ingredients to create an environment conducive for the growth and study of bacteria. These ingredients serve specific purposes, from providing essential nutrients to enabling the differentiation of bacterial species. Understanding these ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Bacterial Culture Technique
Microbiological cultures, also known as Microbial culture is the technique of generating microbial species by the process of letting them reproduce in a conditions in a monitored laboratory conditions. Microbiological cultures are fundamental and essential diagnostic methods that are employed as research tools within molecular biology. The term “culture” could be used to describe the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Bacterial Food Poisoning - Symptoms, Prevention, Causes & Treatment.
Facts of Bacterial Food Poisoning What is Bacterial Food Poisoning? Causes of Bacterial Food Poisoning Bacterial food poisoning mainly occurs by eating contaminated foods. the contamination of food with the bacterial toxin or chemicals can be occurred by; Symptoms of Bacterial Food Poisoning If you have bacterial food poisoning, you probably won’t go unnoticed. Symptoms ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Bacterial Growth and Different Environmental Factors Affect Bacterial Growth
Environmental Factors Affect Bacterial Growth In addition to knowing the proper nutrients for the cultivation of bacteria, it is also necessary to know the physical environment in which the organisms will grow best. Just as bacteria vary greatly in their nutritional requirements, so do they exhibit diverse responses to physical conditions such as temperature, gaseous ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Bacterial Growth Curve - Definition, Phases, Factors, Significance
What is Bacterial Growth Curve? A bacterial growth curve is the graphical representation that shows the increase and decrease in number of bacterial cells in a population with respect to time. It is studied when bacteria are grown in a closed system or batch culture where no fresh nutrients are added and waste products are ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Bacterial Growth Curve Protocol - Result, Uses
What is Bacterial Growth Curve? A bacterial growth curve is the graphical representation of the growth of a bacterial population with respect to time under a closed culture system such as a culture tube or flask. It is the pattern that shows how the number of bacterial cells increases and decreases during growth. Bacteria reproduce ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Bacterial Secretion Systems - Definition, Types, Mechanism, Importance
What is Bacterial Secretion Systems? Definition of Bacterial Secretion Systems Bacterial secretion systems are specialized protein complexes in bacterial cell membranes that transport substances, primarily proteins, from the bacterial cell to its environment or into host cells, facilitating processes such as pathogenesis and environmental adaptation. Classes of bacterial protein secretion systems Bacterial protein secretion systems ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Bacterial Smear - Principle, Preparation Steps, Uses, Limitations
A bacterial smear is a thin layer of bacterial cell/culture which is placed on a clean, grease-free microscopic slide to observe a clear image under a microscope.
Bacterial toxin: Definition, Types, Example.
When a microorganism starts to synthesize toxin, they are called microbial toxins, such as bacteria and fungi. There are few bacteria that can produce the most potent natural toxins such as Botulinum neurotoxins. However, the bacterial toxin has some medical importance that is why they are used in medical science and research. What Is Toxin? ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Bacterial Transduction - Definition, Types, Steps, Examples
Transduction refers to the transfer of a part of DNA between two bacteriums via a bacteriaophage.
Transduction is mediated by viruses.
Bacterial Transformation - Definition, Principle, Steps, Examples
What Is Bacterial Transformation? Bacterial Transformation Definition Bacterial transformation is the process by which a bacterium takes up free DNA from its environment and incorporates it into its genome, potentially expressing new traits. Principle of Bacterial Transformation Types of Bacterial Transformation Bacterial transformation can occur naturally or be induced artificially. Both forms allow bacteria to ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Bacterial Transformation Protocol
Bacterial transformation is a process wherein bacteria naturally modify their genetic makeup by incorporating foreign genetic material into their own genome. This phenomena has significant ramifications for health care, agriculture, and environmental science and has evolved into a fundamental genetic engineering tool. Scientists can create life-saving medications, alter crops for improved features, and speed up ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Bacteriophages - Definition, Morphology, Life cycle, Significance
Viruses that infect bacteria are known as phages or bacteriophages. Twort (19l5) described a degenerative alteration in staphylococcal colonies isolated from calf lymph that was transmissible serially via application of culture filtrates from the original growth. d’Herelle (1917) observed that the filtrates of dysentery patient faeces cultures produced transmissible lysis of a dysentery bacillus broth ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Baird Parker Agar - Composition, Principle, Preparation, Results, Uses
Baird Parker Agar was created by Baird Parker using the Tellurite–glycine formulation of Zebovitz et al. It allows for a good differentiation between coagulase positive strains.
Baltimore Classification System of Viruses
The virus uses the host’s complete system for protein translation because they lack translational machinery. Hence, the Baltimore classification system is based on this machinery how viruses use the host mechanism. Messenger RNA (mRNA) is the main focus of this classification system. In the beginning, there were six classes of viruses in Baltimore classification system ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Baran Pipette Column - Parts, Procedure, Types, Uses
Baran pipette column is a microscale variation of flash chromatography which is used for rapid purification of small reaction mixtures. It is mainly used when the amount of sample is low, generally 10 to 500 mg. This method was designed by Baran laboratory for making purification faster and more efficient. It is based on the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Basidiomycetes - Life cycle, Characteristics, Significance, Mycelium and Examples
Basidiomycetes are harmful as well as useful. Their attack foods and ornamental plants, cause many different diseases including seedling diseases, wood rots, root and stem rots, seed diseases (smuts), and rusts, on the other hand, it used as humans foods.
Basophil - Definition, Mechanism, Structure, Functions
Basophils are an immunological cell type that release enzyme-containing granules during allergic responses and asthma crises. Basophil is a type of white blood cell that, together with neutrophils and eosinophils, belongs to the granulocytes category. They contain several chemicals, including histamine and heparin. As part of the body’s immune response, basophils degranulate (split open) to ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Bath Solution (Ca2+/Mg2+ Free) Preparation
Bath Solution Preparation To prepare 1L of Bath Solution (Ca2+/Mg2+ Free) the following components are required; Component Amount Concentration KOH (mw: 56.11 g/mol) 7.854 g 0.14 M HEPES (mw: 238.3 g/mol) 4.766 g 0.02 M KCl (mw: 74.55 g/mol) 149 mg 0.002 M EGTA (mw: 380.35 g/mol) 1.902 g 0.005 M Methanesulfonic acid (mw: 96.11 ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
BCYE Agar - Composition, Principle, Preparation, Results, Uses
In 1978, Feeley et al developed a medium for isolating Legionella species. They later modified it by replacing casein hydrolysate with beef extract and starch with activated carbon and naming it Charcoal Yeast extract (CYE) Agar. A further modification was made by Pasculle et al in 1980 by the addition of ACES (N-2-acetamido-2-aminoethane sulfonic acid) buffer in order to maintain the proper pH for optimal growth designated as BCYE for Buffered Charcoal Yeast Extract. Edelstein et al modified the medium in 1981 by adding potassium salt to alpha-ketoglutaric acids, which increased the medium's sensitivity. It is used in primary isolation and cultivation of Legionella species. It is recommended to be used in the cultivation and primary isolation of Legionella spp.
Bead Homogenizer - Principle, Parts, Procedure, Uses
Bead Mill Homogenizer (Bead Homogenizer) is a laboratory device that is used to rapidly break and mix biological or industrial samples into a uniform mixture. It works by placing the sample in a closed tube with small grinding beads. These beads may be made up of glass, ceramic, or stainless steel. During the process, the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Beaker - Definition, Types, Features, and Applications
Beaker is a cylindrical laboratory container with flat bottom and small spout at the top. It is one of the common glassware used in laboratory for mixing, heating, stirring and keeping liquids for short time. The spout is used to pour the liquid easily and in controlled way. It is usually made up of borosilicate ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Beer Production
Health Benefits of Beer Beer provides numerous health benefits when drank in moderation. Among these fascinating health advantages are the following: 1. Anti-cancer properties 2. Reduced risk of cardiovascular diseases 3. Diabetes 4. Prevention of anemia 5. Hypertension 6. Anti-aging properties 7. Gallstones 8. Prevention of dementia and coronary disease 9. Aids digestive system 10. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Beer-Lambert Law - Definition, Derivation, and Limitations
The Beer-Lambert Law is a handy principle used to understand how light interacts with substances, like liquids or gases. Imagine shining a flashlight through a glass of colored water—some of the light gets absorbed, right? This law basically says that the amount of light absorbed depends on three things: how thick the glass is (path ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Bench Top Centrifuge - Principle, Procedure, Types, Parts, Uses
A bench top centrifuge is a laboratory instrument which is used for separation of components present in a liquid sample based on their density. It is a compact device that is designed to be placed on laboratory bench and is commonly used in routine laboratory work. It is the process in which centrifugal force is ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Benedict’s Test - Principle, Reagents, Procedure, Result, Limitation
Benedict's test is a chemical test that is used to test for the presence of reduced sugars within an analytical test. Thus, simple carbohydrates that contain an aldehyde or free ketone functional group are detected using this test. The test is basing itself upon Benedict's Reagent (also called Benedict's solution) which is a complex mix of sodium carbonate, sodium citrate, and the pentahydrate of copper(II) Sulfate.
Best and Top Books for Microbial Genetics and Molecular Biology
Top Selling Books for Microbial Genetics and Molecular Biology
Best Book for BHU PET Applied Microbiology
If you are searching for best Books for BHU PET Applied Microbiology, than here is the list; 1. Prescott’s Microbiology by Joanne Willey, Linda Sherwood Adjunt Professor Lecturer, Christopher J. Woolverton Professor The author team of Prescott’s Microbiology continues the tradition of past editions by providing a balanced, comprehensive introduction to all major areas of microbiology. This ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Best books for CSIR NET Life Science
Hey, if you are searching for best books to prepare for csir net life sciences, then here it is. This article contains a list of best-recommended books for CSIR NET Life Science. You can directly click on the book name and buy it from the Amazon store. Topic Wise Books for CSIR NET Life Science ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Best Books for Medical Microbiology and Immunology
In this article we will discuss about top and best books for Medical Microbiology and Immunology. 1. Ananthanarayan and Paniker’s Textbook of Microbiology Rating: 4.5/5 stars Ananthanarayan and Paniker’s Textbook of Microbiology has firmly established itself as a cornerstone in the field of medical microbiology since its first publication in 1978. With the release of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Best Books for Microbiology B.Sc 2nd Semester and Biochemistry
In this article, I will share the list of top and best microbiology books for B.sc 2nd semester and biochemistry. All these books are recommended by CBCS. In B.sc 2nd semester of microbiology, you will study about Bioenergetics, Carbohydrates, Lipids, Proteins, Enzymes, Vitamins. All these topics you will find in these listed books. Here is ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Best Microbiology Books For B.Sc 1st Year Students and Bacteriology
Hey, here I am sharing the best microbiology books for B.Sc 1st Year Students. All of these books are necessary for first-year students. I also followed these books during my B.Sc and also follow to write my articles. Many of you think that microbiology is a boring memorization subject, but believe me, it’s a very ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Beta (β) Lactamase Test - Principle, Procedure, Results
Many bacteria produce a group of enzymes known as beta-lactamases that are mediated through genes in plasmids or the chromosomes. Beta-lactamase can be a constant process or it may be triggered through contact with antimicrobials. Beta-lactamases hydrolyze (and consequently inhibit) the beta-lactam ring of many Cephalosporins as well as penicillins. Beta-Lactamase Test is a rapid test to determine the presence of beta-lactamase , an enzyme that is produced by the strains from Staphylococcus aureus Neisseria gonorrhoeae, Branhamella catarrhalis as well as Haemophilus influenzae.
Beta-oxidation of Fatty Acid - Definition, Steps, Importance
What is Beta-oxidation? Definition of Beta-oxidation Beta-oxidation is the metabolic process in cells where fatty acids are broken down into smaller units called acetyl-CoA, generating energy in the form of ATP. Location of Beta-Oxidation Beta-oxidation, a crucial metabolic pathway for the breakdown of fatty acids, occurs in specific cellular locations depending on the organism’s type. In ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Bial’s Test- Principle, Procedure, Result, Uses
Bial’s test is a chemical test used for detection of pentoses (5-carbon sugars) and it is used to distinguish pentoses from hexoses. It was developed by German physician Manfred Bial. It is also used in laboratory for estimation of RNA because RNA contains pentose sugar ribose. It works on principle of acid dehydration of sugars. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Bile Esculin Agar (BEA) - Principle, Composition, Preparation, Results, Uses
What is Bile Esculin Agar (BEA)? Bile Esculin Agar (BEA) Composition Bile Esculin Agar (BEA) contains the following ingredients per liter of the medium: The final pH of the medium, when measured at 25°C, is approximately 6.6±0.2. These specific components and their concentrations are carefully selected to create a medium that is selective and differential ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Bile Esculin Test Principle, Procedure, Result, and application.
Bile Esculin test The Bile Esculin test is a biological test that is used to distinguish Enterococci from Group D Streptococci from non-group D viridans group Streptococci by their capacity to hydrolyze esculin. A variety of organisms are capable hydrolyzing esculin. But only a handful of them can do it when they are surrounded by ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Bile Solubility Test - Principle, Procedure, Result, Uses
It is a biochemical test used in microbiology for the identification of Streptococcus pneumoniae from other alpha hemolytic streptococci. It is mainly based on the ability of pneumococcal cells to undergo lysis in presence of bile salts. This test is commonly performed in diagnostic laboratories for confirmation of pneumococcal isolates. It is the process in ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Bilobed Anther – Structure, Function, Diagram
What is a Bilobed Anther? Structure of a Bilobed Anther The structure of a bilobed anther is essential to understanding its role in plant reproduction. Here’s a detailed breakdown of its components: Transverse cross-section of a Bilobed Anther A transverse cross-section of a bilobed anther provides a detailed view of its internal structure, revealing multiple ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Binary fission - Definition, Types, Steps, Examples
Definition of binary fission (What is binary fission?) Binary fission can be described as a kind of sexual reproduction in which one living cell, or organelle expands twice its size, and then splits into two identical cells, which means that each of the daughter cells can be expected to grow to what size as the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Binomial Nomenclature - Definition, Rules, Examples, Advantages, Disadvantages
Binomial nomenclature means a system that is used to provide a unique name to organisms, including plants, animals, microorganisms, and other living things. This naming system makes it easier to understand them better and also separates each species from others. Therefore a universally accepted naming system is essential. Binomial nomenclature definition Binomial nomenclature is a ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Bioaccumulation - Definition, Mechanisms, Applications
What is Bioaccumulation? Definitions of Bioaccumulation Bioaccumulation (increase in chemical concentration) is the process of chemical accumulation in an organism over time. Bioaccumulation, as defined by the International Union of Pure and Applied Chemistry, is the accumulation of a chemical in an organism due to direct uptake from the environmental matrix (bioconcentration) and uptake from ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Bioaerosol - Definition, Types, Collection, Transmission
What is Bioaerosol? Types of bioaerosols 1. Fungi 2. Bacteria 3. Viruses 4. Pollen Collection Methods of Bioaerosol/Deposition of Bioaerosol Bioaerosols are primarily collected via collection plates, electrostatic collectors, mass spectrometers, and impactors. Other experimental approaches are also utilised. In comparison to other PC filter alternatives, Polycarbonate (PC) filters have produced the most accurate bacterial ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Biochemistry Crossword
Biochemistry is the branch of science that explores the chemical processes and substances that occur within living organisms. It combines principles from both biology and chemistry to study biomolecules like proteins, nucleic acids, carbohydrates, and lipids. Biochemists investigate how these molecules interact, how they contribute to the structure and function of cells, and how metabolic ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Biodegradation - Definition, Steps, Factors, Applications
What is Biodegradation? Definition of Biodegradation Biodegradation is the natural process by which microorganisms break down organic matter into simpler substances, such as carbon dioxide, water, and minerals. Examples of Some biodegradable pollutants Biodegradable pollutants encompass a range of highly toxic synthetic compounds that have been introduced into the environment over time. Some examples of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Biodiversity - Definition, Types, Importance, Conservation
Biodiversity is a term that might sound complicated, but it’s actually a simple and really important idea. Imagine you’re walking through a forest. You see different types of trees, hear various birds singing, and spot all sorts of insects and animals. All these different forms of life, including the plants, animals, and microorganisms, as well ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Biodiversity Hotspots - Definition, Criteria, Importance, Examples
Biodiversity hotspots are regions packed with an extraordinary variety of plant and animal life found nowhere else on Earth—but they’re also in serious trouble. To qualify as a hotspot, an area must have at least 1,500 unique plant species and have already lost over 70% of its original natural habitat due to human activities like ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Biogeny (Formation of Primitive Life)
What is Biogeny (Formation of Primitive Life)? 1. Formation of nucleic acids and nucleoproteins The formation of nucleic acids and nucleoproteins considered as one of the key transition in Biogeny where information molecules begin to store and transmit life instructions. It started after Chemogeny produced small organic monomers like nucleobases, sugars, phosphates, etc. Prebiotic synthesis ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Biogeochemical Cycle - Definition, Importance, Examples
What is Biogeochemical Cycle? Definition of Biogeochemical Cycle A biogeochemical cycle is the movement and transformation of chemical elements and compounds between living organisms, the atmosphere, and the Earth’s crust, involving the cycling and recycling of nutrients and elements essential for life. Types of Biogeochemical Cycles Biogeochemical cycles are classified into two main types: gaseous cycles ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Bioinformatics - Definition, Introduction, Purpose, Applications
What is Bioinformatics? Definition of Bioinformatics Bioinformatics is the interdisciplinary field that combines biology, computer science, and mathematics to store, analyze, and interpret large-scale biological data, such as DNA, RNA, and protein sequences, through the development of computational tools and algorithms. History of Bioinformatics Aim of Bioinformatics The primary goals of bioinformatics are outlined as ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Biological Clocks - Circadian rhythms, Tidal rhythms, Lunar rhythms, Jet lag, Entrainment
What is Biological Clocks? Biological clocks are the internal timing system present in living organisms, and it is the process by which rhythmic changes occur in a regular pattern. It is an endogenous mechanism that runs for about 24 hours, and this rhythmic behaviour is referred to as circadian rhythm. The rhythm continues even in ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Biological Consequences of Complement Activation
The Membrane-Attack Complex Can Lyse a Broad Spectrum of Cells Cleavage Products of Complement Components Mediate Inflammation C3b and C4b Binding Facilitates Opsonization The Complement System Also Neutralizes Viral Infectivity The Complement System Clears Immune Complexes from Circulation Complement Deficiencies C1q, C1r, C1s, C4, and C2 Deficiencies C3 deficiencies Homozygous deficiencies Congenital deficiencies The majority ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Biological Fitness - Definition, Influence of Factors, Examples
What is Biological Fitness? Definition of Biological Fitness Biological fitness is the ability of an organism to survive, reproduce, and pass on its genes in a specific environment. It reflects how well an organism’s traits help it adapt to environmental conditions, ensuring the continuation of its genetic material across generations. Distinguishing Biological Fitness from Exercise ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Biological Macromolecules - Types, Structure, Functions, Examples
What are Biological Macromolecules? Definition of Biological Macromolecules Biological macromolecules are large, complex molecules essential for life, typically classified into four main categories: carbohydrates, proteins, nucleic acids, and lipids. They are composed of smaller units called monomers, which are linked together to form polymers. These macromolecules play crucial roles in biological processes, including energy storage, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Biological Magnification -Definition, Causes, Effects
What is Biological Magnification/Biomagnification? Biomagnification or biological magnification is the process by which certain chemicals accumulate in living organisms to a greater concentration than in the non-living environment. Causes of Biological Magnification/Biomagnification The principal causes of biomagnification are as follows: 1. Agriculture 2. Organic Contaminants 3. Industrial Activities 4. Mining Activities in the Ocean Process ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Biological Membrane - Classification, Structure, Functions
Membranes are thin, flexible layers that act like barriers or filters, separating different spaces or substances while allowing certain things to pass through. Think of them as sheets or films—some natural, others human-made. In living things, cell membranes are crucial. They wrap around cells, controlling what enters or exits, like nutrients in and waste out. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Biological Organization - History, Levels, Importance
What do you mean by Biological Organization? The Historical Origins of Biological Organization The concept of biological organization has deep roots in the history of philosophy and science. From ancient Greek thought to the rise of modern biology, the idea of hierarchy in nature has evolved significantly. Early frameworks, such as Aristotle’s grading of living ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Biological Oxygen Demand (BOD) - Definition, Importance, Measurement
Biological oxygen demand refers to the amount of oxygen required by bacteria and other microorganisms to decompose organic matter under aerobic (oxygen present) conditions at a certain temperature (BOD). The greater the concentration of organic contaminants in the water, the greater the oxygen demand of the bacteria. Consequently, the level of contamination in a body ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Biology Word Search Puzzle on Biochemistry
Explore the fascinating world of biochemistry with our interactive word search game! Find and highlight key terms related to the study of chemical processes within living organisms. Challenge yourself with words like “enzyme,” “protein,” and “nucleotide” as you dive into the essential building blocks of life. Perfect for students and enthusiasts alike, this game is ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Biometrics, Numerical taxonomy and Cladistics
What is Biometrics? What is Numerical Taxonomy? Principle of Numerical Taxonomy The principle of numerical taxonomy, as articulated by Sneath and Sokal (1963), comprises several key tenets that guide its application in classifying and analyzing organisms. These principles emphasize a systematic and empirical approach to taxonomy, leveraging mathematical methods to ensure objectivity and accuracy. These ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Biomolecule - Definition, Types, Structure, Examples, Significance
What are Biomolecules? Definition of Biomolecule A biomolecule is any organic molecule that is essential for life and is involved in the structure, function, and regulation of the cells and tissues in living organisms. Common types of biomolecules include carbohydrates, lipids, proteins, and nucleic acids. Types of Biomolecules – Four Major Types of Biomolecules Biomolecules ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Bioprocess Engineering - Definition, Types, Uses
Bioprocess engineering involves the design of, operation, management, and optimizing biochemical processes that involve different biological pathways, or reactions that are mediated through living cells from plants, animals and microorganisms as well as enzymes in controlled conditions to facilitate the efficient biotransformation process of raw materials into a variety of goods at the appropriate scale.
Bioreactor - Types, Design, Parts, Applications, Limitations
A bioreactor is the vessel in which biological reactions is carried out in controlled conditions. It is the process where microorganisms, plant cells or animal cells are allowed to grow and produce useful products. It is designed as a closed container in which temperature, pH, dissolved oxygen (DO) and nutrient level is maintained with the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Bioremediation - Definition, Types, Application
What is Bioremediation? Bioremediation is a process used to clean up and detoxify polluted sites by utilizing microorganisms, plants, or their enzymes to break down and degrade environmental contaminants. It involves the natural or deliberate introduction of these biological agents to enhance the rate of degradation and transformation of pollutants. The concept of bioremediation includes ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Biosafety Cabinet - Definition, Classification (Class I, II, III), Working Mechanism, Application, Features.
What is Biosafety Cabinet? A biosafety cabinet (BSC), also known as a biological safety cabinet or microbiological safety cabinet, is a specialized laboratory workspace designed to handle materials contaminated with or potentially contaminated with pathogens requiring a specific biosafety level. The primary purpose of a biosafety cabinet is to provide a safe working environment for ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Biosafety Guidelines - Biosafety guidelines and regulations
Biosafety guidelines provide guidelines, policies, and procedures that must be observed by all personnel who work in facilities handling microbiological agents, such as bacteria, viruses and parasites, fungi and prions. These guidelines are required for all institutions, including clinical and microbiological labs, biomedical research laboratories, teaching and training laboratories, and other healthcare institutions (e.g. hospitals, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Biosafety levels (BSL-1, BSL-2, BSL-3 and BSL-4) - Primary and Secondary Barriers, Agents
A biosafety level (BSL) refers to a specific set of biocontainment measures designed to isolate hazardous biological agents within a controlled laboratory environment. This document outlines the necessary protective measures required in a laboratory environment to safeguard employees, the ecosystem, and the community from infectious agents. Historical Overview The classification of four levels of biosafety ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Biosensors - Principle, Types, Characteristics, Applications
What are Biosensors? Definition of Biosensors A biosensor is a device that detects biological changes and converts them into an electrical signal, typically by combining a biological sensing element with a transducer for applications like medical diagnostics or environmental monitoring. Components of Biosensors Biosensors consist of several key components that work together to detect biological ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Biotechnology Crossword Puzzle
Biotechnology is a broad field of science that involves using living organisms, cells, or biological systems to develop products, processes, or technologies that benefit humanity. It combines principles of biology, chemistry, physics, engineering, and computer science to solve problems in various industries, such as healthcare, agriculture, and environmental protection. Constructed by biologynotesonline.com with the free ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Biotic Factors - Definition, Types, Examples
Definition of Biotic Factor Biotic factors are the living components or variables that have an effect on an ecosystem or other species residing in that ecosystem. Biology definition A biotic factor is a factor produced by a live organism or any living component in its surroundings as a result of the organism’s actions. Biotic factors ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Biotic Factors of a Desert
What is Biotic Factor? A biotic factor is a living component that affects another organism or shapes the ecosystem. These can be animals, plants, fungi, and microorganisms. They relate to the living things in an ecosystem and are essential for the survival and growth of organisms within their environment. Biotic factors determine the types and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Biotic interaction - Definition, Types, Examples
What is Biotic interaction? Types of Biotic Interactions Based on the nature of these effects, biotic interactions can be categorized into three main types: positive, neutral, and negative. Below are the types of interactions, along with detailed descriptions: A. Positive Interactions 1. Mutualism Mutualism is a type of biotic interaction where two species engage in ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Bird Seed Agar (Staibs Medium) - Composition, Principle, Preparation
Bird Seed Agar Bird Seed Agar is an effective solid medium to isolate selectively and differentially of Cryptococcus Neoformans from clinical specimens. It is utilized for the specific isolation from Cryptococcus neoformans as well as C. Gattii. C. Neoformans typically grows as yeast (unicellular) and reproduces via budding. Cryptococcus Neoformans is an enclosed yeast, which makes the enzyme phenoloxidase an enzyme that is essential to melanin production.
Bismuth Sulphite Agar (BSA) - Composition, Principle, Preparation, Results, Uses
Salmonellae are the most complex taxonomically diverse group of bacteria in Enterobacteriaceae. Salmonella infections in humans are usually caused by the consumption of food, milk, and water contaminated with animal or human excreta. S. Typhi is only found in humans.
Biuret Test For Protein - Principle, Procedure, Result, Uses
Proteins are polymers of amino acids. They are complex organic compounds containing nitrogen, hydrogen, carbon, and oxygen. Proteins are abundant in our everyday food e.g. egg, soya bean, pulses, fish, milk etc.
BLAST - Definition, Types, Characteristics, Outputs, Applications
What is BLAST? BLAST, which stands for Basic Local Alignment Search Tool, is a widely used bioinformatics program and algorithm. It is designed to compare and analyze biological sequences such as DNA, RNA, and protein sequences. BLAST helps in identifying regions of similarity between different sequences, which can provide insights into their functional and evolutionary ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Blastomyces dermatitidis - Morphology, Transmission, Treatment
Kingdom: Fungi Division: Ascomycota Class: Eurotiomycetes Order: Onygenales Family: Ajellomycetaceae Genus: Blastomyces Species: B. dermatitidis Morphology of Blastomyces dermatitidis Blastomyces dermatitidis is a dimorphic fungus that causes blastomycosis, a fungal infection in humans and animals. The fungus exists in two different morphological forms, the yeast phase, and the mold phase. Overall, the morphology of Blastomyces dermatitidis ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Blood Agar - Preparation, Composition, Application, and limitation
production of blood agar after the addition of liquid blood.
Blood Cells - Definition, Types, Structure and Functions
What are Blood Cells? Blood Cells Definitions Red blood cells (erythrocytes): Blood cells responsible for transporting oxygen from the lungs to the body’s tissues and removing carbon dioxide. White blood cells (leukocytes): Blood cells involved in the body’s immune response, defending against infections and diseases. Platelets (thrombocytes): Blood cells essential for blood clotting, preventing excessive ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Blood Collection Tubes - Definition, Significance of Color Coding
Blood Collection Tubes are evacuated, sterile and single-use medical devices that are used to collect human blood samples for laboratory testing. These tubes are used by trained healthcare professionals during blood collection. It helps to collect, contain, preserve and transport the blood sample safely. The tubes are generally made up of glass or shatter-resistant plastic ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Blood Cross Matching - Principle, Procedure, Result.
Cross Match is a laboratory test, performed prior to a blood transfusion to determine whether donor blood is compatible (or incompatible) with recipient blood.
Blood Grouping Test - Principle, Procedure, Result
The concept of Blood grouping was first discovered by Karl Landsteiner in 1901, who was an Austrian-American immunologist and pathologist. He received Nobel Prize in Physiology or Medicine in 1930 for this discovery.
Blood Pressure - Definition, Types, Measurement, Disorders
What is Blood Pressure? Definition of Blood Pressure Blood pressure is the force exerted by circulating blood against the walls of the arteries, measured in terms of systolic and diastolic pressures during the cardiac cycle. Types of Blood Pressure Blood pressure, a critical physiological parameter, is the force exerted by circulating blood against the walls ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Blood pressure and its regulation
What is Blood pressure? Factors Regulating Blood Pressure The regulation of blood pressure is a complex and dynamic process that involves multiple systems working together to maintain homeostasis. Even under normal physiological conditions, arterial blood pressure can exhibit variability. However, the body employs four primary regulatory systems to ensure that blood pressure remains within acceptable ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Blotting Technique - Definition, Types, Application
In molecular biology and genetics, blotting is an analysis technique used for the detection of specific biomolecules (proteins, DNA or RNA) in samples of complex composition by transferring them onto a carrier such as a nitrocellulose, polyvinylidene fluoride or nylon membrane.
BOD Incubator - Principle, Parts, Procedure, Application
A BOD incubator is a laboratory instrument that is used for maintaining a controlled temperature environment required for the estimation of Biochemical Oxygen Demand of water samples. It is designed to operate both at heating and cooling conditions which is different from ordinary incubators. It is mainly adjusted at a fixed temperature of 20°C which ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
BOD Test (Biological Oxygen Demand) - Principle, Procedure, Calculation
BOD test (Biochemical Oxygen Demand) is a standard laboratory test. It is used for measuring the amount of dissolved oxygen which is consumed by aerobic microorganisms (bacteria) when the organic matter present in water sample is broken down and decomposed. It is the process where oxygen is utilized during biodegradation and this is referred to ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Body Lines of Defense - Types, Examples
What is Body Lines of Defense? Defense Systems – Innate and Acquired Defense Systems When the body encounters invaders, it deploys two distinct types of responses: the Innate (Natural/Non-specific) response and the Acquired (Adaptive/Specific) response. These responses form the body’s defense systems against foreign particles. The Innate response remains consistent regardless of the number of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Bombardment (Biolistics) Method for Plant Cells - Principle, Requirement, Protocol
What is Bombardment (Biolistics) Method? Bombardment (Biolistics) method is a direct physical technique used to introduce foreign DNA into living cells. It is also referred to as the gene gun method. In this process, the desired DNA is first coated on very small and dense metal particles such as gold or tungsten. These DNA coated ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Bone - Definition, Structure, Types, Growth, Resorption, Bone Structure
What is Bone? Definition of Bone Bone is a rigid connective tissue that forms the framework of the skeletal system in humans and other vertebrates. It provides structural support, protects internal organs, enables movement, produces blood cells, stores minerals, and maintains overall body rigidity. Features of Bone Bones possess several notable features that contribute to ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Bone Marrow - Definition, Types, Structure and Functions
What is Bone Marrow? Definition of Bone Marrow Bone marrow is the soft tissue found within the cavities of bones that produces various types of blood cells, including red blood cells, white blood cells, and platelets. Location of Bone Marrow The location of bone marrow within the human body is widely distributed, but it undergoes changes ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Bordetella pertussis - Habitat, Morphology, Pathogenesis, Treatment
What is Bordetella pertussis? Scientific classification of Bordetella pertussis Domain: Bacteria Phylum: Pseudomonadota Class: Betaproteobacteria Order: Burkholderiales Family: Alcaligenaceae Genus: Bordetella Species: B. pertussis Geographical Distribution and Habitat of B. pertussis Bordetella pertussis, the causative agent of whooping cough, is a major concern worldwide. The disease it causes is predominantly seen in children, and its spread ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Borrelia recurrentis - Habitat, Morphology, Pathogenesis, Treatment
What is Borrelia recurrentis? Scientific classification of Borrelia recurrentis Domain: Bacteria Phylum: Spirochaetota Class: Spirochaetia Order: Spirochaetales Family: Borreliaceae Genus: Borrelia Species: B. recurrentis Geographical Distribution and Habitat of Borrelia recurrentis Borrelia recurrentis is the cause of relapsing fever, with distinct patterns of prevalence based on hygiene, environmental factors, and the vectors involved. Morphology of Borrelia ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Botanical Nomenclature - Principles, Rules, Ranks, Typification, author citation, rejection
What is Botanical nomenclature? Importance of scientific names Scientific names are crucial for accurately identifying and classifying plants and organisms. Here are key reasons why they are essential: Common name and its problems Common names, while widely used, present several issues that complicate plant identification and communication. These problems arise from their variability, lack of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Botulism Food Poisoning by Clostridium botulinum
What is Botulism Food Poisoning? Botulism food poisoning is a severe and potentially life-threatening illness caused by the consumption of food contaminated with botulinum neurotoxins (BoNTs). Here are the key points about botulism food poisoning: Preventing botulism food poisoning involves proper food handling and storage practices, such as ensuring adequate heat treatment during cooking, avoiding ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Bovine Spongiform Encephalopathy (BSE)- Mad Cow Disease
What is Bovine spongiform encephalopathy? Sources and causes of contamination of Bovine Spongiform Encephalopathy (BSE) Pathogenic mechanism of Bovine Spongiform Encephalopathy (BSE) Signs and symptoms of Bovine Spongiform Encephalopathy (BSE) Epidemiology of Bovine Spongiform Encephalopathy (BSE) Diagnosis of Bovine Spongiform Encephalopathy (BSE) Treatment and Vaccination Prevention and control measures of Bovine Spongiform Encephalopathy (BSE) Prevention ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Bradford Stock Solution Preparation
This solution is mainly used to determine the concentration of proteins in solution.
Brain Heart Infusion (BHI) Agar - Composition, Principle, Preparation, Results, Uses
Rosenow developed a medium that could be used to cultivate streptococci using a dextrose broth and brain tissue in 1919. Hayden modified Rosenow's formula and found that crushed marble promoted the growth of dental pathogens. The current formulation uses infusions from calf brain instead of brain tissue, and disodiumphosphate has been replaced by calcium carbonate.
Branches of Microbiology
In the previous article, I have already discussed What is Microbiology? And History Of Microbiology. In this article, we will discuss Different branches of Microbiology and their purpose. What is Microbiology? Microbiology is an advanced biology course that studies unicellular (single cell), multicellular (cell colony), or acellular (lacking cells) microorganisms, including bacteria, archaea, algae, fungi, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Breeding Methods for Cross-pollinated species
In this article we will discuss about the different methods for Breeding Cross-pollinated species What are Cross-pollinated species? Cross-pollinated species are plants that require pollen from a different individual of the same species to achieve fertilization and produce seeds. This process contrasts with self-pollinated species, where a single plant can fertilize itself. Cross-pollination is essential ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Brief History And Developments In Industrial Microbiology
Industrial microbiology is the use of microorganisms like bacteria, fungi, and yeast for producing useful materials on a large scale. It is the process where these microbes are grown under controlled conditions so that they can convert raw materials into different products. It is the process mainly linked with fermentation and other bioconversion methods, and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Bright Field Microscope - Definition, Parts, Working Principle, Application
What is Bright Field Microscope? Bright field microscope is an optical microscope that produce a dark image of the specimen against a bright background, and it is the most common compound light microscope used in biological laboratories. It is the system where the specimen is illuminated from below by a uniform beam of light, and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Brilliant Green Agar - Composition, Principle, Preparation, Results, Uses
As a primary plating medium, Brilliant Green Agar medium should be used to isolate Salmonella species. Kristensen and colleagues first described it as a selective isolation medium to Salmonella species. Kristensen et al. first described it as a selective isolation medium for Salmonella species. Kauffmann modified the formula to make it a highly selective plating media for the isolation and identification from salmonellae in feces, other pathological material, food and dairy products. Brilliant Green Agar should always be used in conjunction with other selective plating media like Deoxycholate Citrate Agar and Hektoen Enteric Agar. Salmonella Typhi is treated with Bismuth Sulphite.
Broodstock Management - Definition, Objective, Procedure, Importance
What is Broodstock Management? Objective of Broodstock Management Broodstock management is essential for optimizing fish breeding practices, particularly in aquaculture systems. The objectives of effective broodstock management encompass several key areas, all aimed at enhancing fish production and ensuring sustainability. The following points detail these objectives: Selection procedure of brood fish The selection procedure for ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Brown Algae (Phaeophyceae)- Habitat, Characteristics, Morphology, Importance
What are Brown Algae (Phaeophyceae)? Habitats of Brown Algae Characteristic Features of Brown Algae Classification of Brown Algae Brown Algae Classification Taxonomic Rank Classification Domain Eukaryota Kingdom Chromista Phylum Ochrophyta Class Phaeophyceae Orders Fucales, Laminariales, Dictyotales Families Fucaceae, Laminariaceae, Dictyotaceae Genera Fucus, Laminaria, Dictyota Species Fucus vesiculosus, Laminaria digitata, Dictyota dichotoma Morphology and Structure of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Brucella - Habitat, Morphology, Pathogenesis, Treatment
Brucella is a genus of small Gram-negative coccobacilli. It is non-motile and non-spore forming, and it is the organism responsible for a zoonotic disease called brucellosis. It is the process where the bacteria survive as facultative intracellular parasite inside different host cells. These organisms are named after David Bruce and are placed under the family ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Brucella Agar - Composition, Principle, Preparation, Results, Uses
Brucella is an intracellular parasite which causes epizootic abortions for animals, and septicemic febrile disease or localized infections of tissues, bones or organ systems of humans. Brucella species are very meticulous and require a rich nutrient environment to develop. Additionally, Brucella species are highly infectious, and therefore extreme caution should be exercised when handling.
Bryophytes - definition, classification, life cycle, characteristics, importance
What are Bryophytes? Bryophytes definition Bryophytes plants are plants that can be found growing in damp and shaded areas. These plants are unique because they can live on soil and bare rocks. They are an integral part of plant succession on bare rock. They exhibit alternation of generations and are known by a unique name. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
BSC Microbiology Syllabus PDF - Choice Based Credit System (CBCS)
Proposed syllabus and Scheme of Examination for B.Sc. (Honors) Microbiology. The B. Sc. Honours Microbiology program under the Choice Based Credit System (CBCS) is meticulously designed to provide students with a comprehensive understanding of microbiology. This program includes a mix of core courses, discipline-specific electives, generic electives, ability enhancement courses, and skill enhancement courses. Below ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
BT Cotton - Definition, Features, Development, Advantages, Limitations
What is BT Cotton? Bt cotton is a genetically modified cotton variety in which genes from the bacterium Bacillus thuringiensis are inserted into the plant, and it is the process that allows the cotton plant to produce Cry proteins within its own tissues. These are insecticidal proteins that act specifically on harmful caterpillar pests like ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Bt Crops - Definition, Types, Advantages, Limitations
What are Bt Crops? Bt crops are the transgenic crops in which a gene from the soil bacterium Bacillus thuringiensis is introduced into the plant. It is the gene that produces special insecticidal proteins inside the plant body and these proteins are referred to as Cry or Vip proteins. When insect larvae feed on the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Budding - Process, Types, Advantages, Disadvantages
What is Budding? Definition of Budding Budding is a form of asexual reproduction in which a new organism develops from an outgrowth or “bud” on the parent organism, eventually detaching to live independently. Types of Budding I. Types of Biological Budding (Asexual Reproduction) II. Types of Horticultural Budding (Plant Grafting Techniques) 1. Budding in Plants ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Bulk Method – Procedure, Applications, Advantages, Disadvantages
What is Bulk Method? Definition of Bulk Method The bulk method, developed by Nilsson-Ehle in 1908, is a plant breeding technique where large quantities of plants from the F1 generation and subsequent generations are grown in bulk. Individual plants are only selected and evaluated after a prolonged bulking period, distinguishing it from methods like the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Bunsen Burner - Definition, Principle, Parts, Functions
What is a Bunsen Burner? Definition of Bunsen Burner A Bunsen burner is a laboratory gas burner that produces a controlled flame for scientific experiments and research purposes. Principle of Bunsen burner The principle of Bunsen burner based on the combustion of gas with air before ignition, which produce a safe and controllable flame for ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Burkholderia Cepacia Agar Base - Preparation, Composition, Principle
Burkholderia cepacia can be viewed as an opportunity-based bacterium that is associated with nosocomial illnesses caused by contamination of medical equipment and disinfectants. However, the highest risk group is CF patients. People with cystic fibrosis are at an increased risk of infection. those with the infection, if not treated are prone to rapid declines of lung functions, frequent bacteremia and even death due to lung dysfunction.
Butyrate Disk Test - Principle, Procedure, Result, Uses
The Butyrate Disk Test is a rapid biochemical test used in microbiology laboratory for the detection of enzyme butyrate esterase in bacteria. It is mainly used for the presumptive identification of Moraxella catarrhalis, which is an important human pathogen associated with respiratory tract infections. It is useful because this organism shows morphological similarity with Neisseria ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Calcium Chloride Stock Solution Preparation
Calcium Chloride Stock Solution Preparation Calcium chloride is a common calcium salt used in a variety of applications. To prepare 1L of Calcium Chloride Stock Solution the following components are required. Component Amount Concentration CaCl2 (mw: 110.98 g/mol) 58 g 0.5226 M Preparation procedure Prepare 800 mL of distilled water in a suitable container. Add ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Calcofluor White Staining - Principle, Procedure, Results, Applications
Calcofluor White (CFW) is a fluorescent dye that is used for the quick detection of fungi, yeasts, and some parasites. It is a stilbene derivative and it is the compound that absorbs ultraviolet light and then emits a visible blue light. It binds with β-linked polysaccharides like chitin in fungal cell walls and cellulose in ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Calvin Cycle - Definition, Steps, Products, Functions
What is Calvin Cycle? The Calvin Cycle, also known as the C3 cycle or Calvin-Benson cycle, is a critical biochemical process in photosynthesis that enables plants to convert carbon dioxide into organic compounds, primarily glucose. Named after Melvin Calvin, who discovered the pathway in the 1950s, this cycle occurs in the stroma of chloroplasts in ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Cambridge O Level Biology Study Notes
Cambridge O Level Biology is an internationally recognised school-level biology course and exam offered by Cambridge International for students usually aged 14 to 16. It helps students understand the basic concepts of biology, such as cells, plants and animals, human body systems, genetics, and the environment. The course also teaches practical skills through experiments and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
CAMP Test - Principle, Procedure, Result, Uses
CAMP Test was first discovered by four researchers Christie, Atkins, Munch, and Peterson in 1944, that’s why this test is also known as Christie–Atkins–Munch-Peterson test.
Campylobacter Blood Agar (CVA) Composition, Principle, Preparation, Results, Uses
Campylobacter blood agar (CVA), is a selective medium that allows for the primary isolation from stool specimens of Campylobacter Jejuni. Dekeyser et al. Dekeyser et al. reported that Campylobacter jejuni was isolated from patients suffering from diarrhea and acute gastroenteritis using a filtration method and a selective media with antimicrobials. Skirrow, however, reported that a select medium containing three antimicrobics was used for isolation. Blaser and colleagues reported that they were able to isolate C. jejuni from feces using a selective medium that contained four antimicrobials: amphotericin (vancomycin), polymyxin B and trimethoprim. Reller et al. in 1983 also introduced a better selective medium containing cefoperazone and Vancomycin. This combination of antimicrobials allowed for better suppression of normal fecal bacteria, thereby allowing for better isolation of C.jejuni from the fecal specimen.
Campylobacter Infection and Food Poisoning - Campylobacteriosis
What is Campylobacteriosis? Campylobacteriosis is a common bacterial infection that primarily affects the gastrointestinal tract, leading to gastroenteritis. Here is some information about campylobacteriosis: Efforts to prevent campylobacteriosis focus on ensuring food safety, particularly in relation to poultry products, by implementing good hygiene practices during production, processing, and preparation. Public awareness campaigns about safe food ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Canal System in Sponge - Definition, Types, Structures, Mechanisms, Functions and Examples
What is Canal system in sponges? Canal system in sponges is a system of water canals present in the body of sponges through which water circulates continuously. It is also referred to as aquiferous system. This system is highly characteristic feature of phylum Porifera and it is essential for their survival. Sponges are sedentary and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Cancer Cell - Definition, Types, Morphology, Development
What is Cancer Cell? Definition of Cancer Cell A cancer cell is an abnormal cell that divides uncontrollably, ignores natural growth regulation, and can invade surrounding tissues or spread to other parts of the body. Characteristics of Cancer Cells Characteristics of Cancer Cells Cancer cells are fundamentally different from normal cells in ways that make ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Cancer Immunotherapy
What is Cancer Immunotherapy? Manipulation of Co-Stimulatory Signals Can Enhance Immunity Enhancement of APC Activity Can Modulate Tumor Immunity Cytokine Therapy Can Augment Immune Responses to Tumors Interferons Tumor Necrosis Factors In Vitro–Activated LAK And TIL Cells Treatment with Monoclonal Antibodies Key Facts
Candida albicans - Morphology, Life Cycle, Pathogenesis, Treatment
What is Candida albicans? Kingdom: Fungi Division: Ascomycota Class: Saccharomycetes Order: Saccharomycetales Family: Saccharomycetaceae Genus: Candida Species: C. albicans Habitat of Candida albicans Candida albicans is a form of yeast commonly found as part of the human body’s normal microbial flora. It is known to inhabit various body segments, particularly mucous membranes and moist regions. Here are ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Candida glabrata - Morphology, Pathogenesis, Treatment, Prevention
Kingdom: Fungi Division: Ascomycota Class: Saccharomycetes Order: Saccharomycetales Family: Saccharomycetaceae Genus: Candida Species: C. glabrata What is Candida glabrata? Habitat of Candida glabrata Candida glabrata is a common yeast found in a variety of habitats, including human hosts and the environment. Here are the principal environments in which Candida glabrata is found: Morphology of Candida glabrata Candida glabrata ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Candida parapsilosis - Morphology, Pathogenesis, Transmission, Treatment
Kingdom: Fungi Division: Ascomycota Class: Saccharomycetes Order: Saccharomycetales Family: Saccharomycetaceae Genus: Candida Species: C. parapsilosis What is Candida parapsilosis? Taxonomy of Candida parapsilosis The taxonomy of Candida parapsilosis is as follows: Candida parapsilosis belongs to the kingdom Fungi and the phylum Ascomycota, which includes a diverse group of fungi. It falls under the class Saccharomycetes, which ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Candida tropicalis - Morphology, Pathogenesis, Transmisssion, Treatment
Kingdom: Fungi Division: Ascomycota Class: Saccharomycetes Order: Saccharomycetales Family: Saccharomycetaceae Genus: Candida Species: C. tropicalis Habitat of Candida tropicalis Candida tropicalis is a yeast species that inhabits a variety of natural environments and the human body. Here are some typical environments where Candida tropicalis is found: Morphological features of Candida tropicalis Candida tropicalis is a yeast species with ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Candidiasis - Definition, Causative Agent, Types, Transmission
Candidiasis, also known as a yeast infection, is a fungal infection caused by a group of yeasts called Candida. Candida is a normal part of the human microbiota and is commonly found in the mouth, gut, and female genital tract. However, when there is an overgrowth of Candida, it can cause infection. Candidiasis can occur ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Candidiasis - Types, Causative Agent, Treatment, Prevention, Symptoms
Candidiasis Properties Pathogenesis and Immunity Candida spp. are typically present as part of the normal flora on the oral cavity, gastrointestinal system, and vaginal mucosa. Candida exhibits colonisation at these sites in over 80% of healthy individuals. However, the organism is rarely seen on the surface of normal human skin, with the exception of the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Capillary Electrophoresis - Definition, Principle, Types and Application
Capillary Electrophoresis (CE) is a type of electrophoresis technique that uses a narrow capillary to separate charged molecules (ions) based on their migration towards electrodes under the influence of an electric field. It is a high-resolution and fast method for the analysis of small molecules, DNA, and proteins. The importance of CE lies in its ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Capsule Staining - Procedure, Principle, Result
Capsule staining is a differential staining method, where two different stains are used such as the primary stain and the counterstain.
Carbenicillin Solution Preparation
Carbenicillin is an ampicillin analog with structure related to benzyl penicillin. It is effective against Gram-negative bacteria and exhibits limited activity against Gram-positive bacteria. Carbenicillin binds and inhibits the enzymes involved in the synthesis of bacterial cell wall. Since carbenicillin is less sensitive to β-lactamases than ampicillin, it is effective against ampicillin-resistant bacteria. It has ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Carbohydrate Fermentation Test - Sugar Fermentation Test
The carbohydrate fermentation test can be used to determine if bacteria are able to ferment a certain carbohydrate.
It is a test to determine any presence of acids or gas resulting from carbohydrate fermentation.
Carbohydrate metabolism In Plant- Synthesis and catabolism of sucrose and starch
What are carbohydrates? Types of carbohydrates Carbohydrates can be broadly categorized into three primary types: monosaccharides, disaccharides and oligosaccharides, and polysaccharides. What Is Sucrose? Sucrose is the most prevalent disaccharide found in nature and serves as a principal product of photosynthesis in plants. This sugar is classified as a non-reducing sugar, which limits its chemical ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Carbohydrates - Definition, Examples, Structure, Types, and Functions
What are Carbohydrates? Definition of Carbohydrates Carbohydrates are organic molecules made of carbon, hydrogen, and oxygen that serve as a major source of energy in living organisms. They include sugars, starches, and fibers and are classified into monosaccharides, disaccharides, oligosaccharides, and polysaccharides. Carbohydrates play key roles in energy storage, structural support, and various biological processes. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Carbohydrates - Monosaccharides, Disaccharides, Polysaccharides
What is Carbohydrate? Definition of Carbohydrates Carbohydrates are carbon-based compounds that serve as a source of energy and play important roles in the structure and function of living organisms. Structure of Carbohydrates Monosaccharides Monosaccharides are fundamental units of carbohydrates and are often referred to as simple sugars. They play essential roles in various biological processes ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Carbon cycle - Definition, Steps, Importance, Examples
Carbon cycle Definition Carbon cycle is the process by which carbon compounds move between the earth’s atmosphere, biosphere, geosphere, pedosphere, and hydrosphere. Properties of Carbon Physical Properties of Carbon Chemical Properties of Carbon Steps of Carbon Cycle 1. Carbon in the Atmosphere 2. Producers Absorb Carbon 3. Producers are Eaten 4. Decomposers Release Carbon 5. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Carbon Fixation - Process, Pathways, Importance
What is Carbon Fixation? Carbon Fixation Definition Carbon fixation is a biological process where atmospheric carbon dioxide (CO2) is converted into organic compounds, primarily by plants, algae, and certain bacteria. This process is a key component of photosynthesis, enabling the incorporation of inorganic carbon from the atmosphere into organic molecules like carbohydrates, thereby playing a ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Carbon Monoxide Poisoning - Pathophysiology, Toxicokinetics, Diagnosis, Prevention, Symptoms
What is Carbon Monoxide Poisoning? Pathophysiology of Carbon Monoxide Poisoning The pathophysiology of carbon monoxide (CO) poisoning involves complex interactions within the body that result in severe physiological disturbances. The following points summarize the key aspects of how carbon monoxide affects human health: Toxicokinetics of Carbon Monoxide Poisoning The toxicokinetics of carbon monoxide (CO) poisoning ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Cardiac Conduction - Cardiovascular System Physiology
What is Heart Conduction System? Components of Heart Conduction System The heart conduction system is a specialized network that plays a critical role in maintaining the heart’s rhythm and ensuring effective blood circulation throughout the body. This system consists of various components, each with unique functions that contribute to the synchronized contraction of the heart ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Cardiac Cycle Phases, Duration and Diagram
What is Cardiac Cycle? Cardiac Cycle Phases The cardiac cycle refers to the sequence of events that occurs from the beginning of one heartbeat to the beginning of the next. This cycle consists of two primary phases: ventricular contraction, known as systole, and ventricular relaxation, referred to as diastole. Each of these phases can be ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Cardiac Output - Determination, Regulation, Factors, Distribution
What is Cardiac Output? What is Cardiac Index? Cardiac Index (CI) is a crucial measure in cardiovascular physiology that expresses cardiac output in relation to the individual’s body surface area (BSA). This index provides a more accurate understanding of heart function by accounting for the size of the person, making it a more individualized and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Career In Microbiology and Its Importance
Microbiology is the study of microscopic organisms like bacteria, viruses, fungi and some parasites, and it is the field that explains how these organisms is involved in different biological and environmental activities. A career in microbiology is followed when a person study these microbes and work with them in laboratories or research centers. It is ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Careers of Microbiologist: Scope, Salary, Jobs, Courses, Eligibility.
Carrier of microbiologists, Microorganisms together with their actions are essentially vital to all processes on earth. Micro-organisms are in us, on us, and around us. Because they have an effect on each facet of our lives- thus they matter. Microbiology includes the examination of all dwelling organisms which can be too minute to be seen ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Cartilage - Definition, Structure, Types, Functions
What is Cartilage? Definition of Cartilage Cartilage is a semi-rigid and flexible connective tissue found in various parts of the body, such as joints, nose, and ears. It is tough, yet pliable, and provides structural support, cushioning, and smooth surfaces for joint movement. Location of Cartilage Characteristics of Cartilage Structure of Cartilage Cartilage consists of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Cary Blair Transport Medium - Principle, Composition, Preparation, Uses, Results
Cary-Blair Transport Medium is simple, semi-solid, and non-nutritive medium that is used to collect and storage of samples of microbiological organisms. The low levels of nutrients in the medium aid in the life of the organisms, without multiplication. The semisolid consistency facilitates the ability to transport easily and the medium is able to be stored for up to a year after its preparation at temperatures of room temperature. Cary-Blair Transport Medium is a modification to Stuart's Medium which is comprised of a more effective buffering system that replaces sodium glycerophosphate by organic phosphates. This new formulation helps prevent the growth of Enterobacteriaceae and aids in the long-term conservation for Salmonella as well as Shigella for extended durations. It is employed for the transport of clinical specimens believed to have enteric pathogenssuch as Shigella, Salmonella, Vibrio Cholerae, and Escherichia Coli O157 H7.
Cas9 Protein - Structure, Types, Function
Name Cas9 endonuclease Alternative name spCas9/spyCas9 Organism Streptococcus pyogenes serotype M1 Molecular weight ~163KDa Gene cas9 Location on chromosome 0.85 to 0.86Mb Protein CRISPR-associated endonuclease Cas9/Csn1 Cofactor Mg2+ Biological processing Interference- defense response to phage.Maintaining CRISPR repeat sequences Functions DNA and RNA bindingMetal ion binding3’-5’ exonuclease activityEndonuclease activity What is Cas9 Protein? Structure of Cas9 HNH ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Casein Hydrolysis Test - Principle, Procedure, Result, Uses
The Casein Hydrolysis Test is a biochemical test that is used to determine the ability of microorganism to produce and secrete extracellular proteolytic enzyme known as caseinase. It is the process in which casein protein of milk is broken down into smaller soluble products. Casein is the main protein present in milk and it is ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Catalase Test Principle, Procedure, Result and Application.
The catalase test is a type of biochemical test which is used to detect the production of catalase enzymes in the organism.
Cation Exchange Chromatography - Principle, Protocol, Uses
What is Cation Exchange Chromatography? Cation Exchange Chromatography Principles The principles of cation exchange chromatography are based on the net surface charge of proteins and the concept of isoelectric point (pI). The net surface charge of a protein can change with the pH of the surrounding environment. The pI of a protein refers to the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
cDNA Cloning - Definition, Principle, Steps, Applications
What is cDNA cloning? Definition of Complementary DNA or cDNA Complementary DNA (cDNA) is a form of DNA synthesized from a messenger RNA (mRNA) template through the action of the enzyme reverse transcriptase. It represents the coding sequence of genes and is commonly used in gene cloning and expression studies. cDNA Cloning Definition cDNA cloning ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
cDNA library - Definition, Principle, Construction, Uses
What is cDNA library? Principle of cDNA library Process involved in the construction of cDNA library 1. Extraction of mRNA from the eukaryotic cell 2. cDNA construction In the process of creating cDNAs, there’s different approaches. They are described as follows: a. The RNAse method Step I: Annealing: Step II: Replacing RNA strand with DNA ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
cDNA Synthesis - Principle, Protocol
What is cDNA? cDNA synthesis principle cDNA synthesis steps There are different steps for synthesis of cdna such as; cDNA synthesis protocol 1. Prepare sample 2. Remove genomic DNA 3. Select reverse transcriptase Common reverse transcriptases and their attributes. AMV reverse transcriptase MMLV reverse transcriptase Engineered MMLV reverse transcriptase(e.g., Invitrogen SuperScript IV Reverse Transcriptase) RNase ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Cell - Definition, Structure, Types, Functions, Examples
What is Cell? Definition of Cell A cell is the basic structural and functional unit of all living organisms, responsible for various life processes and containing essential biological molecules. Discovery of Cells – Who discovered cells? Origins of Cells The inception of cells is intrinsically linked to the genesis of life, marking the commencement of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Cell - Structure, Characteristics, Types, Size and Shape, Functions
What is a Cell? Definition of Cell A cell is the smallest, basic unit of life that performs essential functions such as growth, reproduction, and energy processing, and serves as the structural and functional building block of all living organisms. Discovery of Cells The discovery of cells marked a turning point in biological science, revealing ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Cell Biology Crossword
Cell biology is the study of cells, their physiological properties, structures, organelles, interactions, and behavior. It examines how cells function individually and in groups, including processes like cell division, communication, and metabolism. Cell biology is essential for understanding the fundamental unit of life and how cells contribute to the overall functioning of organisms. This field ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Cell Coat - Definition, Functions, Structure
Cell Coat Definition Extracellular Materials Cell Coat Function In addition to safeguarding the plasma membrane, the cell coat serves the following essential purposes: (i) Filtration (ii) Maintenance of the micro-environment of the cell (iii) Enzymes (iv) Immunological properties of the extraneous coats (v) Histocompatibility
Cell Compartmentalization - Definition, Types, Origins, Importance, Advantages
What is Cell Compartmentalization? Types of Cellular Compartments Cellular compartments are essential for maintaining the organization and efficiency of eukaryotic cells. These compartments are specialized regions that facilitate specific functions by maintaining unique internal environments. The primary types of compartments include: Major Cellular Compartments Cellular compartments, or organelles, play vital roles in maintaining the structure ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Cell Cycle - Definition, Phases, Checkpoints, Regulation
What is Cell Cycle? Cell cycle is the ordered sequence of events by which a cell grows and divides to form two genetically identical daughter cells. It is the process that ensures continuity of life by producing new cells from pre existing cells. The cell cycle is a carefully regulated process and it occurs in ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Cell Differentiation - Definition, Process & Examples
What is Cell Differentiation? Definition of Cell Differentiation Cell differentiation is the process by which unspecialized cells, like stem cells, transform into specialized cells with distinct structures and functions, enabling the development and maintenance of complex tissues and organs in multicellular organisms. Factors Influencing Cell Differentiation In multicellular organisms, several key factors influence cell differentiation, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Cell Disruption - Definition, Methods, Application
The term "cell disruption" refers to the method that allows intracellular fluid through methods that break the cell wall. The main goal of the process of cell disruption is gain intracellular fluid without altering its components. The method used can differ dependent on the type of cell as well as the structure of its cell wall.
Cell Division - Definition, Types, Mitosis, Meiosis, Cell cycle
What is Cell Division? Definition of Cell Division Cell division is the process by which a single cell divides to produce two or more new cells, essential for growth, repair, and reproduction in living organisms. Discovery of Cell Division The discovery of cell division is a fundamental aspect of cellular biology, providing insights into the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Cell Fusion - Definition, Types, Significance
What is Cell Fusion? Types of Cell Fusion Cells can fuse in one of two ways. Both homotypic and heterotypic cell fusion fall into this category. 1. Homotypic cell fusion 2. Heterotypic cell fusion 3. Other types of cell fusion There are several different types of cell fusion that can occur in both plant and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Cell Growth - Definition, Types, Mechanisms
Growth Definition Levels of Growth There are two distinct stages of growth in living organisms: A. Cell growth B. Growth of multicellular organisms The growth of multicellular animals and plants in connection to the growth and multiplication of their individual cells can be divided into three distinct categories: (1) Auxetic growth (Auxesis = growth resulting ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Cell Mediated Immune Response
Cell-Mediated Immunity Definition CMI is an unique sort of acquired immune response that is not mediated by antibodies but rather by sensitised T cells. This type of immunity is passed from donor to recipient without the need of antisera, but rather with intact lymphocytes; therefore, it is referred to as cell-mediated immune reaction. Contrary to ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Cell membrane (Plasma Membrane) Structures and Functions
What is Cell membrane or Plasma Membrane? Definition of Cell membrane or Plasma Membrane The cell membrane, also known as the plasma membrane, is a semi-permeable biological barrier that surrounds and protects the cell’s interior from the external environment, regulating the passage of molecules in and out of the cell. Cell Membrane Composition The cell ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Cell Membrane Staining - Principle, Procedure, Result, Uses
Cell membrane staining is the process in which the plasma membrane of a cell is visualized with the help of dyes or fluorescent probes. It is the thin outer covering of the cell, and it is normally transparent, so it cannot be seen clearly under a simple light microscope. It is the process where special ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Cell Organelles - Structure, Functions, Diagram
Your body is currently doing a lot of things simultaneously. Your body is sending electrical impulses, pumping blood and filtering urine.
Cell proliferation - Definition, Types, differentiation, assay, diseases
What is Cell proliferation? What is Normal cell proliferation? The delicate balancing act between cell growth, division, differentiation, and death is what allows for normal cell proliferation, an essential function in the body. Diseases can be caused by disruptions in any of these systems, thus they’re all crucial. Proliferation and apoptosis are two processes that ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Cell Signaling - Definition, Types, Functions
What is Cell Signaling? Three Stages of Cell Signaling Cell signalling can be defined simply as the creation of a “signal” by a single cell. The target cell then receives this signal. In actuality, signal transduction is stated to involve three phases: Types of Cell Signaling Pathways Cell signalling plays a crucial role in enabling ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Cell Structure and Functions - Cell Organelles
A cell is like the tiny building block that makes up all living things, from plants and animals to bacteria. Imagine it as a microscopic bag filled with stuff that keeps life going. Every cell has a thin outer layer called a membrane, which holds everything inside and controls what goes in or out. Inside, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Cell Theory - Definition, History, Principles, Modern Theory, Examples
What is Cell Theory? Definition of Cell Theory The cell theory is a fundamental principle in biology that states all living organisms are composed of cells, cells are the basic units of life, and all cells arise from pre-existing cells. 3 Parts Of Cell Theory – The three principles of cell theory The cell theory, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Cell Viability test using Propidium Iodide (PI) - Principle, Procedure, uses
Cell viability analysis using Propidium Iodide is a simple method in which the dye is used to distinguish between living and dead cells. It is the process where Propidium Iodide (PI) is added to a cell suspension and the stained cells is then examined usually by flow cytometer. PI is a red-fluorescent dye that binds ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Cell Wall - Definition, Structure, Composition, Functions
What is a Cell Wall? Cell Wall Definition A cell wall is a rigid and protective outer layer found in plants, fungi, bacteria, and some protists, providing structural support and protection to the cell. Properties of Cell Wall The cell wall is a crucial component of many organisms, including plants, fungi, algae, and certain prokaryotes. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Cell Wall ingrowths - Adcrustation and incrustation
Adcrustation refers to a biological process where a substance grows from within, expanding the entire structure without any surface layers being added. Essentially, growth happens throughout the substance itself. A common example is the growth of fruits, where the increase in size and mass occurs internally as the entire structure expands, rather than by the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Cell Wall Staining by Dayr's Method - Principle, Procedure, Uses
The composition of cell wall varies from species to species, it has been reported that the main constituents of cell wall is chitin, hemicellulose, and cellulose. In addition, prokaryotic cell wall contains peptidoglycan (also known as murein and mucopeptide). Peptidoglycan is mainly composed of sugar, amino acids (peptide; amino acids + glycan; sugar).
Cell Wall Structure of Archaebacteria
Archaeal Cell Wall Introduction One Membrane Archaea Double Membranes of Archaea What is S-Layer? The S-layer, or surface layer, is a fundamental component of the cell envelope in many archaea and some bacteria. It represents one of the most common cell wall variations, particularly among Crenarchaea. This layer consists primarily of proteins that self-assemble into ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Cell Wall Synthesis Inhibitors - Mechanism, Examples
What are Cell wall synthesis inhibitors? Cell wall synthesis inhibitors encompass antibiotics like β-lactams and glycopeptides. These antibiotics play a crucial role in treating infections by targeting the bacterial cell wall, an essential structure for bacterial survival. Understanding the mechanisms and types of these inhibitors provides insight into their therapeutic applications. β-Lactam Antibiotics β-lactam antibiotics ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Cells of Immune System - Types and Examples
The immune system is a complex network of organs, tissues, and cells that work together to keep the body healthy and protect it against outside intruders. Among the numerous components of the immune system, immune system cells play an important role in identifying and removing dangerous chemicals. Primary lymphoid organs and secondary lymphoid organs are ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Cellular Junctions - Types and Functions
What is Cellular Junctions or Cell junction? Definition of Cellular Junctions or Cell junction Cellular junctions, or cell junctions, are specialized structures in eukaryotic cells that facilitate adhesion and communication between adjacent cells or between a cell and the extracellular matrix. These junctions are essential for maintaining the structural integrity of tissues and enable coordinated ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Cellular Respiration Equation, Types, Steps, and Importance
What is Cellular Respiration? Cellular respiration is a vital metabolic process that occurs within cells, enabling the conversion of energy stored in carbohydrates into energy carriers, most notably adenosine triphosphate (ATP). Cellular respiration can occur in the presence or absence of oxygen. When oxygen is available, it is referred to as aerobic respiration. This process ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Cellulose Acetate Electrophoresis - Definition, Principle, Operating Procedure, Uses
Cellulose Acetate Electrophoresis is a type of zone electrophoresis technique used to separate charged biological molecules like proteins, nucleic acids and dyes in a liquid sample. It is carried out on a porous membrane made up of cellulose acetate. This membrane is first soaked in buffer solution and then electric current is passed through it. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Central Dogma Theory of Molecular Biology and Genetic Code
DNA is the full genetic information that determines the nature and function that an animal has. Proteins are made by the genetic code contained in DNA. Conversion of DNA encoded data to RNA is necessary to make proteins. So, in the majority of cells, genetic information is transferred from - DNA to RNA, and then to protein. The transfer of information is controlled by three different processes that help in the transfer of genetic information as well as its transformation into a different form:
Centrifugal Force - Definition, Principle, Formula, Calculation, Examples
Centrifugal force is an apparent force that seems to act outward from the centre of rotation when a body moves in a circular path. It is also called a pseudo force or fictitious force because it is not produced by any real physical interaction. It is observed only in a rotating or non-inertial frame of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Centrifugal Separators - Working Principle, Parts, Types, Uses
Centrifugal Separators are mechanical devices that are used to separate the components of a mixture on the basis of their different densities. It is generally operated by an electric motor and rotates a bowl or chamber at very high speed. During this rotation, a strong centrifugal force is produced which acts like artificial gravity. The ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Centrifugation of blood - Blood Separation
Centrifugation of blood The process of dividing whole blood into its components is known as blood separation. For research purposes, diagnostic and therapeutic reasons as well as research, whole blood may be separated. Scientists may employ several blood separation methods to achieve this. Blood separation machines that spin at high speeds exert a centripetal force, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Centrifuge - Principle, Parts, Types, Applications
Centrifuge is a mechanical device used to separate the components of liquid or gaseous mixture on the basis of their size, shape and density. It is operated by placing the sample mixture in tubes or containers which are fitted inside a rotor. The rotor is then rotated at very high speed around a fixed central ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Centrifuge Blood Sample - Purpose, Steps, Techniques
What are the components of blood? Blood is a fluid tissue that circulates throughout the body and performs a number of important functions. It is made up of several components, including cells and plasma. Cells: Plasma: Plasma is the liquid portion of the blood that carries the cells and other substances throughout the body. It ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Centrifuge tube - Definition, Types, Applications, Sizes
Centrifuge tube is a specialized tube that is used to hold liquid samples during centrifugation. It is made up of strong and durable material so that it can tolerate high rotational force without breaking or leakage. It is commonly used in biological, medical and chemical laboratories. During centrifugation, the tube is placed inside the centrifuge ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Centrioles - Definition, Structure, Functions
What are Centrioles? Definition of Centrioles Centrioles are cylindrical, microtubule-based structures found in most eukaryotic cells, playing a crucial role in cell division by aiding in the formation of the spindle apparatus and in cellular processes like the formation of cilia and flagella. They are typically composed of nine sets of microtubule triplets and lack ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Centrosome - Definition, Structure, Functions, Diagram
A centrosome is an organelle present in eukaryotic cells that serves as the main microtubule organizing center. It is composed of two centrioles, which are cylindrical structures made up of microtubules arranged in a nine-fold symmetry, and a matrix of proteins that surround and support the centrioles. The centrosome plays a critical role in various ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Cephalochordate - Characteristics, Classification
Classification of Cephalochordata Kingdom Animalia Superphylum Deuterostomia Phylum Chordata Subphylum Cephalochordata Characteristics of Cephalochordate Morphology of Cephalochordate Feeding of Cephalochordate Systematic Resume The systematic resume of the subphylum Cephalochordata provides an overview of the classification and distribution of the two genera within the family Brachiostomatidae. The subphylum Cephalochordata consists of a single family known as ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Cereals Plants - Wheat and Rice (origin, morphology, processing & uses), brief account of millets.
What are Cereals? Major cereal crops Cereal crops are pivotal in human nutrition and have been integral to civilizations throughout history. They are among the earliest plants to have been domesticated, with their cultivation closely associated with the development of agricultural societies. This narrative provides an overview of the major cereal crops, their significance, and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Cetrimide Agar - Composition, Principle, Preparation, Results, Uses
Cetrimide, a quaternary salt of ammonium, acts as a detergent that lowers the surface tension at the point-of-contact. It also has precipitant, complexing, and denaturing effects upon bacterial membrane proteins. It has inhibitory properties on many microorganisms, including Pseudomonas species that are not Pseudomonas. Lowburry was the first to develop cetrimide agar. It is a modified version of Tech Agar (developed in King et al. For the selective inhibition other than Pseudomonas, aeruginosa, 0.1% cetrimide (cetyltrimethyl ammonium bromide), was added. Cetrimide agar can be used to presumptive identify and selectively isolate Pseudomonas.aeruginosa species from both clinical and nonclinical specimens.
Cetrimide Agar Test - Principle, Purpose, Procedure, Results
Cetrimide Selective Agar is a solid medium that is recommended for use in qualitative procedures for selective isolation and presumed identification of Pseudomonas aeruginosa and other nonfermenting, gram-negative bacilli.
cGMP Pathway – Definition, Steps, Functions, Regulation
The cGMP pathway, short for cyclic guanosine monophosphate pathway, is a crucial signaling mechanism in cells. It involves the synthesis of cGMP from GTP (guanosine triphosphate) through the action of the enzyme guanylate cyclase. cGMP acts as a secondary messenger, similar to cyclic AMP (cAMP), and plays a vital role in various physiological processes. One ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Channel Protein - Definition, Structure, Function, Example
What is Channel Protein? Types of Channel Protein There are present 2 types of channel protein such as; 1. Non-gated Channel 2. Gated Channel Structure of Channel Protein Function of Channel Protein Channel Proteins and Carrier Proteins Example of Channel Protein Chloride channel Potassium channel Calcium channel Sodium channel References
Characteristic of Genetic Code
Genetic code refers to the rules which the linear nucleotide sequence identifies what is the linear structure of the polypeptide. This means that they define what sequences of nucleotides in an mRNA transformed to the amino acid sequence in the polypeptide.
Characteristics of Muscle Twitch - Motor Unit, Summation and Tetanus
Muscle twitch, the brief and transient contraction of a muscle fiber, is a fundamental event in muscle physiology. Understanding the characteristics of muscle twitches provides insights into the intricate mechanisms that govern muscle function. This article delves into the key aspects of muscle twitch, focusing on motor units, summation, and tetanus. Muscle twitches are initiated ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Characters of Algae | General Characters of Algae
In this article, we will discuss some important characters of algae. Algae is a photosynthetic eukaryotic organisms. They can be found everywhere such as soil, water, rocks, sands, etc. But most of them grow in the aquatic environment. Here is the some General Characters of Algae – Characters of Algae 1. Occurrence 2. Thallus organization ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Charcoal Selective Medium - Composition, Principle, Preparation, Results, Uses
In 1984, Bolton et al. Bolton et al. (1984) suggested that charcoal could be used to replace blood in a medium for the isolation of Campylobacter species. Endtz et al. Later, it was confirmed that Campylobacter isolates at a higher rate when using charcoal selective media.
Chargaff’s Rules - First and Second Rule
What is Chargaff’s Rules? Definition of Chargaff’s Rules Chargaff’s Rules are two fundamental principles discovered by biochemist Erwin Chargaff, which dictate the base pairing in DNA. The first rule states that in DNA, the amount of adenine (A) is equal to thymine (T), and the amount of cytosine (C) is equal to guanine (G). The ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Charophyta - General Characteristics, Occurrence, Morphology, Cell Structure And Life-cycle of Chara
What is Charophyta? General Characteristics of Charophyta Below are the key characteristics that define Charophyta: Occurrence of Charophyta Charophyta, particularly the genus Chara, is prevalent in various aquatic environments, primarily thriving in freshwater ecosystems. Understanding the occurrence of charophytes provides insight into their ecological roles and adaptability to diverse habitats. The following points outline the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Checkpoints in Cell Cycle - Types, Functions, Regulations
What is Checkpoint? A checkpoint is a control point in cell cycle. It is a internal surveillance mechanism present in eukaryotic cell. It ensures that cell division occurs in proper manner. It act like a quality control step where progression is checked before moving to next phase. It is the process where cell checks cell ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Cheek Cells Under a Microscope
Cheek cells, fascinating eukaryotic entities, grace the lining of our mouths. These microscopic wonders boast a distinct structure that encapsulates a world of biological marvels within their tiny boundaries. Thanks to their ease of shedding, acquiring them for observation has become a simple yet enlightening endeavor. Within the confines of these small entities, a realm ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Chemical Method of Sterilization - Types, Mode of Action, Application, Examples.
Chemical Method of sterilization Characteristics of an ideal Chemical Antimicrobial agent or disinfectant A chemical antimicrobial agent should contain the following characteristics; How to Select An Ideal Chemical Agent for Practical Application? There are three major factors that need to be assessed in the process of selecting the most appropriate chemical agent for a specific ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Chemical Oxygen Demand (COD) - Definition, Measurement, Importance
Chemical Oxygen Demand (COD) is a way to measure how much oxygen is needed to chemically oxidize organic and some inorganic substances in water that is acidic and has a strong oxidant, like potassium dichromate. It is usually shown in mg O₂ per liter. To find out how much oxidizable material is in a sample, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Chemogeny or Chemical Evolution of Life
What is Chemogeny? 1. Origin of Earth’s Primitive Atmosphere 2. Formation of Simple Inorganic Molecules (Water, Ammonia and Methane) The formation of simple inorganic molecules, such as water, ammonia, and methane, played a significant role in the chemical evolution of the primitive Earth. During the early stages, when the surface temperature of the Earth was less ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Chemosynthetic Bacteria - Examples, Definition, Pathways, and Processes
Chemosynthesis involves the conversion of carbon compounds as well as others molecules to organic substances. In this biochemical process, methane, or an inorganic compound like hydrogen sulfide or gas, is converted into a form that can serve as an energy source. However, the photosynthesis process’s energy source (the series of reactions in which water and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Chi-square Test - Types, Formula, Practice Problems, Applications
What is Chi-square Test? Formula of chi-square The Chi-square test is symbolically represented as [latex] \chi^2 [/latex], and the formula for comparing variances is: Where: Similarly, when the Chi-square test is used as a non-parametric test for goodness of fit or testing independence, the following formula is applied: Where: Properties of the Chi-Square Test The ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Chlamydia and Chlamydophila
Chlamydia Human infections caused by Chlamydia species Bacteria Diseases Chlamydia trachomatis Lymphogranuloma venereum, ocular lymphogranuloma venereum, trachoma, adult inclusion conjunctivitis, neonatal conjunctivitis, infant pneumonia, and urogenital infections Chlamydophila pneumoniae Pharyngitis, sinusitis, bronchitis, and pneumonia Chlamydophila psittac Psittacosis General Properties There are two morphologically distinct forms of chlamydiae: elementary body and reticulate body. Elementary body Reticulate ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Chlamydia Under the Microscope - Procedure, Result
Chlamydia is caused by Chlamydia trachomatis which is a Gram-negative bacterium, and it is the organism that behave as an obligate intracellular parasite because it cannot produce its own metabolic energy. It is the process where the bacterium must survive and replicate inside the eukaryotic host cell, and this organism shows a biphasic developmental cycle ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Chlamydomonas - Life Cycle, Habitat, Structure, Examples
Chlamydomonas is a tiny, single-celled green algae you’d likely find in ponds, soil, or even damp tree bark. Imagine a microscopic organism shaped like a oval, sporting two whip-like tails called flagella that let it zip through water. What’s cool about it? Despite its simplicity, it’s a powerhouse in science. Researchers love studying it because ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Chlorophyta - Characteristics, Occurrence, Thallus organization, Structure and Reproduction
What is Chlorophyta? Important features of Chlorophyta Below is a detailed breakdown of the key features of Chlorophyta: Cell structure of Chlorophyta Chlorophyta, or green algae, exhibit a wide range of structural features at the cellular level, which contribute to their adaptability and function in diverse environments. Below are key structural elements that define their ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Chloroplast - Definition, Characteristics, Structure, Location, Functions, and Diagram
The term "chloroplast" is derived of the Greek words chloros, which translates to green and also plastes which refers to "the one who forms". Chloroplasts are membrane-bound plastids which have membranes that are embedded in a liquid matrix.
Chloroquine solution Preparation and Uses
It was originally used as an antimalarial compound. It kills the erythrocytic forms of malaria parasites at all stages of development but does not affect the sporozoites.
Chocolate Agar Media - Principle, Composition, Preparation, Result
Chocolate Agar (CAP or CHOC) is a nonselective enhanced medium that is used to identify and isolate of pathogens that are fastidious.
Choice Based Credit System UGC B.sc. Botany Honours Syllabus
Structure of B.Sc. Honours Botany under CBCS Course Category Courses Core Courses 1. Algae and Microbiology 2. Biomolecules and Cell Biology 3. Mycology and Phytopathology 4. Archegoniate 5. Morphology and Anatomy 6. Economic Botany 7. Genetics 8. Molecular Biology 9. Plant Ecology and Phytogeography 10. Plant Systematics 11. Reproductive Biology of Angiosperms 12. Plant Physiology ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Choice Based Credit System UGC B.Sc. Hons Zoology Honours Syllabus
CORE COURSE CORE COURSE I – NON-CHORDATES I: PROTISTS TO PSEUDOCOELOMATES Unit 1: Protista, Parazoa, and Metazoa General characteristics and classification up to classes. Study of Euglena, Amoeba, and Paramecium. Life cycle and pathogenicity of Plasmodium vivax and Entamoeba histolytica. Locomotion and reproduction in Protista. Evolution of symmetry and segmentation in Metazoa. Unit 2: Porifera ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Chondrichthyes - Characteristics, Classification & Examples
Kingdom Animalia Phylum Chordata Subphylum Vertebrata Division Gnathostomata Superclass Pisces Class Chondrichthyes Characteristics of Chondrichthyes Chondrichthyes, also known as Sharks, Skates, and Rays, exhibit a range of fascinating characteristics. Here are some key features of these jawed fishes: These characteristics contribute to the unique adaptations and biological traits of Chondrichthyes, making them a diverse and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
CHROMagar - Composition, Principle, Preparation, Results, Uses
In 1979, Dr. A. Rambach invented and patented the first chromogenic medium for E.coli detection. This technology uses a color-based differentiation technique. It uses soluble colorless molecules, also known as chromogens. They are composed of a substrate that targets a specific enzyme activity and a chromophore. The chromophore can be released when the enzyme of the target organism cleaves the colorless, chromogenic conjugate.
Chromatography - Principle, Types, Applications
Chromatography is an analytical technique which is used to separate the components of a mixture. It is used in laboratory for separation, identification and also estimation of substances present in a complex mixture. The method was first developed by Russian botanist Mikhail Tsvet for separation of plant pigments. In chromatography, there are two phases. One ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Chromoblastomycosis (Chromomycosis) - Morphology, Pathogenesis, Transmission, Treatment
What do you mean by Chromoblastomycosis (Chromomycosis)? Chromoblastomycosis, also referred to as chromomycosis, is a chronic fungal infection of the epidermis and subcutaneous tissues. Multiple species of pigmented fungi, including Fonsecaea spp., Phialophora spp., Cladophialophora spp., and others, are responsible for this condition. The term “chromoblastomycosis” refers to the presence of pigmented chromoblasts, which are ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Chromosomal Mutation - Definition, Causes, Mechanism, Advantages, Disadvantages
What is Chromosomal mutation? Definition of Chromosomal Mutation Chromosomal mutation refers to alterations in the structure or number of chromosomes within a cell, which can impact genetic information and potentially lead to various genetic disorders. Causes of Chromosomal Mutation Mechanism of Chromosomal Mutation Chromosomal mutations arise through various mechanisms that can be broadly categorized into ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Chromosomal Theory of Inheritance
What is Chromosome? What is Chromosomal Theory of Inheritance? Observations of Chromosomal Theory of Inheritance The Chromosomal Theory of Inheritance provided a clear link between the behavior of chromosomes and Mendel’s laws of inheritance. It was supported by a series of critical observations that connected chromosomal behavior during meiosis with the inheritance patterns Mendel described. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Chromosome - Definition, Function, Structure, Types
Chromosomes are a collection of tightly coiled DNA that are located in the nucleus of virtually every cell of our body. Humans possess 23 chromosome pairs.
Chromosome Abnormalities - Types, Mechanism, Detection
A chromosome disorder, also known as Chromosome Abnormalities is caused by an alteration in the size or the structure of chromosomes.
Chromosome Mapping - Definition, Types, Steps, Unit, Importance
What is Chromosome Mapping? Chromosome mapping is a pivotal technique in genetics that determines the relative positions of genes on a chromosome. This process involves creating maps that systematically organize and elucidate genetic information on chromosomes. These maps not only depict the positions of genes but also the distances between them, scaled to a specific ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Chronic granulomatous disease (CGD)
Chronic granulomatous disease (CGD) Chronic granulomatous disease (CGD) is an uncommon inherited primary immunological weakness that affects particular white blood cells (neutrophils, monocytes, macrophages, eosinophils). The illness is characterised by a failure to resist certain bacterial and fungal infections and a propensity to develop persistent inflammation. Life-threatening recurrent fungal and bacterial infections affecting the skin, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Chytridiomycota Overview
Chytridiomycota is a sub-group of zoosporic organisms from the kingdom Fungi. They are also known as chytrids. Named after the Ancient Greek word khutridion, which means "little pot", it refers to the structure that contains unreleased zoospores. The earliest diverging fungal lineages are the Chytrids. Their membership in kingdom Fungi can be seen with chitin cell wall, posterior whiplash flagellum and absorptive nutrition. They also use glycogen to store energy and produce lysine through the a-amino acid (AAA).
Cilia - Definition, Structure, Types, Function
Cilia Definition Characteristics of Cilium Structure of Cilium Cilia are extracellular protrusions that are membrane-bound, microtubule-containing, and formed from centrioles. They are structurally durable, as well as flexible and dynamic, having different mechanisms that regulate their composition and functions. On the basis of the patterns of microtubules found in the axonemes of the cilia, motile cilia ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Cilia and Flagella - Definition, Structure, Function
Cilia as well as Flagella are complex cytoplasmic filamentous structures that protrude through the cell's wall. They are small, particularly distinct appendices to the cell. The flagella (singular meaning flagellum) are hairy, long structures that extend out from the plasma membrane. They can be utilized to move the entire cell.
Cimex lectularius (Bed Bug) - Morphology, Life Cycle, Types, Control
What is Cimex lectularius? Classification of Cimex lectularius scientific name: Cimex lectularius Linnaeus (Insecta: Hemiptera: Cimicidae) Classification Level Classification Name Kingdom Animalia (Animals) Phylum Arthropoda (Arthropods) Subphylum Hexapoda (Hexapods) Class Insecta (Insects) Order Hemiptera (True Bugs, Cicadas, Hoppers, Aphids, and Allies) Suborder Heteroptera (True Bugs) Infraorder Cimicomorpha Superfamily Cimicoidea Family Cimicidae (Bed Bugs) Subfamily Cimicinae ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Circulatory System in Vertebrates - Components, Structure, Functions
The circulatory system is a vital component of vertebrates, consisting of two interconnected systems: the blood vascular system and the lymphatic system. While both systems play crucial roles in maintaining the body’s overall function, the circulatory system primarily refers to the blood vascular system. In vertebrates, the blood vascular system is a closed system characterized ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Circulatory System of Earthworm
Circulatory system of Earthworm The earthworm possesses a closed type of circulatory system, which plays a pivotal role in the transportation of nutrients, oxygen, and waste products throughout its body. This system is intricate and is composed of various components, each with its specific function. A. Blood Vessels behind 13th segments in Intestinal Region In the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Cis and Trans Isomers - Definition, Properties, Identification, Examples
What is Cis and Trans Isomers? What causes cis and trans isomerism? Cis and trans isomerism arise due to the restricted rotation around a double bond or in a ring structure. This restricted rotation locks the atoms or groups into specific spatial arrangements, leading to different isomeric forms. Let’s explore an example to understand the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Citric Acid Production
What is Citric Acid? Properties of Citric Acid – C6H8O7 C6H8O7 Citric Acid Molecular Weight/ Molar Mass 192.124 g/mol Density 1.66 g/cm³ Boiling Point 310 °C Melting Point 153 °C Citric Acid structure – C6H8O7 Which Microorganism is used for Citric Acid Production? Numerous microorganisms are utilised in the production of citric acid. There are ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Classical Pathway of Complement Activation
The classical pathway is a key immune system mechanism that plays an important role in defending the body from foreign invaders. It consists of a series of sequential interactions among complement components that result in the killing of target cells via a process known as cell lysis. The presence of an antibody attached to an antigen, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Classification of Bacteria Based on Cell Wall, pH, Temperature, salt, Nutrition, Oxygen, Shape
Little, single-celled creatures living practically everywhere are bacteria. They’re prokaryotic, meaning they lack a real nucleus. They differ from eukaryotic cells in that they lack membrane-bound organelles. Shapes vary; spherical (cocci), rod-like (bacilli), spiral (spirilla), or comma-shaped (vibrios). Their survival in hostile environments depends on this diversity. Some twist like corkscrews, designated as spirochaetes. There ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Classification of Fish (pisces) - Systematic Classification and Based on feeding habit, habitat and manner of reproduction
A fish is an aquatic vertebrate which is mostly characterized by the presence of gills throughout life, a streamlined body, and paired as well as unpaired fins which helps in swimming. It is the group that comprises jawless forms like hagfish and lampreys, cartilaginous fishes like sharks and rays, and the bony fishes which is ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Classification of Fungi - Gymnomycota, Mastigomycota, Amastigomycota.
The fungi are classified based on the characteristics of the sexual spores and fruiting bodies present during the sexual stages of their life cycles. Therefore, based on characteristics of their sexual stages and morphology of their asexual spores and thalli they are classified into different groups.
Classification of Insects - Basis of insect classification and Classification of insects up to orders
Insects are a diverse group of arthropods belonging to the class Insecta, characterized by their three-part body structure, which includes the head, thorax, and abdomen. They typically have six legs, compound eyes, and one or two pairs of wings. Insects exhibit remarkable adaptability, inhabiting a wide range of environments from deserts to oceans. They undergo ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Classification of Lipid
What are lipids? Classification of Lipids Based on the Chemical Composition 1. Simple Lipids Simple lipids are fundamental components in the realm of biological molecules. They primarily consist of neutral fats and oils, as well as waxes. These lipids play crucial roles in various biological processes, especially in energy storage and insulation. 2. Compound Lipids ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Classification of Protein On the Basis of Structure, Composition, Functions
What is Protein? Classification of protein On the Basis of Structure 1. Fibrous protein Fibrous proteins are a distinct category of proteins characterized by their elongated or fiber-like structure. These proteins are primarily found in animals and play specific roles in structural support. Therefore, understanding their nature, structure, and function is essential for a comprehensive ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Classification of Protozoa
Protozoa are defined as microscopic, acellular organisms that exist either singly or in colonies, characterized by a lack of tissues and organs and the presence of one or more nuclei. With approximately 50,000 known species within the Phylum Protozoa, these organisms exhibit a remarkable diversity and complexity despite their simple structure. Protozoa can be broadly ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Classification of Virus
What is a Virus? Structure and Function of Viruses Properties of Viruses Classification of Viruses Classification of Viruses On the Basis of Genetic Material Present Viruses can be classified based on the type of genetic material they contain. There are two main types of genetic material that viruses can have: DNA (deoxyribonucleic acid) or RNA (ribonucleic ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Cleavage - Definition, Types, Planes, Patterns, Significance
What is cleavage? Characteristics of cleavage Step by step process of Cleavage Types of cleavages The cleavage pattern in embryos mainly determined by yolk quantity and how that yolk is distributed by the cytoplasm.Also, timing and direction of mitotic spindle (inside egg) play important role. Yolk usually slow / restrict the process of complete division. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
CLED Agar - Composition, Principle, Preparation, Results, Uses
Cystine-Lactose-Electrolyte-Deficient (CLED) medium, first described by Sandys and later modified by Mackey and Sandys, is generally used for diagnostic routine urinary bacteriology as a non-selective medium capable of supporting the growth of most urinary pathogens. CLED Agar, a differential medium for the isolation and counting of bacteria from urine, is used. It supports the growth all potential urinary pathogens. The medium also provides distinct colony morphology. It is suitable for the growth of all urinary pathogens, contaminants, and provides good colonial differentiation. However, it does not allow for the spread of Proteus species because of its low electrolytes.
Climax Community - Definition, Characteristics, Theories
What is climax community? Climax community means Characteristics of a climax community Nature of Climax Community 1. Poly-climax and Mono-climax 2. Pattern theory of Climax Factors Affecting the Nature of Climax Community Transient and cyclic climax Theories of the Climax Community There are several ideas about what happens at the end: 1. Mono-climax Theory 2. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Cloning Vectors - Definition, Types, Features, Applications
What is Cloning Vector? A cloning vector is a small portion of DNA that can be maintained in an organism and into which a foreign DNA fragment can be inserted for the purposes of cloning. The vector for cloning may consist of DNA extracted from a virus, the cell of a higher organism, or the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Clostridium botulinum - Overview
Types of Botulism There are three primary forms of botulism: baby, wound, and foodborne. Additional clinical classifications include adult intestinal toxaemia and iatrogenic botulism. 1. Foodborne botulism 2. Infant botulism 3. Wound botulism 4. Adult intestinal toxemi 5. Iatrogenic botulism Morphology of Clostridium botulinum C. botulinum has the following characteristics: Habitat of Clostridium botulinum Geographical ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Clostridium perfringens - Habitat, Morphology, Pathogenesis, Treatment
What is Clostridium perfringens? Scientific classification of Clostridium perfringens Domain: Bacteria Phylum: Bacillota Class: Clostridia Order: Eubacteriales Family: Clostridiaceae Genus: Clostridium Species: C. perfringens Geographical Distribution and Habitat of Clostridium perfringens Clostridium perfringens is found globally, with varying types responsible for different diseases in humans and animals. Morphology of Clostridium perfringens Clostridium perfringens is a Gram-positive ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Clostridium Perfringens Food Poisoning
Characteristics of Clostridium perfringens Factors Contributing to C. perfringens Type A Foodborne Disease Source of contamination of Clostridium perfringens Clostridium perfringens enterotoxins Epidemiology of Clostridium perfringens food poisoning Synthesis and Release of CPE Effects of CPE on the GI Tract Pathogenesis of C. perfringens Food Poisoning Source of Enterotoxigenic C. perfringens Strains in Food Clinical Features of Clostridium perfringens ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Clostridium tetani - Overview
Tetanus is caused by C. tetani, an obligate anaerobic Gram-positive bacillus. Tetanus is an infectious disease characterised by increased muscle tone and spasms caused by the release of tetanospasmin, a neurotoxin produced by C. tetani when it is inoculated into humans. Morphology of Clostridium tetani C. tetani demonstrates the following characteristics: Geographical distribution of Clostridium ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Clostridium Under Microscope
What is Clostridium? Morphology of Clostridium Gram Staining of Clostridium The bulk of Clostridium are Gram-positive rods. C. difficile, for example, is a Gram-positive Clostridium that will look dark blue/violet due to the retention of the main stain (crystal violet) in its thick peptidoglycan layer. Although these bacteria appear Gram-positive, under certain conditions, they can ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Coagulase Test - Principle, Procedure, Application, Result.
It is a type of biochemical test, which is used to differentiate Staphylococcus aureus from coagulase-negative staphylococci. S.aureus produces two forms of coagulase (i.e., bound coagulase and free coagulase).
Coarse Adjustment and Fine Adjustment Knob of Microscope
What is Fine Adjustment Knob? Particularly in high magnification levels, the fine adjustment knob is an essential part of a microscope as it helps to achieve exact and crisp focus. Particularly in the study of cells, microscopes are essential instruments in scientific inquiry as they let us view objects beyond our human sight. Under a ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Coccidioidomycosis - Definition, Life Cycle, Pathogenesis
Coccidioides is a genus of dimorphic fungi that exist as both mycelia and spherules. Mycelia and spherules are both asexual structures. Sexual coccidiosis has not been identified. The results of a molecular analysis indicate that Coccidioides is related to ascomycetes such as Histoplasma capsulatum and Blastomyces dermatitidis. There are two recognized taxa within the genus ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
COD Test - Test for Chemical Oxygen Demand In Wastewater
COD Test (Chemical Oxygen Demand test) is a water quality test. It is used to determine the amount of oxygen required to chemically oxidize the organic and inorganic pollutants present in a water sample. It is based on oxidation of pollutants by a strong chemical oxidant. Generally potassium dichromate (K2Cr2O7) is used in heated and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Coding Strand vs. Template Strand - Difference Between Template and Coding Strand
The Difference between a template and a coding strand is primarily based on two characteristics: directional polarity and function. The two distinct strands of double-stranded DNA are the template strand and the coding strand, with the former functioning as a base to transcribe mRNA and the latter determining the correct base sequence of the mRNA. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Codominance - Definition, Examples, Importance
What is Codominance? Definition of Codominance Codominance is a genetic scenario where two different alleles at a locus are both fully expressed in a heterozygote, resulting in a phenotype that displays traits of both alleles simultaneously. What are the Symbolism for codominant alleles? Examples of Codominance Codominance in Animals Codominance in Humans Codominance in Plants ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Codon Chart - Codon Table, mRNA Codon Chart, Amino Acids & RNA Wheel Explained
An codon chart is presented as a compact key, that maps three-nucleotide codons to amino acids, and it is usually shown as a table or circular map. In the chart, each codon is represented by three bases (A, U, G, C) and is read in the 5’→3’ direction, misreading the direction will alter meaning. Sixty-four ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Coelomates - Types, Characteristics, Functions, Evolution, Metamerism
What are Coelomates? Definition of Coelom The coelom is a fluid-filled body cavity located between the digestive tract and the body wall, completely lined by mesodermal tissue. It provides space for organ development, movement, and a hydrostatic skeleton in many animals. Characteristics Features of Coelom Below are the special features of the coelom that distinguish ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Cold-blooded vs Warm-blooded animals
The animals that are cold-blooded are those who are incapable of controlling their body's temperature in accordance with temperatures of their environment.
Coliform Bacteria - Definition, Classification, Examples
What are Coliforms? Introduction Classification of Coliforms Escherichia Edwardsiella Citrobacter Klebsiella Klebsiella rhinoscleromatis Klebsiella ozaenae Klebsiella oxytoca Enterobacter Hafnia Serratia Proteus Morganella Providencia Erwinia
Coliform Presence/Absence (PA) Test - Principle, Procedure, Result, Uses
What is Coliform Presence/Absence Test? Coliform Presence/Absence (P-A) test is a rapid simple and inexpensive qualitative method which is used mainly for monitoring treated drinking water and distribution system for fecal indicator bacteria (coliforms). It is the modification of traditional multiple-tube fermentation technique where a single large water sample volume is inoculated in one culture ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Collagen - Definition, Structure, Types, Functions
What is Collagen? Definition of Collagen Collagen is the most abundant protein in the body, providing structural support to connective tissues such as skin, bones, tendons, and ligaments. It consists of a triple helix of amino acids, forming a framework that maintains the integrity and elasticity of various tissues. Collagen plays crucial roles in wound ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Collagen Hybridizing Peptide Staining - Principle, Procedure, Uses
Collagen Hybridizing Peptide stain is a vital stain used for the detection of collagen degraded tissues, mainly used in Developmental Biology, Histology, and Histopathology.
Colony Counter - Types, Principle, Parts, Uses, Examples
What is Colony Counter? Definition of Colony Counter A colony counter is a device used in microbiology laboratories to count bacterial or microorganism colonies on a solid growth medium. It simplifies and accelerates the colony counting process, providing an accurate measurement of colony forming units (CFUs) in a given sample. Purpose of colony counting Type ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Colony Morphology of Bacteria with their identification and Examples
What is Colony Morphology of Bacteria? Colony morphology of bacteria means the visible features seen in bacterial colonies when they grow on solid media like agar plates. Each colony usually comes from one bacterial cell that divides and forms a clump. These clumps or colonies can look very different based on the species and conditions, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Color Spectrophotometer - Principle, Parts, Procedure, Applications
What is Color Spectrophotometer? A color spectrophotometer is referred to as an optical instrument that is utilized for measuring the intensity of light at various wavelength’s, which gives a look into how a sample’s surface reflect or absorb color’s in a quite systematic way. It is considered a device that records the reflectance spectrum, which ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Colorimeter - Definition, Principle, Parts, Procedure, Applications
A colorimeter is a scientific instrument used to measure the absorbance of light by a colored solution to determine the concentration of solutes. Based on the Beer-Lambert law, the principle of colorimeter explains how light intensity changes as it passes through a solution. The instrument mainly consists of essential parts of colorimeter like a light ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Colorimeter vs Spectrophotometer
What is Colorimeter? A colorimeter is a sophisticated scientific instrument dedicated to the domain of colorimetry, the science of measuring the absorbance and transmittance characteristics of light as it propagates through a liquid medium. The underlying principle governing its operation is the renowned Beer-Lambert’s law, which correlates the light absorbed or transmitted by a sample ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Coltivirus - Structure, Genome, Replication, Pathogenesis
Coltivirus is a virus genus (of the family Reoviridae) that infects both vertebrates and invertebrates. It contains the agent that causes Colorado Lyme fever. The Colorado tick fever virus can lead to fever, shivers, headache, photophobia, myalgia, arthralgia, and fatigue. Children are especially susceptible to developing a hemorrhagic disease. Leukopenia containing both lymphocytes and neutrophils ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Columbia Blood Agar Base w/ Hemin - Composition, Preparation, Principle, Result, Uses
What is Columbia Blood Agar Base? Principle of Columbia Blood Agar Base The principle of Columbia Blood Agar Base lies in its composition and functionality in supporting the growth and differentiation of various bacterial species. Here are the key principles of Columbia Blood Agar Base: Composition of Columbia Blood Agar Base Ingredients Gms/Litre Peptone special ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Columbia CNA Agar - Composition, Preparation, Uses, and Results
What is Columbia CNA Agar? Columbia CNA Agar with 5% Sheep Blood Composition of Columbia CNA Agar per Liter of Medium The composition of Columbia CNA Agar can be summarized as follows, considering the information provided: Ingredients: The base of Columbia CNA Agar is prepared using a nutritionally rich medium that includes different peptones to ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Column Chromatography - Principle, Steps, Parts, Uses, Advantages
Chromatography is a laboratory analytical technique which is used to separate a chemical mixture into its individual components. It is used for identification, purification and estimation of different substances present in a mixture. It separates the components according to their different movement through two phases. In this technique, the mixture is distributed between a mobile ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Commensalism - Definition, Types, Example
What is Commensalism? Along with mutualism, the term was coined in 1876 by Belgian palaeontologist and naturalist Pierre-Joseph van Beneden. Beneden first used the term to describe the behaviour of carrion-eating animals that followed predators in order to consume their leftover meal. The term commensalism is derived from the Latin word commensalis, which meaning “table ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Common Ancestry - Definition, Theory, Evidence
What is Common Ancestry? The theory of common ancestry The theory of common ancestry posits that all life on Earth descends from a singular “universal common ancestor.” This foundational concept in evolutionary biology provides insight into the interconnectedness of all living organisms and how they have evolved over time through adaptation to their environments. Predictions ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Common Fungal Culture Media and Their Uses
To ensure that clinical specimens are properly cultured, two types of media are required. The non-selective medium (e.g. Brain Heart Infusion Agar) should be used. Other media should be specific and tailored to isolate pathogenic fungi.
Communicable Diseases - Types, Transmission, Control
What is Communicable Disease? Types of Communicable Diseases Communicable diseases are illnesses caused by pathogens, which can spread from one person or animal to another. These diseases are typically transmitted through various means, such as direct contact, contaminated food or water, blood, or bodily fluids. Here’s a breakdown of the main types of communicable diseases. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Community - Definition, Types, Characterisitcs, Importance
What is Community in Ecology? Types of Community Types of community can be classified based on their size and self-regulatory capabilities. Here are the main types of communities: Communities can also be classified based on their openness or closedness: Understanding the types of communities helps ecologists study the dynamics, interactions, and adaptations within different ecological ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Community Characteristics - Dominance, Diversity, Species richness, Abundance, Stratification
Characteristics of Community These characteristics collectively contribute to the unique structure, function, and dynamics of communities, highlighting the complex and interconnected nature of ecological systems. Understanding these characteristics helps ecologists study and conserve communities and the interactions that occur within them. 1. Trophic organization Trophic organization is a fundamental concept in ecology that describes the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Comparative Anatomy and associated glands of Digestive Systems In Vertebrates
The digestive tract of vertebrates The digestive tract of vertebrates consists of several distinct parts, each playing a crucial role in the overall process of digestion. From the mouth to the glands associated with digestion, this system is designed to break down food, absorb nutrients, and expel waste. Below is a detailed breakdown of the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Comparison Between Acid Fast and Non Acid Fast Bacteria
Acid Fast bacteria resist the decolorizing by acid after staining. Non Acid Fast Bacteria readily resist the decolorizing by acid after staining.
Comparison Between Gram Stain and Acid Fast
Gram stain refers to a staining technique for the preliminary identification of bacteria, in which a violet dye is applied, followed by a decolorizing agent and then a red dye.
Comparison Between Kinyoun Stain vs Ziehl neelsen stain
In Kinyoun stain method basic fuchsin is used as a primary stain.
Competition Interaction - Definition and Types with Examples
What is Competition Interaction? Competition is defined as an interaction between two or more individuals of the same population or between two or more populations in which each adversely affects the other’s access to limited resource(s) (food, water, nesting sites, shelter, mates, etc.). Mutualism is defined as a population interaction that benefits both parties. Competitive ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Competitive ELISA - Principle, Protocol, Applications
What is Competitive ELISA? Principle of Competitive ELISA The principle of competitive ELISA is based on the competitive binding process that occurs between two specific antibodies and an antigen of interest. In this assay, two antibodies are utilized: one is conjugated with an enzyme, and the other is present in the test serum (if the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Complement Components - Definition, Functional categories
What is Complement? Functional categories of Complement Components Complement components can be classified into seven functional categories: 1. Initiator complement components 2. Enzymatic mediators 3. Membrane-binding components or opsonins 4. Inflammatory mediators 5. Membrane attack proteins 6. Complement receptor proteins 7. Regulatory complement components FAQ
Complement Fixation Test - Principle, Types, Procedure, Results, Applications
What is Complement Fixation? Principle of Complement Fixation Test The principle of the complement fixation test is based on the interaction between antigens, antibodies, and complement proteins. When an antigen and antibody come into contact, they form an antigen-antibody (Ag-Ab) complex. This complex then interacts with complement proteins and becomes fixed with them. As a ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Complement System - Definition, Activation, Effects, Regulation
Complement System Definition The complement system, also known as the complement cascade, is a component of the immune system that boosts the ability of antibodies and phagocytic cells to eliminate germs and damaged cells from an organism, stimulate inflammation, and assault the cell membrane of a pathogen. Properties of Complement Complement demonstrates the following attributes: ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Composite Fish Culture - Definition, Steps, Advantages
What is Composite Fish Culture? Steps in Composite Fish Culture 1. Site selection Site selection is a critical aspect of aquaculture that significantly influences the success of fish farming operations. Choosing an appropriate site requires a comprehensive evaluation of various factors that can affect fish health, growth, and overall productivity. The process can be categorized ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Composting - Methods, Types, Factors, Importance
What is Composting? Important ingredients required for function of Microorganisms Mechanism of Composting Organisms can decompose organic materials in compost if the proper mixture of water, oxygen, carbon, and nitrogen is present. There are two basic groups of decomposers: chemical decomposers, which execute chemical processes on organic waste, and physical decomposers, which reduce trash to ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Compound Microscope - Principle, Parts, Diagram Definition, Application
Compound Microscope is an optical instrument in which two lenses are used to magnify the small specimen. It is also called light microscope. The two lenses are objective lens and eyepiece lens. The objective lens is near the specimen and eyepiece lens is near the eye. The specimen is placed on glass slide. Light is ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Concept of Species - Definition, Types, Importance, Modes of speciation
The concept of species has been a subject of ongoing debate and controversy among taxonomists and biologists. The task of defining and recognizing species is crucial for understanding the diversity and organization of life on Earth. Over time, various species concepts have been proposed to tackle this challenge, each with its own merits and limitations. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Conducting System of Heart Beat
Overview of Heart Conduction The conduction system of the heart is a complex network that orchestrates the electrical signals required for heart muscle contraction. This system ensures that the heart beats in a coordinated manner, facilitating efficient blood circulation throughout the body. The process begins with the generation of an electrical signal, which propagates through ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Confocal Microscope - Principle, Parts, Uses
Confocal Microscope is an advanced optical microscope that is used to produce clear and sharp image by removing the out-of-focus light. It uses laser light to focus on a single point of the specimen. It gives better resolution and contrast than the ordinary light microscope. In confocal microscope, the light is not passed through the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Conical Flask (Erlenmeyer flask) - Diagram, Definition, Types, Uses
Conical flask or Erlenmeyer flask is a laboratory flask with flat bottom, conical body and narrow neck. It is used for mixing, heating, cooling and storing of liquid chemicals. It was made by German chemist Emil Erlenmeyer in 1860. The wide body and narrow neck helps in swirling of liquid without spilling. The narrow neck ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Connective tissue - Structure, Location, Function and Classification
What is Connective tissue? Definition of Connective tissue Connective tissue is a type of animal tissue that supports, connects, and protects various structures in the body. It consists of fibers, ground substance, and cells, and is found between other tissues and organs. It provides structural support, flexibility, and plays a role in the transportation of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Consumers - Definition, Types, Examples
What is Consumer? Consumer is a category that belongs inside an ecosystem’s food chain. It primarily refers to animals. Consumers cannot generate their own energy and must rely on the intake and digestion of producers, other consumers, or both in order to survive. Types of consumer 1. Primary consumers Examples of Primary consumers 2. Secondary ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Contamination of Foods
The growing plants carry a common microbiome on their surfaces. They could be contaminated by external sources. Animals too have a normal surface flora, as well as an intestinal one. They also release organisms through excretions and secretions. They can are also contaminated by outside sources. Animals and plants with parasitic diseases, of course, carry the pathogen responsible for the illness. The healthy tissues that are inside both animals and plants nevertheless are found to have a small number of living microorganisms or none at all.
Contamination, Preservation, and Spoilage of Cereals and Cereal Products
What is spoilage? Contamination of Cereals and Cereal Products Contamination source of cereal products Cereal products, such as grains and flour, can be susceptible to contamination from various sources throughout their production and supply chain. Understanding these potential sources is crucial for ensuring the safety and quality of these food items. Here are some common ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Continuous Culture - Definition, Advantage, Application, Systems
Continuous Culture Definition Continuous Culture is an ‘open’-culture system for the cultivation of microorganisms or cells in which fresh sterilized medium is introduced at a steady flow rate and from which the culture fluid emerges at the same rate. Continuous Culture Advantages System applied for Continuous Culture There are two systems used for Continuous Culture ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Contribution of Ignaz Semmelweis, Hans Christian Gram, Charles Lavaran, Fanny Hesse, Marjory Stephenson, Kiyoshi Shiga, Emil von Behring.
1. Ignaz Semmelweis Ignaz Semmelweis was a Hungarian physician and obstetrician (1818–1865). He is regarded as the “savior of mothers”. He worked in a maternity clinic in Vienna where high maternal deaths were observed after childbirth. It was during this period that he studied the cause of puerperal fever. Key Contributions of Ignaz Semmelweis Some ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Contribution of Louis Pasteur in Microbiology.
Who Was Louis Pasteur? Louis Pasteur was a French chemist and microbiologist who is regarded as one of the founder of modern bacteriology and microbiology. He was born in 1822 at Dole in France. His work is considered as the foundation of microbiology and immunology. In the early period of his career, he studied chemistry, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Contribution of Microbiologists: Joseph Lister, Alexander Fleming, Edward Jenner, Lazzaro Spallanzani, Martinus Beijerinck.
1. Joseph Lister Joseph Lister was a British surgeon and medical scientist. He was born in Essex, England in 1827 in a Quaker family. He is regarded as the father of modern surgery and father of antiseptic surgery. He obtained the degree of Bachelor of Medicine from University College London in 1852. His main work ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Contribution of Paul Ehrlich and John Snow In Microbiology
Paul Ehrlich Paul Ehrlich (1854–1915) was a German physician, biochemist and scientist. He is regarded as one of the founders of modern hematology, immunology and chemotherapy. His work was mainly concerned with immunity, staining techniques and chemical treatment of diseases. In 1908, he was awarded the Nobel Prize in Physiology or Medicine along with Élie ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Contribution of Robert Koch and Koch’s Postulates
Who was Robert Koch? Heinrich Hermann Robert Koch (1843–1910)was a German physician and microbiologist. He is regarded as one of the founder of modern bacteriology. He is most famous for discovering the specific bacteria causing deadly infectious diseases. Anthrax is caused by Bacillus anthracis. Tuberculosis is caused by Mycobacterium tuberculosis. Cholera is caused by Vibrio ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Contribution of Selman Waksman, Julius Wagner-Jauregg, Charles Nicolle, Gerhard Domagk, Howard Florey, Ernst Chain, Max Theiler.
1. Julius Wagner-Jauregg Julius Wagner-Jauregg was an Austrian psychiatrist. He was the first psychiatrist who received the Nobel Prize in Physiology or Medicine. He is mainly known for introducing malarial therapy for the treatment of neurosyphilis. It is considered as one of the earliest biological treatment in psychiatry. Key Contributions of Julius Wagner-Jauregg Development of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Contributions of Antonie van Leeuwenhoek
Who was Antonie van Leeuwenhoek? Antonie van Leeuwenhoek was a Dutch scientist who is regarded as the Father of Microbiology. He was born in 1632 in Delft, Netherlands. He did not receive formal higher education and he spoke only Dutch. He started his career as a linen draper. In this work he used small magnifying ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Control Group - Definition, Importance, Examples
What is Control Group? Definition of Control Group A control group is a set of subjects in a scientific experiment who do not receive the treatment or intervention being studied, serving as a benchmark for comparison against the treatment group to determine the effect of the variable under investigation. Importance of Control Group The control ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Controlled Experiment - Definition, Process, Importance, Examples
What is Controlled Experiment? Definition of Controlled Experiment A controlled experiment is a scientific investigation in which a researcher deliberately manipulates a specific variable, while keeping all other variables constant, to determine its effect on a system under study. How Does Controlled Experiment Works? A controlled experiment works by systematically testing a hypothesis through the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Conventional methods of aquaculture
Key Takeaways Pond Aquaculture Types of ponds and their aquacrops The cultivation of aquatic crops in various types of ponds is primarily determined by the salinity of the water, which influences the selection of species that can thrive in these environments. Understanding the different types of ponds and the specific aquacrops associated with each is ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Coomb’s Test - Direct and Indirect Coomb’s Test
What is Coomb’s Test? Objectives of Coomb’s Test The objectives of Coomb’s test are to detect red blood cells that are sensitized with IgG alloantibodies, IgG autoantibodies, or complement components. This helps in determining blood group compatibility for transfusions, diagnosing autoimmune hemolytic anemia, and identifying immune-mediated reactions and conditions such as paroxysmal nocturnal hemoglobinuria. Overall, the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Copyrights - Definition, Objective, Terms, Rights, Registration, Transfer
What is Copyright? Definition of Copyright Copyright is a legal right that grants creators exclusive control over the use, reproduction, distribution, and performance of their original works for a limited time. Exclusive Copyright Rights Exclusive copyright rights encompass a set of specific entitlements granted to the copyright owner. These rights enable the owner to control ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Coral Reefs - Types, Structure, Habitat, Formation, Importance
What are Coral Reefs? Structure of a coral polyp Coral polyps are fundamental building blocks of coral reefs, exhibiting a unique structure that facilitates their role in these vibrant ecosystems. Generally small, a typical coral polyp measures about 10 mm in length and 1 to 3 mm in diameter. Although some solitary polyps can reach ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Cori Cycle - Definition, Steps, Regulation, Importance
What is the Cori Cycle? Cori Cycle Definition The Cori Cycle is a metabolic pathway in which lactate produced by anaerobic glycolysis in muscles is transported to the liver, converted back into glucose, and then returned to the muscles for energy production. This cycle plays a crucial role in maintaining energy balance during periods of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Coronary circulation - Anatomy, Physiology, Vasculature of the Heart
What is Coronary circulation? Anatomy Of the coronary circulation The anatomy of the coronary circulation is crucial for understanding how the heart receives its blood supply. This system consists of the coronary arteries and veins, which work together to deliver oxygen-rich blood to the myocardium and return deoxygenated blood back to the heart. Coronary Arteries ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Coronavirus - Definition, Structure, Genome, Replication
Coronavirus Characteristics of COVID-19 Structure of Coronavirus Genome of Coronavirus Epidemiology of Coronavirus The novel coronavirus SARS-CoV-2 is the cause of the 2019 coronavirus disease (COVID-19). The virus was identified for the first time in December 2019 in Wuhan, China, and has since spread worldwide, resulting in a pandemic. Here are some essential aspects of the epidemiology of COVID-19: Replication of Coronavirus ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Corynebacterium diphtheriae - Morphology, Pathogenesis, treatment
What is Corynebacterium diphtheriae? Scientific classification of Corynebacterium diphtheriae Domain: Bacteria Phylum: Actinomycetota Class: Actinomycetia Order: Mycobacteriales Family: Corynebacteriaceae Genus: Corynebacterium Species: C. diphtheriae Geographical Distribution and Habitat of Corynebacterium diphtheriae Corynebacterium diphtheriae is the causative agent of diphtheria, and its distribution is heavily influenced by geographic, environmental, and immunization factors. Here’s a breakdown of where ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Counter Current Immunoelectrophoresis - Principle, Procedure, Result.
Counter current immunoelectrophoresis is a modification of immunoelectrophoresis in which antigen and antibody migrate towards opposite directions and form a visible white precipitate in the area between the wells.
Cranial Nerves in Mammals - Definition, Types, Structure, Functions
What is Cranial nerve? Definition of Cranial nerve Cranial nerves are a set of twelve pairs of nerves that emerge directly from the brain and are responsible for controlling various functions in the head, neck, and some organs in the chest and abdomen. These nerves transmit sensory information, such as sight, hearing, taste, and touch, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Cresol Red Solution Preparation and Uses
Cresol red is used as a tracking dye for DNA/RNA in agarose gel electrophoresis and protein in polyacrylamide gel electrophoresis.
Crimean-Congo Hemorrhagic Fever Virus - An Overview
Crimean-Congo Hemorrhagic Fever (CCHF) is a viral disease that is transmitted to humans by ticks. It is a highly infectious and severe disease that can be fatal in up to 50% of cases. The virus is found in many parts of the world, including Africa, Asia, and Europe. CCHF is caused by a virus in ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
CRISPR-Cas9 Gene Editing - Definition, Mechanism, Application
What is gene/genome editing? Gene or genome editing refers to the deliberate and precise modification of an organism’s genetic material. This advanced biotechnological process allows for the targeted alteration of DNA sequences within a genome, facilitating the correction of genetic anomalies or the introduction of specific traits. Historically, the concept of gene editing traces its ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Crossing Over - Definition, Types, Mechanism, Significance, Example
What is Crossing over? Definition of Crossing over Crossing over is the exchange of genetic material between non-sister chromatids of homologous chromosomes during prophase I of meiosis, resulting in new combinations of genes. Characteristics of Crossing over At which stage Crossing over occurs? Types of Crossing over Crossing over can be categorized based on its ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Cryo Electron Microscopy - Principle, Procedure, Advantages, Limitations and Applications
What is cryo-EM? Principle of cryo EM Types of cryo EM Cryo-electron microscopy (cryo-EM) is a collection of special methods. These are broadly categorized into two types, mainly cryo-transmission electron microscopy (cryo-TEM) and cryo-scanning electron microscopy (cryo-SEM). Each has its own advantage in the analysis of biological samples in their native state, frozen by cryo-preparation. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Cryptococcus neoformans - Structure, Infection, Habitat
Characteristics of Cryptococcus neoformans Habitat of Cryptococcus neoformans Morphology of Cryptococcus neoformans Cultural characteristics of Cryptococcus neoformans Life Cycle of Cryptococcus neoformans Virulence Factors of Cryptococcus neoformans Cryptococcus neoformans is a fungal pathogen that causes life-threatening infections, primarily in immunocompromised individuals. Some of the virulence factors of Cryptococcus neoformans are: These virulence factors enable Cryptococcus neoformans to evade host ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
CSIR NET-JRF Life Sciences Previous Year Question Papers (2011-2024)
Download CSIR NET-JRF Life Sciences Previous Year Question Papers (2011-2023) Prepare effectively for the CSIR NET-JRF Life Sciences exam with our comprehensive collection of previous year question papers from 2011 to 2023. Access a curated archive of past exams to enhance your study strategy and familiarize yourself with the exam pattern. These question papers are ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
CUET-PG (Life Sciences, Biochem, Botany and Zoology) Syllabus
Number of tests Once in a year Participating Universities More than 140 Central and Participating universities 142 Subject/Programme Life Sciences, Microbiology, Biochemistry, Biotechnology,Bioinformatics, Zoology, Botany, Human Genetics,Molecular Medicine, Genomic Science and Nutrition Biology Organized by NTA Medium of examination Hindi and English Mode of examination Computer based test (CBT) Time duration 2 Hours (120 minutes) ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Cultivation of Anaerobic Bacteria
What are Anaerobic bacteria? Characteristics of Anaerobic Bacteria Cultivation of Anaerobic Bacteria Cultivation of Anaerobic Bacteria. Stringent anaerobes can be grown only by taking special precautions to exclude all atmospheric oxygen from the medium. Such an environment can be established by using one of the following methods: Cultivation of Anaerobic Bacteria using Prereduced media Procedure ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Cultivation of bacteria
Bacteria constitute a vital element in the ecology. They are essential to our health as well as the environmental health, play an essential role in the production of food, and offer bioengineers the tools to harness their abilities and produce compounds. However, they could also be harmful, causing harm and diseases. The capacity to cultivate ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Culture Media - Definition, Types, Composition, Use, Examples
When it comes to culturing bacteria, it is crucial to create the same environmental and nutritional conditions as those found in the natural environment. The majority of culture mediums contain water, which is a major source of carbon and energy and nitrogen. It also contains trace elements, as well as some growth factors. In addition, the pH as well as oxygen tension and Osmolarity must also be considered. Some of the components of media for culture include: Although tap water is appropriate for the use of culture media, it shouldn't be used in the event that it contains a significant amounts of minerals. In these instances the use of demineralised or distillated water is recommended.
Culture Media Examples Chart and Table With components and Purpose
Culture Media Examples Components/Comments Primary Purpose Bile esculin agar (BEA) Nutrient agar base with ferric citrate. Hydrolysis of esculin by group D streptococci imparts a brown color to medium; sodium deoxycholate inhibits many bacteria. Differential isolation and presumptive identification of group D streptococci and enterococci Bile esculin azide agar with vancomycin Contains azide to inhibit ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Culture Media Preparation, Maintenance and Preservation
Culture medium refers to the nutrient-rich substance that is used in labs to culture microorganisms such as bacteria and fungi. These materials, whether liquid or solid, provide the microbes with needed nutrients, minerals and other factors for growth and reproduction according to step-by-step reports from authoritative sources around the world. The late 19th century was ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Culture Medium - Definition, Preparation, Classification
The food supply upon which microorganisms thrive in laboratories is termed as a culture medium or culture media. Culture Medium Definition The nutrient preparation on or in which a culture (microorganism) is grown in the laboratory is known as culture medium or culture media. Classification of culture media/Types of Culture Medium Many special-purpose media are ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Cultures Production for Food Fermentations
General Principles of Culture Maintenance and Preparation Selection of Cultures Maintenance of Activity of Cultures Maintenance of Purity of Cultures Preparation of Cultures Activity of Culture Mixed Cultures Bacterial Cultures With the exception of the propionic acid bacteria added to Swiss cheese, the majority of the bacterial cultures used as starters in dairy products, sausage, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Cyanobacteria - Definition, Characteristics, Structure, Functions, Examples
What is Cyanobacteria? Definition of Cyanobacteria/Cyanobacteria definition Cyanobacteria are photosynthetic bacteria that obtain energy through photosynthesis. They are often referred to as blue-green algae, although they are not classified as true algae. Cyanobacteria played a crucial role in the production of oxygen and the shaping of Earth’s atmosphere. They can be found in various aquatic ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Cycas - Morphology, Anatomy and Reproduction
Category Name Division Cycadophyta Class Cycadopsida Order Cycadales Family Cycadaceae Genus Cycas Distribution of Cycas Cycas is the largest genus within the Old World Cycads and stands out as the most widely distributed genus in the order Cycadales. Its distribution spans across various geographical regions, showcasing its adaptability and ecological significance. Below is a detailed ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Cyclic AMP Pathway (Cyclic Adenosine Monophosphate)
What is Cyclic AMP pathway? Synthesis of Cyclic AMP Cyclic AMP pathway Functions of Cyclic AMP References
Cyclops - Habitat, Morphology, Life Cycle, Control, Importance
What is Cyclops? Cyclops is a genus of small freshwater crustaceans which belongs to the subclass Copepoda. It is commonly referred to as water flea due to its small size and free swimming nature. It is named after the one-eyed giants of Greek mythology as a single median eye is present at the centre of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Cysticercosis - Definition, Symptoms, Treatment, Diagnosis
What is Cysticercosis? Clinical manifestations of Cysticercosis Cysticercosis is a parasitic infection caused by the larval stage of the tapeworm Taenia solium. The clinical manifestations of cysticercosis depend on the location of the cysticerci (larval stage) within the body. It’s worth noting that not all patients with cysticercosis will experience symptoms. Asymptomatic cysticercosis is often ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Cystine Glucose Blood Agar - Composition, Principle, Preparation, Results, Uses
Cystine Glucose blood agar is also known as Cystine Heart Agar. Francis developed blood-dextrose-cystine agar after determining F. tularensis would only grow on an artificial medium supplemented with sulfhydryl compounds (i.e., cystine). F. Tularensis is extremely meticulous organism that requires cystine to grow at its best. To honor the achievements of all time of Francis in the field of understanding the disease it was named Francisella Tularensis. The hemoglobin-rich medium is suggested to cultivate Francisella Tularensis. Without enrichment supplies, it facilitates the growth of cocci gram-negative and other pathogenic organisms.
Cystine Tryptic Agar - Composition, Preparation, Principle, Uses
Cystine tryptic agar (CTA) which is also referred to as cystine trypticase agar was created by Vera as an semi-solid growth medium to identify and maintain the health of microorganisms for long time period of time when stored at suitable temperatures. It's used for determination of the motility of bacteria and, when combined with carbohydrate, is involved in the fermentation process and the differentiation of microorganisms that are fastidious, such as Neisseria and streptococci, as well as pneumococci and non-spore-forming anaerobes.
Cytodifferentiation - Definition, Primary Steps, Protocol
What is Cytodifferentiation? Steps in Cytodifferentiation Cytodifferentiation involves a series of critical steps that lead to the specialization of cells within a culture, particularly in plant tissue culture. The fate of individual cells during this process is inherently variable and influenced by both intrinsic and extrinsic factors. As a result, the cytodifferentiation process is not ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Cytokinesis - Definition and Process In animal and Plant Cells
What are Cytokines? Definition of Cytokines Cytokines are small proteins that play a crucial role in cell signaling, mediating communication between cells and regulating various physiological processes. What is Cytokinesis? Definition of Cytokinesis Cytokinesis is the process of cell division in which a single cell divides into two daughter cells, each with its own nucleus ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Cytoplasm - Functions, Structure, Definition, and Diagram
The cytoplasm, a highly viscous substance (gel-like) that is enclosed within the cell membrane. It is composed of water (about 85%), proteins (10-15%), lipids (2-4%) and nucleic acids, inorganic salts, and polysaccharides in smaller amounts. Depending on the cell's configuration, cytoplasm might also contain occasional inclusions (e.g. stored nutrients and pigments).
Cytoplasmic Matrix - Definition, Structure, Properties
Cytoplasmic Matrix Physical Nature of Cytosol (Or Cytoplasmic Matrix) The cytosol (cytoplasmic matrix) is a colloidal substance that is colourless or greyish, transparent, viscous, gelatinous, or jelly-like. It is more dense than water and may flow. In the past, there has been considerable debate on the physical nature of the matrix. Regarding the physical properties ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Cytoplasmic or Extra-Nuclear Inheritance - Definition, Examples, Significance
What is Cytoplasmic or Extra-Nuclear Inheritance? Cytoplasmic inheritance, also known as extrachromosomal or extranuclear inheritance, refers to the transmission of genetic material that is not found within the nucleus but rather in the cytoplasm of a cell. This type of inheritance contrasts with Mendelian inheritance, which involves nuclear genes. In cytoplasmic inheritance, the genetic information ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Cytoskeleton - Definition, Structure, Functions
The cytoskeleton is a dynamic network of protein filaments found in the cytoplasm of all cells, including those of bacteria and archaea. It stretches from the cell nucleus to the cell membrane in eukaryotes and is composed of the same proteins in all organisms. It consists of microfilaments, intermediate filaments, and microtubules, all of which ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Cytotoxic T cells - Development, Activation, Functions
What is a Cytotoxic T cell? Development of CD8+ T cells Effector CTLs Are Generated from CTL Precursors Activation and differentiation of CD8+ T cells Cytotoxicity Mediated by CD8+ T Role in anti-viral immunity Role in anti-tumor immunity What are Memory CD8+ T cells? All of these effector and memory subsets work together to generate ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Czapek’s Agar (CZA) - Composition, Principle, Preparation, Results, Uses
Czapek medium (also known as Czapek’s agar or Czapek Dox medium) is a medium used to grow fungi and other organisms. This medium is suitable for qualitative cultivation of soil bacteria and saprophytic fungi. Czapek originally created the medium in 1902 to cultivate saprophytic mushrooms. Czapek-Dox Agar, a modified formula of the Czapek (1902-1903) and Dox (1910) formulas, is prepared according to Thom & Church. Medium contains sucrose as the only source of carbon, and nitrate is the only inorganic nitrogen source.
Dark Field Microscopy - Principle, Parts, Procedure, Uses
Dark field microscopy is a special illumination technique used in light microscope to increase contrast of transparent, unstained or low contrast specimens. The specimen looks bright, and the background looks dark or almost black. It is useful when normal bright background observation is not giving clear contrast. It is done by using a modified condenser ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Darwinism Theory - Definition & Examples
What is Darwinism Theory? The Theory of Evolution – Darwinism Theory The Theory of Evolution, formulated by Charles Darwin in the mid-19th century, is a scientific explanation for the diversity of life on Earth. It is considered one of the most important and well-supported scientific theories in the field of biology. At its core, the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Databases in Bioinformatics - Types, Functions, Examples, Tools
What is Bioinformatics? Bioinformatics is an interdisciplinary discipline that analyses and interprets biological data by combining biology, computer science, mathematics, and statistics. It involves the creation and application of computational tools, algorithms, and databases for storing, retrieving, managing, and analysing biological data. Bioinformatics is essential for organising, analysing, and deriving meaningful insights from enormous quantities ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Daughter Cells - Definition, Formation, Importance, Examples
What are Daughter Cells? Definition of Daughter Cells Daughter cells are the cells resulting from the division of a single parent cell, either through the process of mitosis, where they inherit identical genetic material, or meiosis, where they receive half the genetic content. Characteristics of Daughter Cells Daughter cells are the end products of cellular ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
DBT-JRF (BET) Biotechnology Eligibility Test Question Papers
GAT-B (Biotech) DBT-JRF (BET) Biotechnology Eligibility Test – Previous Year Question Papers Download: Excel in the GAT-B (Biotech) DBT-JRF (BET) Biotechnology Eligibility Test with our collection of previous year question papers. Download these past papers to gain a deep understanding of the exam structure, familiarize yourself with key topics, and practice with questions similar to ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
DBT-JRF Biotechnology Eligibility Test (BET) Syllabus
General Comments: Question paper will have two parts, Part-A (General aptitude & General Biotechnology) and Part-B (General plus specialized branches in Biotechnology). Part-A will have all compulsory 50 MCQ questions in General science, Mathematics, Chemistry, General aptitude, analytical, quantitative ability, general biotechnology etc. There will be 150 questions in Part B, out of which only ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Decanter centrifuge - Principle, Types, Parts, Uses
Decanter centrifuge is an industrial machine which is used to separate solid materials from liquids present in a slurry. It is also known as horizontal bowl centrifuge, solid bowl centrifuge, or scroll centrifuge. It works by spinning at very high speed. In this process, a strong centrifugal force is produced which increases the natural gravitational ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Decarboxylase Broth Protocol
Moeller introduced the decarboxylase media to detect the ability of bacteria to decarboxylate amino acid. They were used for the first time to detect lysine, ornithine, and arginine decarboxylases among Enterobacteriaceae bacteria.
Decarboxylase Test - Principle, Procedure, Results, Uses
Decarboxylase Test Medium base is used to distinguish bacteria based on their ability to decarboxylate amino acids.
Decomposers - Definition, Mechanisms, Types, Example
What are Decomposers? Definition of Decomposers Decomposers are organisms that break down dead or decaying organic matter into simpler substances, facilitating nutrient recycling in ecosystems. Common examples include fungi and bacteria. Types of decomposers Decomposers play a pivotal role in the biogeochemical cycling of nutrients within ecosystems. These organisms specialize in breaking down dead organic ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Decomposition - Definition, Types, Process, Advantages
What is Decomposition? Definition of Decomposition Decomposition is the process by which organic matter breaks down into simpler substances, typically by the action of microorganisms like bacteria and fungi, releasing nutrients, carbon dioxide, and water back into the environment. Types of Decomposition Decomposition happens in two main types: abiotic and biotic. Each plays a distinct role in breaking ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Deforestation - Definition, Causes, Effects, Control
What is Deforestation? Definition of Deforestation Deforestation is the large-scale removal of trees from forests or natural landscapes, often to repurpose the land for agriculture, urban development, or industrial use, leading to habitat loss, decreased biodiversity, and increased carbon emissions. Importance of Forests Forests are essential to the health of the planet, playing a critical ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Degradation of Hydrocarbons (oil spills)
Types of Hydrocarbon Crude petroleum HCs can be categorised as alkanes, cycloalkanes, aromatics, polycyclic aromatics, asphaltines, and resins. Alkanes Cycloalkanes Aromatic HCs Polycyclic aromatic HC Asphaltines and resins Effects of Hydrocarbon The ecological and/or economic effects of direct or indirect exposure of live creatures to hydrocarbon molecules can vary. Principles of Bioremediation Oil Spill Cleaning ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Degradation of Pesticides - Types, Mechanisms
What are Pesticides? any substance or mixture of substances intended for preventing, destroying, or controlling any pest, including vectors of human or animal disease, unwanted species of plants or animals, causing harm during or otherwise interfering with the production, processing, storage, transport, or marketing of food, agricultural commodities, wood and wood products or animal feedstuffs; ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Deletion Mutation - Definition, Causes, Mechanism, Examples
What is Deletion Mutation? Definition of Deletion Mutation A deletion mutation is a genetic anomaly in which a segment of a chromosome or DNA sequence is omitted during DNA replication, leading to the absence of specific nucleotides or entire chromosomal segments. This can result in altered gene function or expression. Causes of Deletion Mutation Deletion ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Dendrites - Definition, Structure, Types, Functions
What are Dendrites? Definition of Dendrites Dendrites are branched extensions of neurons that receive and process incoming signals from other neurons, facilitating communication within the nervous system. They transmit electrical impulses toward the cell body and play a crucial role in integrating synaptic inputs to generate action potentials. Characteristics features of Dendrites The following characteristics ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Dendritic cell - Definition, Location, Structure, Types, Functions
What is Dendritic cell? Location of Dendritic cell DCs in lymphoid organs Lymph nodes Spleen Thymus Blood Skin Gut Structure of Dendritic cells Dendritic cell maturation Mechanism of Dendritic Cells in Immunity – How Dendritic cells work against pathogens? (Immunity) Dendritic Cell Function in Innate Immune System Dendritic Cells Function in Innate Immunity to Adaptive ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Dendrochronology - Definition, History, Methods, Applications
What is Dendrochronology? Definition of Dendrochronology Dendrochronology is the scientific study of tree rings, used to date events and environmental changes by analyzing the growth patterns of trees. Each ring represents a year of growth, and variations in width and density can provide insights into past climatic conditions, ecological changes, and historical events. History of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Dengue and Dengue Virus - Overview
Through the bite of an infected Aedes species mosquito (Ae. aegypti or Ae. albopictus), dengue viruses are transmitted to people. These mosquitoes can transmit other viruses including Zika and chikungunya. 4 billion people, or close to half of the world’s population, reside in dengue-risk zones. In risky locations, dengue is frequently the main cause of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Denitrification - Definition, Process, Factors
What is Denitrification? The nitrogen cycle concludes with denitrification. The nitrogen cycle consists of living organisms fixing atmospheric nitrogen and then releasing it back into the atmosphere. Denitrification is the process of releasing nitrogen from living organisms into the atmosphere. Denitrification Process Denitrification is the last step in the nitrogen cycle. It is a naturally ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Density Gradient Centrifugation - Principle, Protocol, Uses
Density gradient centrifugation is a mechanical separation technique used to separate and concentrate particles present in a liquid medium. It is carried out by using centrifugal force and a density gradient medium in a centrifuge tube. In this method, the sample is placed in a tube containing fluid whose density gradually increases from top to ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Deoxycholate Citrate Agar (DCA) - Composition, Principle, Preparation, Results, Uses
Deoxycholate Citrate Agar is an alteration of Leifson formula that is suggested for the identification of Salmonella as well as Shigella spp. It is comparable to deoxycholate agar however it is slightly more selective for enteric pathogens due to higher levels of both deoxycholate and citrate salts. The sodium deoxycholate pH range of 7.3 to 7.5 inhibits gram-positive bacteria. Citrate salts in the amount contained into the composition, act as inhibitors to gram-positive bacteria, as well as other intestinal organisms that are normal. This makes it an effective and selective media, commonly used to isolate intestinal pathogens.
Desert Ecosystem - Definition, Types, Importance
A Desert Ecosystem is a system in which living things (plants, animals, microbes) interact with non-living parts (soil, air, water, temperature) in a region that is extremely dry. It is defined by very low rainfall (often less than about 250 mm per year), and scarcity of moisture is a crucial limiting factor. The system is ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Detect the presence of specific antibody and quantitate the amount of antibody in patient’s serum
Such is the case with the slide and tube Widal test. The agglutinins against the ‘0’ (somatic) and ‘H’ (flagellar) antigens of Salmonella typhi, paratyphi A, and paratyphi B are measured qualitatively (slide test) and quantitatively (Tube test) using a suspension of suitable organisms that have been killed. Widal-quantitative tube agglutination test This test aids ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Determination of Magnesium In Milk - Principle, Procedure, Result
Determination of magnesium in milk is an analytical test in which total magnesium present in milk is released from milk matrix and then it is quantified by suitable method. Magnesium is an important macro mineral in milk and it is present around 90–150 mg/kg. It has structural role in stabilizing casein micelle and maintaining colloidal ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Determination of Phosphorus In Milk - Principle, Procedure, Result
Determination of phosphorus in milk is a biochemical test in which the total phosphorus present in milk is converted into inorganic orthophosphate and then it is measured by colour reaction. It is the process in which different form of phosphorus present in milk matrix are first released from organic matter and then it is estimated ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Detritus Food Chain - Definition, Energy Flow, Examples
What is Detritus Food Chain? Characteristics of Detritus Food Chain The detritus food chain exhibits several distinct characteristics that set it apart from other food chains. Here are some key characteristics of the detritus food chain: These characteristics collectively highlight the unique features and ecological significance of the detritus food chain. By capitalizing on detritus ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Deuteromycetes - Reproduction, Characteristics, Classification and Examples
Key Points on Deuteromycetes Here are the key points summarizing the characteristics and significance of Deuteromycetes: What are Deuteromycetes? Characteristic Features of Deuteromycetes Classification of Deuteromycetes The Deuteromycetes, commonly known as the ‘imperfect fungi,’ are categorized into four distinct form orders based on various characteristics. Each form order represents a unique mode of reproduction and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Development Stages of frog - Pre-embryonic, embryonic and post-embryonic development
The development of frogs follows a typical sequence of events observed in sexually reproducing organisms. It begins with the fertilization of an egg or zygote. The zygote then undergoes a series of divisions, dividing and re-dividing to form an embryo. The embryo is the earliest stage of development and remains within the egg or reproductive ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Developmental Biology Introduction, Hisotry and Basic concepts
What is Developmental Biology? Developmental biology is a scientific discipline that focuses on understanding how organisms grow, develop, and mature from a fertilized egg into a complex multicellular organism. It explores the processes, mechanisms, and patterns that shape the formation of tissues, organs, and the overall body plan throughout an organism’s life cycle. Developmental biologists ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Diagnostic Techniques of Viruses - Molecular and Immunological Techniques
The most common cause for human disease is viral infections. Millions are still dying from viral infections, including hepatitis and human immunodeficiency viruses (HIV).
Diaphragm of a Microscope - Definition, Types, Mechanism, Functions
Diaphragm of a microscope is a thin opaque disc like part having a circular opening (aperture) which can be adjusted. It is fitted in the light path of microscope, mostly below the stage and near the condenser. It controls the passage of light that will go to the specimen. The main work of diaphragm is ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Diatoms - Definition, Structure, Life Cycle, Importance
What is Diatom? Definition of Diatom A diatom is a tiny, single-celled algae with a hard shell made of silica, found in oceans, waterways, and soil. They play a crucial role in oxygen production, nutrient cycling, and the food web of aquatic ecosystems. Scientific classification of Diatom Domain: Eukaryota Clade: Diaphoretickes Clade: SAR Clade: Stramenopiles ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Diatoms Under the Microscope
What are Diatoms? Classification of Diatoms Diatoms, those mesmerizing aquatic organisms with their glass-like structures, hold a unique place in the world of classification. As members of the protist kingdom, they are eukaryotic organisms that do not fit squarely into the categories of plants, animals, or fungi. Instead, diatoms find their formal classification under the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Diauxic Growth Curve - Definition, Occurrence
What is Diauxic growth? When a bacterium is incubated in a medium containing two sugars one monosaccharide and another di or polysaccharide (like glucose and lactose). The bacteria first utilize glucose and complete their lag and log phase. After completion of glucose utilization, they used lactose and produce and another lag phase due to the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Dicot and Monocot stem - Characteristics, Structure, Functions, Examples
What is Monocot Stem? Characteristics Features of Monocot Stem Monocot stems possess unique characteristics that distinguish them from other plant types. These features play a crucial role in their growth, development, and overall functionality. The following points outline the defining characteristics of monocot stems: What is dicot Stem? Characteristics Features of dicot Stem Dicot stems ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Difference Between Active Transport and Passive Transport - Active vs Passive Transport
Passive and active transport are two different methods to move molecules across cells' membranes. The cell membrane is multi-tasking device that provides structure to the cell , while protecting the contents of the cytosol from the outside environment.
Difference between Aerobic and Anaerobic Respiration - Aerobic vs Anaerobic Respiration
Aerobic respiration refers to a series of metabolic reactions that occur in the presence oxygen in a cell. It is used to convert chemical energy into ATPs.
Difference Between Analytical Balance and Triple Beam Balance
What is Analytical balance? What is Triple beam balance? Difference Between Analytical Balance Vs Triple Beam Balance 1. Precision – Analytical balance gives very high precision (up to 0.0001 g) while triple beam balance only measure till 0.01 g, so less sensitive comparatively. 2. Power Source – Analytical balance mostly works on electric / electronic ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Difference Between Asexual and Sexual Reproduction
Asexual reproduction is the process of reproduction that does not involve gamestasy, and does not require the exchange of genetic information which results in offspring that are identical to their parents.
Difference between Biochemical Oxygen Demand (BOD) and Chemical Oxygen Demand (COD)
What is BOD? What is COD? Difference between Biochemical Oxygen Demand (BOD) and Chemical Oxygen Demand (COD) – BOD vs COD Similarities Between BOD and COD Difference between Biochemical Oxygen Demand (BOD) and Chemical Oxygen Demand (COD) pdf Download References
Difference between Biomagnification and Bioaccumulation
Biomagnification Bioaccumulation Difference between Biomagnification and Bioaccumulation
Difference Between Biotic and Abiotic Factors - Biotic vs Abiotic Factors
The biotic factor , also known as the component of the biotic refers to the living thing that creates the ecosystem.
Difference Between Bone and Cartilage - Bone vs Cartilage
A bone is a connective tissue in which living cells, tissues and other components are contained within hard, non-living intercellular material.
Difference Between Breathing and Respiration - Breathing vs Respiration
Breathing is also known as 'external respiration' because it is an external procedure of bringing oxygen into the body and exchanging carbon dioxide through the respiratory organs. The breathing process in all vertebrates is comprised of a high-yielding tubes which connect the nose with the alveoli. Breathing is a continuous cycle in which the amount of respiratory cycles in a minute is referred to as breathing or the rate of breathing. Under normal circumstances the speed and the depth of breathing is controlled by various homeostasis processes to regulate the partial pressure of carbon dioxide levels in the blood.
Difference Between Cation and Anion - Cation vs Anion
An anion can be described as an atom, or an atom group bearing either negative or positive electrical charges.
Difference Between cDNA and Genomic DNA - cDNA vs genomic DNA
The DNA library is composed of DNA fragments that were transformed into vectors that can recognize and identify specific DNA fragments. There are two kinds of libraries: cDNA or genomic libraries. The genomic DNA libraries contain huge DNA fragments. On the other hand cDNA libraries are made up of reverse-transcribed, cloned mRNA. In the end, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Difference between celsius and fahrenheit - Celsius Vs Fahrenheit Scale
Celsius scale, also known as the centigrade scale is a temperature scale that is based upon the point at which water freezes at 0degC, and the point at which water boils at 100degC.
Difference Between Chromosome and Chromatid - Chromosome vs Chromatid
A Chromosome is a thread-like form found in the nucleus or nuclear region of cytoplasm. It's made of one DNA molecule (Deoxyribonucleic acid) and proteins, which carry certain or all of the genetic materials in an organism.
Difference Between Cilia and Flagella
Cilia and Flagella are tiny structures attached to eukaryotic and prokaryotic cells. They protrude from the surface of their cells. These structures help in the locomotion of unicellular organisms. Accordingly, they mainly contain proteins called microtubules or basal bodies. In the case of single-celled eukaryotic organisms, both cilia and flagella are vital for locomotion.
Difference between Cilia and Microvilli
What is Cilia? What is Microvill? Difference between Cilia and Microvilli Cilia Microvilli Epithelial cells generate cilia, which are elongated, hair-like structures. Microvilli are epithelial cell-derived membrane protuberances. Cilia develop from basal granules. Basal granules are lacking in microvilli. Cylindrical cilia with tapered ends. Microvilli are cylindrical and terminate in blunt tips. Microvilli are shorter ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Difference Between Cladogram and Phylogenetic tree
What is Cladogram tree? What is Phylogenetic tree? Cladogram vs Phylogenetic tree Cladogram Phylogenetic Tree Represents evolutionary relationships based on shared derived traits (synapomorphies) Represents evolutionary relationships among organisms or groups of organisms Focuses on identifying and grouping organisms based on shared characteristics Represents the pattern of descent and the evolutionary history of species or ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Difference Between Classical, Alternative and Lectin Pathway
What is a Classical Pathway? What is an Alternative Pathway? What is a Lectin Pathway? Similarities Between Classical Alternative and Lectin Pathway The complement components in different activation pathways Activation pathway The C component designations The activated C component designation C regulators The triggering/ initiator C component Classical C1q, C1r, C1s, C2, C3, C4, C5, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Difference Between Coarse and Fine Adjustment
In the realm of technological devices and gadgets, customization to cater to user preferences is a ubiquitous feature. While most devices boast a single adjustment knob for each controlled element, there are instances where a more nuanced approach is taken, featuring two distinct knobs: coarse and fine adjustments. These two modes of adjustment offer users ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Difference Between Communicable and non -communicable diseases
Also known as transmissible diseases, or infectious diseases, communicable diseases can also be called transmissible diseases. The infectious agent is transmitted to others by contact with bodily fluids, bodily fluids, bites of insects, and air. Infectious diseases can spread either directly or indirectly. Direct transmission means that the infectious agent is transmitted through close physical contact. In indirect transmission, it is spread through air, water or other vectors.
Difference Between Compound Microscope and Simple Microscope.
Comparison between Compound Microscope and Simple Microscope.
Difference Between Diploid and Haploid - Diploid vs Haploid
In all organisms, somatic cells are diploloid, and sexual cells are typically haploid. The cells that are diploid have two homologous copies of two chromosomes inherited through two parental. The majority of mammals are diploid, with the exception of some rats. But, studies that have disproved that there is polyploidy among mammals have been conducted. Polyploidy is a condition where cells possess chromosomes which are more than diploid number of chromosomes. The majority of organisms that reproduce through mitosis have 2n DNA chromosomes, forming diploid cells.
Difference Between endocytosis and exocytosis (endocytosis vs exocytosis)
Endocytosis is a cellular process by which cells internalize substances from their external environment.
Exocytosis is a type of process, in which involves the movement of materials from the inside of a cell to the exterior of the cell by the use of energy.
Difference between enzymes and hormones - enzymes vs hormones
Enzymes (or enzymes) are proteins that act like biological catalysts (biocatalysts). Catalysts speed up chemical reactions. Substrates are molecules on which enzymes can act. The enzyme then converts these substrates into other molecules called products. Enzyme catalysis is required for almost all metabolic processes within the cell to occur at sufficient rates to sustain life. 8.1 Metabolic pathways are dependent on enzymes to catalyze individual processes. Enzymology is the study of enzymes. The pseudoenzyme analysis field recognizes that some enzymes lost their ability to catalyze biological reactions during evolution. This is often evident in their amino acid sequences or unusual 'pseudocatalytical' properties.
Difference between Epithelial tissue and Connective tissue - Epithelial tissue vs Connective tissue
Epithelial tissue is a kind of animal tissuethat is composed of polyhedral cells that are tightly aggregated joined tightly to each other as cellular layers that define the inside of hollow organs as well as protect the body's the body's surface.
Difference Between Eukaryotic and Prokaryotic DNA replication
Prokaryotic DNA Replication Eukaryotic DNA Replication Initiation Elongation Termination Similarities Between Prokaryotic and Eukaryotic DNA Replication difference between prokaryotic and eukaryotic dna replication 1. Location 2. Stage of Cell Division 3. Initiation 4. Direction of Replication 5. Enzymes DNA replication in prokaryotes and eukaryotes utilises comparable enzymes, although DNA replication in eukaryotes is more intricate ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Difference between Exocrine and Endocrine Glands - Exocrine vs Endocrine Glands
Exocrine glands are those equipped with ducts which allow cells to secrete their product through these ducts, so that they are released onto the surfaces of the targeted organs or cells. The cells in the exocrine glands are connected to the epithelium covering them with small tubular ducts that transport the secretions to the target locations. Exocrine glands' secretions are not mixed into the bloodstream, as some of these substances could even cause harm in the blood if they are released.
Difference between exotoxins and endotoxins - exotoxins vs endotoxins
Exotoxin is a toxins produced by bacteria. Exotoxins can cause damage to the host by damaging cells or disrupting normal cell metabolism. They are extremely powerful and could cause significant harm on the human host. Exotoxins can be released, or, as with endotoxins, they can be released when cells. Gram negative pathogens can release outer membrane vesicles with lipopolysaccharide endotoxin, as well as some viral proteins within the bounding membrane as well as other toxins in the intra-vesicular content and thus add an unimagined dimension to the widely-known membrane vesicle transport, which is extremely active in the interface between host and pathogen.
Difference Between Gene and Allele - Definition and Examples
What is Gene? What is Allele? Differences Between Gene and Allele Understanding the concepts of genes and alleles is crucial in genetics. While both terms are fundamental to the study of heredity, they refer to different aspects of genetic information. Here, we explore the distinctions between genes and alleles, outlining their roles and characteristics in ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Difference between genomic and cdna library
There are two types of DNA libraries that are constructed by genetic engineers using scientific methods. These can be classified as cDNA libraries as well as Genomic libraries. The major distinction in cDNA as well as Genomic library is the fact that cDNA library is a repository for the complementary DNA cloned from the all ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Difference between Gram Positive and Gram Negative Bacteria - Gram Negative vs. Gram Positive Bacteria
"Gram-positive" and "gram negative" are two terms used to classify two distinct kinds of bacteria. The distinction is in the form cells' walls and the way they react with Gram staining.
Difference Between Habitat and Niche - Habitat vs Niche
Habitats are natural ecosystem in which an organism is found and makes use of the resources in the area to survive, for shelter and food sources, and mating.
Difference between Heterochromatin and Euchromatin - Heterochromatin vs Euchromatin
Heterochromatin is a densely packed or condensed DNA which is distinguished by the intense staining when stained by nuclear stains. They also contain transcripts that are inactive.
Difference Between Heterosis and Inbreeding Depression
What is Heterosis? Heterosis, commonly known as hybrid vigor, refers to the phenomenon where the offspring of two genetically different parents exhibit greater vigor, growth, yield, or other desirable traits than either of the parent strains. This increased performance in hybrids is a key concept in plant breeding and agriculture. Here’s a closer look at ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Difference Between Homologous Chromosomes and Sister Chromatids
What are Homologous Chromosomes? Homologous chromosomes are fundamental components of the genetic architecture in diploid organisms, including humans. These chromosomes are pairs that have the same structure and genes, though they may carry different alleles, or variations, of those genes. Understanding homologous chromosomes is crucial for grasping the mechanisms of heredity and genetic variation. What ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Difference between hot air oven and autoclave
Through technological advances, The methods for sterilization have changed throughout the decades. There are now many different methods of sterilization employed in laboratories. However, autoclaving using steam is the most popular method for sterilization in the majority of labs. Although autoclaving is a clean rapid, reliable, and cost-effective method of sterilization, without any environmental risks and risks, it is still utilized most often in hospitals. However, there are three commonly employed methods of sterilization that are used: the steam autoclave unsaturated chemical-vapor sterilizer as well as the dry heat sterilizer. This article will only focus on steam autoclaves and dry heat sterilization techniques.
Difference Between Hypertonic vs Hypotonic
Osmosis refers to the movement of water molecules through semi-permeable membranes from high to low water potential. This semi-permeable membrane does not allow for solute particles to pass through it, but solvent particles (water molecules), can move across it. Tonicity can be described as the degree of the osmotic pressure gradient. There are three states. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Difference Between Incomplete Dominance and Codominance
Incomplete dominance is one of the mechanisms for dominance among heterozygotes in which the dominant allele does not fully overpower the phenotypic expressions of the recessive one, and there is an intermediate phenotype within the heterozygote.
Difference Between Independent and Dependent variables
An Independent Variable is kind of variable that is used in experiments, studies, statistical modeling and mathematical modeling that isn't dependent on any other variables that are part of the research.
Difference Between Inhalation and Exhalation - Inhalation vs Exhalation
Inhalation, also known as Inspiration, is a type of breathing that involves the inhalation of air. It is when the air is drawn into the lungs through the contraction of the diaphragm and respiratory muscles.
Difference between Lenticels and Hydathodes
What are Lenticels? What are Hydathodes? Difference between Lenticels and Hydathodes Lenticels and hydathodes are both specialized structures in plants, yet they serve distinct functions and are located in different regions. Understanding their differences is essential for comprehending how plants regulate gas exchange and water balance. Below is a detailed comparison of these two structures: ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Difference Between Linkage and Crossing Over
What is Linkage? What is Crossing Over? Difference Between Linkage and Crossing Over Here is a detailed comparison of these two genetic phenomena: Aspect Linkage Crossing Over Definition Tendency of genes close on the same chromosome to be inherited together during meiosis. Exchange of genetic material between non-sister chromatids of homologous chromosomes. Relationship of Related ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Difference Between Lytic and Lysogenic Cycle
What is Lytic Cycle? The lytic cycle is a fundamental process in the life cycle of certain viruses, particularly bacteriophages, which are viruses that infect bacteria. This cycle is characterized by the following sequential events: The term “lytic” is derived from “lysis,” referring to the rupture and death of the host cell. This cycle contrasts ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Difference between MHC Class I and MHC Class II - MHC Class I vs MHC Class II
The Major Histocompatibility Complex (MHC) is an extremely connected group of genes throughout all mammal species. The MHC is also known by HLA complex. HLA complex of humans as well as the H-2 complex in mice.
Difference between Monocarpic and Polycarpic Plants
What are Monocarpic Plants? Examples of Monocarpic Plants Here are some notable examples of monocarpic plants: What are Polycarpic Plants? Examples of Polycarpic Plants Here are some examples of polycarpic plants: Difference Between Monocarpic and Polycarpic Plants Examples: Additional Differences: Difference Chart Between Monocarpic and Polycarpic Plants Characteristic Monocarpic Plants Polycarpic Plants Flowering Produce flowers ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Difference between Monocot and Dicot Leaves - Monocot vs. Dicot Leaves
What is Monocot Leaf? What is Dicot Leaf? Difference between Monocot and Dicot Leaves – Monocot vs. Dicot Leaves The differences between monocot and dicot leaves are fundamental in understanding plant biology, as these two groups exhibit distinct structural and functional characteristics. Both types of leaves are essential for plant life but serve varying purposes ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Difference Between Multicellular and Unicellular Organisms
What are unicellular organisms? Examples of Unicellular Organisms Unicellular organisms are remarkable entities that carry out all life processes within a single cell. These organisms can be found in various environments, from freshwater to marine habitats, and even in extreme conditions. Their simplicity, in terms of cellular structure, is contrasted by the diverse roles they ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Difference between Natural and artificial selection - Natural vs artificial selection
Natural selection is the process that allows an organism to adapt to changing environmental conditions through the introduction of changes in the genotype of its genetic material.
Difference Between Northern, Southern and Western Blotting
What is Northern Blotting? Northern blotting is a laboratory technique used to study gene expression patterns by detecting and analyzing RNA molecules. It is named after its similarity to the Southern blotting technique, which is used for DNA analysis. The Northern blotting method allows researchers to determine the presence, size, and abundance of specific RNA ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Difference between O antigen and H antigen - O vs H antigen
O antigen and H antigen are different in that O is the bacteria's outermost layer, while H is the flagella's threadlike structure.
Difference between One-step RT-qPCR and Two-step RT-qPCR
In One-step RT-qPCR or One-step real time Polymerase chain reaction (PCR) the reverse transcriptase and DNA polymerase are premixed into a single tube.
Difference Between Oviparous and Viviparous - Oviparous vs Viviparous
An Oviparous animal is a creature that produces eggs which later develop into young ones, after being pushed out from the body of the female.
Difference between Photosystem 1 (PS1) and Photosystem 2 (PS2)
What is Photosystem 1 (PS1)? What is Photosystem 2 (PS2)? Difference between Photosystem 1 (PS1) and Photosystem 2 (PS2) Feature Photosystem I (PSI) Photosystem II (PSII) Location in Thylakoid Membrane Outer surface Inner surface Photocenter P700 P680 Absorbing Wavelength >680 nm <680 nm Photophosphorylation Both cyclic and non-cyclic Only non-cyclic Photolysis of Water No Yes ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Difference between Phytoplankton and Zooplankton - Phytoplankton vs Zooplankton
Phytoplankton, a group free-floating microalgae, is an important component of freshwater, ocean and sea ecosystems.
Difference Between Pinocytosis and Receptor Mediated Endocytosis
Pinocytosis refers to the ingestion of liquid into a cell by the budding of small vesicles from the cell membrane.
Difference Between Pollination and Fertilization - Pollination vs Fertilization
Pollination is the transmission of gametes from males (pollen grains) in plants from the male reproductive part (anther) to the female reproductive part (stigma).
Difference Between Primary and Secondary Metabolites
Primary metabolites are substances which are directly involved in the metabolic pathways of an organism , which are necessary to its development, growth and reproduction. They are a part of the physiological processes that occur within the organism. Primary metabolites are generated in the body during the growth phase due to the mechanism of growth. The phase of growth which is associated with the creation of primary metabolites is referred to as 'trophophase'..
Difference Between primary and secondary sewage treatment
What is primary sewage treatment? What is secondary sewage treatment? Difference between primary and secondary sewage treatment Primary Treatment Secondary Treatment Difference Chart between primary and secondary sewage treatment Aspect Primary Treatment Secondary Treatment Nature of Process Physical process involving removal of solid particles from sewage. Biological process involving the degradation of organic matter. Method ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Difference between Primary and Secondary Succession
Primary succession refers to a type or ecological succession that occurs in an environment that has just been formed, but does not have any habitable soil. However, living organisms are then colonized for their first time.
Difference Between Prokaryotic and Eukaryotic Cells - Prokaryotic Vs Eukaryotic Cells
What is Prokaryotic Cell? What is Eukaryotic Cell? Difference Between Prokaryotic and Eukaryotic Cells Feature Prokaryotic Eukaryotic Nucleus Absent; genetic material located in a nucleoid region. Present; genetic material enclosed within a nuclear envelope. Membrane-bound organelles Generally absent (e.g., mitochondria, chloroplasts, endoplasmic reticulum, Golgi apparatus). Present (e.g., mitochondria, chloroplasts in photosynthetic cells, endoplasmic reticulum, Golgi ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Difference Between Prokaryotic cell and Eukaryotic Cell - Prokaryotic cells vs Eukaryotic Cells
Unicellular organisms that don't possess membrane-bound organelles, such as nucleus and mitochondria are known as prokaryotic cells. They are classified into two groups based on the constituents of the cell wall Bacteria as well as Archaea.
Difference between Quantitative and Qualitative Data - Quantitative vs Qualitative Data
Qualitative data deals with descriptions. It can be observed , but is not able to be calculated. In contrast Qualitative data is one that is focused on mathematical calculations and numbers and can be calculated as well as calculated.
Difference Between RNA Primer and DNA Primer - RNA Primer vs DNA Primer
When it comes to DNA replication and amplification, primers play a crucial role. Primers are short nucleotide sequences that provide a starting point for DNA synthesis. However, not all primers are created equal. There are two main types: RNA primers and DNA primers. Understanding the difference between RNA primers and DNA primers is essential for ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Difference between Saturated and Unsaturated fatty acids
Saturated fats are the most basic type of fats. They are linear chains with no branches made of CH2 groups that are linked by single carbon bonds. They are joined by the terminal carboxylic acid.
Difference Between Simple Diffusion and Facilitated Diffusion - Simple diffusion vs facilitated diffusion
The major distinction between simple and facilited diffusion is that simple diffusion is not accompanied by the involvement of the channel or carrier proteins whereas the facilitated one takes place through channels or protein carrier proteins.
Difference between static quenching and dynamic quenching
What is Quenching ? Quenching relates to a process that reduces the fluorescence intensity of a supplied substance. A variety of methods can succeed in quenching, such as excited state reactions, energy transfer, complex-formation and collisional quenching. As an outcome, quenching is often profoundly dependent on pressure and temperature. Some examples of common chemical quenchers are ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Difference between Telomere and Telomerase
What is a Telomere? Telomeres are crucial components found at the ends of chromosomes. They are made up of repetitive nucleotide sequences that protect the genetic material from damage. Each time a cell divides, the telomeres shorten, playing a key role in cellular aging and health. Here’s a breakdown of what telomeres are, how they ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Difference between Vascular and Non-vascular plants - Vascular vs Non-vascular plants
Vascular plants, often referred to as tracheophytes, are the plants on the land with cells that are lignified to conduct minerals and water all over the body.
Difference Between Virus and Viroids - Virus Vs Viroids
Difference Between Virus and Viroids In this article we will discuss about Differences Between Viroids and Prions. Virus Viroid Difference Between Virus and Viroids – Virus Vs. Viroids Feature Virus Viroid Genetic Material DNA or RNA, single- or double-stranded, linear or segmented Small circular single-stranded RNA molecule Capsid/Coat Protein coat (capsid); some have additional lipid ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Difference Between Xylem and Phloem - Xylem vs Phloem
The Xylem is a blood vessel which transports water as well as dissolved minerals that are absorbed by root to remainder part of the plant.
Differences Between Absorption and Adsorption
In biology, absorption refers to the procedure of absorbing or assimilating substances within cells or across tissues through the process of diffusion or Osmosis.
Differences Between Actin and Myosin - Actin vs Myosin
Actin is one of the globular proteins. They're among the top proteins within the majority of eukaryotic cells. They assist in providing structure, shape and flexibility to the body.
Differences between Active Immunity and Passive Immunity
The immune system shields the body from a range of pathogens and the toxins. Innate immunity is the first line of defense against pathogens via physical and chemical barriers , such as mucus layers, skin and saliva. The second line of defense is also triggered by innate immunity via the phagocytes. This defense line is ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Differences Between Acute disease and Chronic Disease
The duration of time that is for acute diseases is dependent according to the nature of the disease and its context however it is more concise in comparison to chronic illnesses. The term "acute" can also be used to refer to conditions where the onset of symptoms is sudden and happens quickly. In the case of severe disease is usually fulminant when it's not always true for acute rhinitis. It is commonly associated with the common cold.
Differences Between Agglutination and Precipitation
Agglutination reactions help fragment test antigens, which are typically coupled to the carrier. The carrier could be made up of (such as charcoal or latex particles) or biological (such as red blood cells). The process of agglutination involving Red blood cells can be known as Hemagglutination. The process that involves the white blood cells can be referred to as leukoagglutination.
Differences Between Amphibians and Reptiles - Amphibians vs Reptiles
Amphibians belong to a class of vertebrates with cold blood that is adept at exploitation of terrestrial and aquatic habitats.
Differences between Angiosperm and Gymnosperm - Angiosperm vs Gymnosperm
Angiosperms are flowering plants which are the biggest and the most diverse group of plants within the kingdom of Plantae.
Differences between Anthrax bacilli and Anthracoid bacilli
Bacillus anthracis, a Gram-positive, rod-shaped bacterium, causes anthrax. This is a deadly disease that can infect livestock and humans. It is the only permanent (obligated) pathogen in the genus Bacillus. Because it can be transmitted from animals to people, its infection is called zoonosis. Robert Koch, a German physician, discovered it in 1876. It became the first pathogen to be experimentally demonstrated. It was also the first scientific proof for germ theory.
Differences Between Antigenic Shift and Antigenic Drift
The primary distinction between antigenic drift or antigenic change is the fact that antigenic drift is a way to create change in viruses that is caused by the accumulation of mutations in genes that encode for antigen-binding sites, whereas antigenic shift is a method of combining two kinds of viruses to create one new type that has an assortment of surface antigens of the viruses that were originally.
Differences between Arteries and Veins - Arteries vs Veins
d arterial blood vessels are the two kinds of blood vessels that are part of the closed circulatory system. The primary purpose that blood vessels serve is move circulation of blood around the entire body. However, veins and arteries differ in design and purpose.
Differences Between Autotroph and Heterotroph
An autotroph is a type of organisms that produce their own food through the use of diverse substances like sunlight, water and various other chemicals.
Differences between Autotroph and Heterotroph - Autotroph vs Heterotroph
An autotroph is one of the groups of organisms that can produce their own food using diverse substances like sunlight, water and various other chemical compounds.
Differences between B Cells and T Cells - B Cells vs T Cells
B cells and T cells are two kinds of lymphocytes involved in activating the immune system within the body. Both B and T cells are created within the bone marrow. T cells move into the thymus to develop. T cells as well as B cells play a role in the recognition of pathogens as well as other harmfulforeign substances within the body, such as parasites, viruses, bacteria and dead cells. Two types of T cells comprise called helper T cells and cytotoxic cells.
Differences Between Backcross and Pedigree Methods
What is Backcross Method? The backcross method is a genetic technique used in plant breeding and animal genetics to transfer a specific trait from one organism to another while maintaining the genetic background of the recurrent parent. This method involves several key steps and objectives: Key Concepts of the Backcross Method Advantages of the Backcross ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Differences Between Bacteria and Fungi - Bacteria vs Fungi
Bacteria are single-celled microscopic species that are distinguished in the absence of an incipient nucleus as well as a few organelles that have no membranes.
Differences between Binary fission and multiple fission
Both kinds of fission are the two types of Asexual reproduction, where the binary fission gives rise to two daughter cells that are derived from the parental cell while in multiple fission the parent cell is the one that gives birth to a number of daughter cells. Binary fission is one the most commonly used ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Differences Between Bones and Cartilage - Bones vs Cartilage
Bones and cartilage are two essential components of the skeletal system in vertebrates, providing structure, support, and protection to the body. While both bones and cartilage contribute to the framework of the body, they differ significantly in their composition, physical structure, cellular makeup, and functions. Understanding the differences between bones and cartilage is crucial for ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Differences between bulk and pedigree methods
What is bulk Method? The bulk method is a plant breeding technique used to develop new varieties by selecting plants with desirable traits through repeated cycles of selection and propagation. Here’s a brief overview of how it works: The bulk method is often used in the early stages of breeding programs to quickly evaluate and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Differences Between Cytokines and Chemokines
Chemokines as well as cytokines constitute two immune modulating agents that are involved in mediating and modulating of the immune system's responses. immune system. Different types of cytokine superfamilies are recognized: chemokines INFs, INFs, CSFs, TGFs and TNFs. They differ only by the function they perform within the body. Chemokines cause a gradient of concentration that directs other leukocytes to the location of the infection. The primary distinction between chemokines and cytokines is that cytokines are tiny proteins that are released by cells within the body that affect other cells. Chemokines are a part of the superfamily of cytokines and possess Chemotactic properties.
Differences between Diarrhea and Dysentery - Diarrhea vs Dysentery
The bathroom, experiencing the urge to bowel, peeing regardless of what you refer to it as stool is a normal element of your daily life. But, there are times when this process of eliminating waste from your body alters. If you experience fluid or loose stool, this is known as diarrhea. This is a fairly common occurrence that usually goes away without treatment.
Differences between DNA and RNA - DNA vs RNA
involved in transmitting the genetic code needed for protein synthesis. Certain viruses also use DNA as their material for genetics.
Differences between DNA Replication and Transcription
DNA replication, in molecular biology is the biological process by which two identical copies of a DNA molecule are created. As the main part of biological inheritance, DNA replication is an essential component in all living organisms. This is necessary for cell division, growth, and repair of damaged tissue. It also ensures that each new cell receives its own copy DNA. Because cells possess the unique property of division, replication of DNA is essential.
Differences Between Dominance and Overdominance Hypotheses
What is Dominance Hypotheses? The Dominance Hypothesis refers to a concept in plant breeding and genetics that deals with the expression of traits in offspring based on the dominance of alleles. It essentially posits that in a heterozygous state, one allele (the dominant allele) can mask the expression of another allele (the recessive allele). Here’s ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Differences Between Early and Late Wood - Spring Wood and Autumn Wood
What is Early and Late Wood? Early wood and late wood are fundamental components of tree growth, produced by the cambium layer in response to seasonal changes. These two types of wood are differentiated based on the time of year they are formed and their structural characteristics, playing crucial roles in a tree’s overall development. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Differences Between Genomics and Proteomics
Proteomics and Genomics are two major areas of molecular biology. Genomes are the biological material that makes up an organism. It contains genes that contain the information about genetics of organisms (genetic code). The research conducted to uncover the information contained in the genome is called genomics.
Differences between Humoral Immunity and Cell mediated Immunity
Cell-mediated immunity and immunological immunity are two kinds of adaptive immune responses which allow the human body to protect itself in a targeted manner against harmful substances such as viruses, bacteria and contaminants. While there is some overlap between the two parts of the immune response and both are based on the function of lymphoid cell function - there are some significant distinctions.
Differences Between Hyaline cartilage, Elastic, and Fibrocartilage
What is Hyaline cartilage? Characteristics of Hyaline cartilage The characteristics of hyaline cartilage make it well-suited for its various functions, including providing structural support, reducing friction between joint surfaces, facilitating smooth movement, and aiding in the growth and development of skeletal elements. What is Elastic cartilage? Elastic cartilage is a type of connective tissue that ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Differences between Invertebrates and Vertebrates
Vertebrates and Invertebrates are the two categories into which all the species of animals are classified. Animals are heterotrophic, multicellular organisms that are classified within the kingdom known as Animalia. The primary distinction between vertebrates and invertebrates lies in the fact that vertebrates comprise of a backbone while invertebrates don't have an internal backbone.
Differences between Meningitis and Encephalitis
Meningitis refers to inflammation of the meninges. Meninges refer to the three membranes covering the brain and spinal chord. When fluid around the meninges becomes contaminated, meningitis may occur.
Differences Between Microfilaments and Microtubules - Microfilaments vs. Microtubules
Both microtubules and microfilaments are components of a cell’s cytoskeleton. Microtubules, microfilaments, and intermediate filaments compose the cytoskeleton. Tubulin proteins are polymerized to produce microtubules. They provide the cell with mechanical support and help to intracellular transport. Polymerization of actin protein monomers produces microfilaments. They contribute to the mobility of the cell on the surface. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Differences Between Mitochondria and Chloroplast - Mitochondria vs Chloroplasts
Mitochondria originates of the Greek word meaning'mitos' thread and 'chondrios'-granule. Mitochondria are also referred to as the "powerhouse of cells' because their primary purpose is to generate energy through the process of ATP.
Differences between Mitosis and Meiosis - Mitosis vs Meiosis
In cell biology, the process of mitosis is a phase of the cell cycle , in which duplicated chromosomes are divided into two nuclei. Cell division creates cells that are genetically identical, in which the number of chromosomes are maintained. Thus, mitosis is called equational division. In general the case of mitosis, it begins with S stage of interphase (during the time that DNA replication occurs) and is usually followed by cytokinesis and telophase that divides the organelles, cytoplasm and cell membrane of a cell into two cells that contain roughly equal amounts of the cellular components. Different stages of mitosis together are the basis for what is known as the Mitotic (M) period of the animal cell cycle, which is the split of the cell's mother into daughter cells that are genetically identical to one another.
Differences Between Monocot and Dicot Flower - Monocot vs. Dicot Flower
What is Monocot Flower? What is Dicot Flower? Differences Between Monocot and Dicot Flower – Monocot vs. Dicot Flower Monocot and dicot flowers represent two major categories of flowering plants, with distinct characteristics that set them apart. These differences encompass their floral structures, pollen, and methods of pollination. Understanding these distinctions is crucial for identifying ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Differences Between Monocot and Dicot Roots - Monocot vs. Dicot Roots
What is Monocot Root? Monocot roots refer to the root systems found in monocotyledonous plants, commonly known as monocots. These plants typically exhibit a distinct root architecture that differentiates them from dicots (dicotyledonous plants). Here is a detailed examination of monocot roots: Structure of Monocot Roots: Functions of Monocot Roots: Examples of Monocot Roots: Common ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Differences Between Monocot and Dicot Seed - Monocot vs. Dicot Seed
What is Dicot Seed? Dicot seeds, belonging to the group known as dicotyledons, are characterized by the presence of two embryonic leaves, or cotyledons. This classification represents one of the primary divisions among flowering plants, or angiosperms, highlighting the diversity within plant biology. Dicot seeds are crucial for understanding plant development, morphology, and ecological roles. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Differences Between Monocot and Dicot Stem - Monocot vs. Dicot Stem
What is Dicot Stem? What is Monocot Stem? Differences Between Monocot and Dicot Stem – Monocot vs. Dicot Stem The following points outline the primary contrasts between monocot and dicot stems: Aspect Monocot Stem Dicot Stem Basic Structure Typically circular and hollow. Generally solid and cylindrical. Hypodermis Composition Composed of non-green sclerenchyma fibers. Made up ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Differences Between Monohybrid cross vs Dihybrid cross
Monohybrid cross Dihybrid cross Differences Between Monohybrid cross vs Dihybrid cross Characterisitcs Monohybrid Cross Dihybrid Cross Definition A genetic cross involving the study of one trait A genetic cross involving the study of two different traits Number of traits One trait Two traits Alleles involved Two alleles Four alleles Genotype combinations Three possible genotypes Nine ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Differences between Neisseria meningitidis and Neisseria gonorrhoeae
Neisseria meningitidis, also known as meningococcus is a Gram-negative bacterium which may cause meningitis or other forms of meningococcal infection like meningococcemia, which is life-threatening sepsis. The bacterium is described as a coccus due to the fact that it is round and, more specifically, is a diplococcus due to the tendency of it to create pairs.
Differences Between Nitrification and Denitrification
Nitrification is the biological process that involves the oxidation of ammonia to Nitrite, followed by the conversion of the nitrite to the nitrate.
Differences between Phenotype and Genotype - Phenotype vs Genotype
Phenotype is a term that is used in genetics to describe all traits that can be observed in living organisms that result of interactions of the genotype and the environment.
Differences between Plasmodium vivax and Plasmodium falciparum
Plasmodium viridax, a protozoal parasite, is a human pathogen. This parasite is the most common and widespread cause of recurring malaria. P. viridax malaria can cause severe illness and death. It is more virulent than Plasmodium falciparum (the most deadly of the five human malaria parasites), but it can be fatal. P. viritax is transmitted by the female Anopheles mosquito. The males don't bite.
Differences between Pneumococcus and Viridans streptococci
Viridans streptococci comprise a vast collection of Gram-positive commensal streptococcal bacteria that are hemolytic and produce a green hue on blood plates (hence the name "viridans", from Latin "viridis", green). The pseudo-taxonomic name "Streptococcus viridans" is often used to describe this species group, however, those who don't prefer using the term "pseudotaxonomic" (which refers to a group of species as though they comprised one species) prefer to use the terms viridans streptococci, viridans streptococci group (VGS) or the viridans species of streptococcal. They do not possess Lancefield antigens. In general, the risk of pathogenicity is very low.
Differences Between Poisonous and Non-poisonous Snakes
When differentiating between poisonous and non-poisonous snakes, several key physical characteristics and features can be observed. Understanding these differences is crucial for identifying and handling snakes safely. Poisonous Snakes Non-poisonous Snakes Differences Between Poisonous and Non-poisonous Snakes Characteristic Poisonous Snakes Non-poisonous Snakes Body Color Generally bright Not so bright Neck Constriction Present Absent Head Shape ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Differences Between Polyembryony and Apomixis
What is Polyembryony? What is Apomixis? Characteristics of Apomixis Characteristics of Polyembryony Differences Between and Apomixis Characteristics of Apomixis vs. Polyembryony Category Apomixis Polyembryony Offspring The offspring are genetically identical to the parent plant. This is because the embryos are produced asexually from the parent’s cells. The offspring can either be genetically identical or genetically ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Differences between Primary and Secondary Succession - Primary vs Secondary Succession
Primary succession can be described as a kind of eco-succession that occurs in an area that is new and has no suitable soil, and is first colonized with living creatures.
Differences between Prokaryotes and Eukaryotes
A single-celled organism without nucleus and other organelles with membranes. Prokaryotes are derived in the Greek pro (pro"pre" - meaning "before") and the word karuon (karyon, meaning 'nut' or "kernel"). In the two-empire model that resulted in the works of Edouard Chatton, prokaryotes were classified as part of the Empire of Prokaryota. However, in the three-domain system that is based on molecular analysis, prokaryotes are divided into two domains: Bacteria (formerly Eubacteria) and Archaea (formerly Archaebacteria). Organisms with nuclei are put in the third domain, Eukaryota. When studying the evolutionary origins of life prokaryotes are believed to have ascended before Eukaryotes.
Differences Between Pureline Selection and Mass Selection
What is Pureline Selection? Pureline selection is a plant breeding method used to develop new varieties from a single genotype or “pure line.” This approach is based on selecting and propagating individuals that consistently exhibit desirable traits, aiming to create a genetically uniform and stable line. Here’s how it typically works: Pureline selection is particularly ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Differences between RBC and WBC - RBC vs WBC
White blood cells are two of the components of the blood supply in mammals. RBCs (RBCs) are biconcave discs that are circular in shape with hemoglobin-containing pigments to carry oxygen throughout the animal's body. Oxygen is essential to the catabolism of cells within animals. A portion of carbon dioxide is transported through RBCs. They are created as a waste product in catabolism. They are also known as white blood cells. (WBCs) contain a range of types of cells like leukocytes neutrophils, and monocytes. They are able to differentiate into various defense mechanisms. The major distinction in red and white blood cells lies with their purpose that red blood cells transport oxygen around the human body, whereas white blood cells play a role with the protection of animals by destroying pathogens that attack the body's cells.
Differences Between Sapwood and Heartwood
What is Sapwood? Sapwood, also known as alburnum, is the outer, lighter-colored layer of wood found in a tree, situated between the bark and the heartwood. It is composed of living cells, including vessels and fibers, and plays a crucial role in the tree’s physiological processes. Here are some key characteristics and functions of sapwood: ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Differences Between Sensitivity, Specificity, False positive, False negative
In many domains, including medicine, statistics, and machine learning, it is vital to comprehend the complexities of diagnostic tests and their outcomes. There are four key principles that come into play when assessing a diagnostic test’s efficacy: sensitivity, specificity, false positives, and false negatives. Confusion and incorrect interpretation of test results can result from the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Differences between Serum and Plasma - Serum vs Plasma
Plasma and serum are two blood derivatives which do not have blood cells such as red blood cells white blood cells and platelets. Both are enriched with proteins, drugs hormones, toxins and electrolytes. Both plasma and serum can be used to treat and diagnose. They are separated from blood using centrifugation, which eliminates the blood's cellular component. Blood is infused with anticoagulants when it has been transfused to stop the clotting. The serum color is amber, while the plasma color is straw. The primary difference between serum as well as plasma lies in the fact that the latter is a protein-rich liquid that separates when blood is coagulated, whereas plasma forms the liquid part of blood that holds blood cells suspended.
Differences between Staphylococcus and Streptococcus
Staphylococcus is an genus of Gram-positive bacteriophages within the family of Staphylococcaceae of the family of Bacillales. Under microscope they appear to be as spherical (cocci) and are found clusters that resemble grapes. Staphylococcus species are anaerobic, facultative organisms (capable of growth anaerobically and aerobically).
Differences Between Taenia Solium and Fasciola Hepatica
Taenia Solium Characteristics of Taenia Solium Taenia solium, also known as the pork tapeworm, is a parasitic flatworm that infects humans and pigs. Here are some of its characteristics: Life history of Taenia solium Fasciola Hepatica Characteristics of Fasciola Hepatica Fasciola hepatica is a parasitic flatworm that infects the liver and bile ducts of various ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Differences between Transcription and Translation - Transcription vs Translation
Transcription is the process by which the genetic information stored on DNA strands is transferred into an RNA-RNA strand via the polymerization process caused by enzymes known as DNA-dependent polymerases.
Differences Between Transduction and Transfection - Transduction vs Transfection
What is Transduction? Steps of Transduction The process of transduction involves several steps, which can be summarized as follows: The overall outcome of transduction is the transfer of genetic material, including specific genes or genetic elements, between bacteria. This process facilitates the spread of genetic diversity, including the transfer of antibiotic resistance genes or virulence ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Differences Between Type I Error and Type II Error
Type 1 error in tests of statistical hypotheses, refers to the mistake that is caused by refusing to accept a null hypothesis even though it's true. Type 1 errors occur when a hypothesis that ought to be accepted was rejected. Type I errors are identified by an (alpha) also known as an error. It is also known as the significance level that the tests. This type of error can be described as a false negative error in which it is impossible to prove the hypothesis due to an error in the test.
Differences Between Viroids and Prions - Viroids Vs Prions
What is Viroid? Viroids represent the smallest known infectious agents affecting plants, characterized by a short (246–467 nt), circular, single-stranded RNA molecule. These entities are characterized by the absence of a protein coat or lipid envelope, categorizing them as “naked” RNA agents, which sets them apart from viruses. The RNA exhibits a robust, base-paired, rod-like ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Differences between Voluntary and Involuntary Muscles - Voluntary vs Involuntary Muscles
Voluntary muscles are muscles that are movable by at the discretion of a person . They are usually connected to the skeleton system.
Differences between Voluntary muscles and Involuntary muscles - Voluntary vs Involuntary Muscles
Voluntary muscles are those that are movable by your own freewill of a person . They are usually connected to the skeleton system.
Differences between Yeasts and Molds - Yeasts vs Molds
Mold and yeast are two types of fungi that grow. They are multicellular or unicellular microorganisms of the eukaryotic family. They are saprophytes that live externally decomposing organic material and absorbing nutrients via their cell walls.
Different Aseptic Techniques in Microbiology Laboratory
Because the aim of biologists is to cultivate microorganisms or eukaryotic cells with no introduction of any extraneous organisms aseptic methods are essential for ensuring that experiments are conducted with precision and accuracy. Always keep in mind that a totally safe working environment for scientists does not exist.
Different Between DNA-A form, DNA-B form, DNA-Z form
Different forms of DNA exist because the molecule can shift its structure when the surrounding conditions is changed. It is the property of DNA to show polymorphism, and this is the reason why B-DNA is not the only form present in cells. It is observed that the B-form is the common right-handed helix under normal ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Different Buffer preparation for Gel Electrophoresis
Acrylamide Stock Solution Preparation Application: Acrylamide is used along with bisacrylamide to form gels used in SDS-PAGE. Acrylamide forms polyacrylamide polymers, while bisacrylamide crosslinks between polyacrylamide chains. To prepare 1L of Acrylamide Stock Solution the following components are required; Component Amount Concentration acrylamide (mw: 71.08 g/mol) 389.6 g 5.481 M bisacrylamide (mw: 154.17 g/mol) 10.4 ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Different classes of Antibodies and Their Properties and Function
What are Antibodies? Antibodies, also known as immunoglobulins (Ig), are Y-shaped proteins produced by specialized white blood cells called B lymphocytes (B cells) in response to the presence of foreign substances known as antigens. Antibodies are an essential component of the immune system and play a crucial role in recognizing, binding to, and neutralizing antigens. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Different Laboratory Instruments for Measuring Volumes
For the creation of solutions and manipulation of liquids, numerous vessels and apparatuses are employed in the laboratory. They differ in their intended application and precision. Volumes must always be measured at a constant temperature because changes in temperature result in volume changes owing to thermal expansion. At 10 °C, water has a substantially smaller ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Different model of Replication - Theta, rolling circle, and linear DNA replication
DNA replication is the process by which genetic material is copied before cell division happens, it’s considered essential for inheritance. Among different models, the main ones observed are Theta model, Rolling Circle model, and Linear DNA replication. Each model are used by different organisms or DNA types (like plasmids, viruses, or eukaryotic chromosomes). The three ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Different Plasma Membrane Models
Plasma Membrane Functions of Plasma Membrane Models of Plasma Membrane Following are descriptions of the top four historical Plasma Membrane models. The examples are: 1. Lipid and Lipid Bilayer Model 2. Unit Membrane Model (Protein-Lipid Bilayer-Protein) 3. Fluid Mosaic Model Modifications of Fluid Mosaic Model 1. Microvilli 2. Intercellular Spaces 3. Interdigitations 4. Desmosomes and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Different Programming Language for Bioinformatics
What is Programming Language? A programming language is a formal language that is used to write computer-executable instructions or code. It is a set of rules and syntax that enables programmers to communicate with computers and assign them specific instructions or tasks. Programming languages enable the creation of algorithms and software applications. They offer a ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Different Types of Birds
Birds are among some of the top vertebrate creatures on Earth. There are over 9000 species of birds, and they're scattered across all of the planet from the poles all the way to the equator.
Different Types of Immunological Techniques With Examples
Immunological techniques is the set of laboratory methods that is based on the specific antigen–antibody reaction, and it is used to detect, identify or measure different biological substances in a sample. It is the process where an antibody binds with its corresponding antigen and this binding is used for locating proteins, hormones, pathogens or other ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Differential Centrifugation - Principle, Protocol, Uses
Differential centrifugation is a simple technique used for separation of cell organelles and other sub-cellular particles from a mixture. It is also called differential pelleting or differential velocity centrifugation. It separates the particles mainly according to their size and density. The larger and heavier particles settle first, while smaller particles remain in the liquid part. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Diffusion - Definition, Causes, Significance, Examples
What is Diffusion? Definition of Diffusion Diffusion is the process by which molecules move from an area of higher concentration to an area of lower concentration, driven by random molecular motion, until equilibrium is reached. Types of Diffusion Diffusion is a critical process in biology, physics, and chemistry, where molecules move from an area of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Digastric Muscle - Definition, Structure, Types, Functions
What is Digastric Muscle? Digastric Muscle Definition The digastric muscle is a bilaterally paired suprahyoid muscle located beneath the jaw, characterized by two distinct ‘bellies’—an anterior and a posterior section—that play pivotal roles in jaw movement and swallowing. Characteristics of Digastric Muscle The digastric muscle exhibits several distinctive characteristics: Where is the Digastric Muscle Located? ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Digestive system of Earthworms
The earthworm, a vital detritivore in terrestrial ecosystems, possesses a specialized and efficient digestive system tailored for its diet and lifestyle. This system is characterized by its alimentary canal, a continuous tubular structure that extends longitudinally from the anterior mouth to the posterior anus. This canal is essential for the processing and absorption of organic ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Digestive System of insects - Structure, functions
Insects exhibit a remarkable diversity in their feeding habits, leading to significant adaptations in their digestive systems. These adaptations can be classified based on their dietary preferences, which include phytophagous (plant-eating), entomophagous (insect-eating), wood-boring, wool-feeding, and saprophytic behaviors. Each of these feeding strategies necessitates specific structural modifications within the digestive system to efficiently process the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Digital Microscope - Principle, Parts, Uses, Advantages
Digital microscopes are modern microscope which does not have an eyepiece. This is a huge contrast from an optical microscope. Digital microscopes have an electronic camera that acts as the detector as well as the imaging output gadget. It displays the images takes place via a computer's screen or monitor, which defines the scope of the microscope's digital.
Dinoflagellate - Definition, Structure, Reproduction, Importance, Examples
What is Dinoflagellate? Definition of Dinoflagellate Dinoflagellates are single-celled eukaryotic microorganisms, primarily found in marine environments, characterized by two whip-like flagella that facilitate movement. Many species are photosynthetic, and they play vital roles in aquatic ecosystems, ranging from primary producers to causing phenomena like bioluminescence and red tides. Dinoflagellates Classification Dinoflagellates are a diverse group ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Diphtheroids - Definition, Classification, Structure, Pathogenesis, Transmission
Domain: Bacteria Phylum: Actinomycetota Class: Actinomycetia Order: Mycobacteriales Family: Corynebacteriaceae Genus: Corynebacterium Species: C. diphtheriae What is Diphtheroids? (Corynebacterium diphtheriae) Characteristics of Diphtheroids/Corynebacterium diphtheriae The infectious disease known as diphtheria is caused by the bacterium Corynebacterium diphtheriae. Key characteristics of Corynebacterium diphtheriae are as follows: Due to pervasive vaccination programs, diphtheria is now uncommon in many ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Diploid - Definition, Importance, Examples
What is Diploid Cell? Definition of Diploid Cell A diploid cell is a cell that contains two complete sets of chromosomes, one inherited from each parent. Features of diploid cells Diploid cells are integral to the genetic architecture of many organisms. Here are the salient features of these cells: Diploid cells in Human body In ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Direct ELISA - Principle, Protocol, Advantages
What is Direct ELISA? Principle of Direct ELISA The principle of direct ELISA revolves around the specific binding interaction between an antigen and its corresponding antibody. In this type of ELISA, the antigen of interest is adsorbed or immobilized onto the surface of a plastic plate, typically a microtiter plate with multiple wells. To minimize ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Direct Microscopic Count (DMC) Advantage, Disadvantage.
Direct Microscopic Count (DMC) Cell Counting Formula In Counting Chamber The number of bacterial cell per milliliter (ml) = Number of cells counted X dilution (if used) X 50,000* The factor of 50,000 is used in order to determine the cell count for 1 ml: 1 ml = 1000 mm3 = (50 times the chamber ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Dirt and Soil under a Microscope
Whta is Dirt and Soil? Direct Observation of the Samples Requirements Procedure Step 1: Wear Protective Gloves Before handling soil and dirt samples, put on a pair of gloves to maintain aseptic conditions and prevent contamination. Step 2: Preparation of Samples Using a spatula, scoop a small amount of dirt and place it onto a ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Disaccharides - Definition, Classification, Functions, Examples
What are Disaccharides? Definition of Disaccharides Disaccharides are sugars formed by the joining of two monosaccharide molecules through a glycosidic linkage. They are soluble in water and include examples like sucrose, lactose, and maltose. Properties of Disaccharides Disaccharides possess several properties that are influenced by their structural characteristics and composition: These properties contribute to the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Disease Control and Management In Plants
Aspects of Plant Diseases Aspects of plant diseases encompass a multifaceted study of the various factors that contribute to the development and impact of diseases on plants. Understanding these aspects is critical for effective disease management and prevention in agriculture. The occurrence of a plant disease is contingent upon three essential elements: the presence of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Disposable Glass Pasteur Pipettes
Ever wondered about the little scientific marvels you hold in your hand during chemistry or biology labs? We’re shining a spotlight on one such unsung hero of the scientific world – disposable glass pasteur pipettes. These handy tools, so often taken for granted, have a fascinating history and a crucial role in your experimental success. Let’s dive in and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Disruptions to Ecosystems - Causes, Consequences, Preventions
Disruptions to Ecosystems Characteristics of Ecosystems Disruptions Ecosystem disruptions, commonly referred to as disturbances, possess several defining characteristics that critically shape their ecological consequences. Understanding these characteristics is essential for grasping how ecosystems respond to and recover from various forms of disruption. Key Implications of These Characteristics: Different causes for Disruptions of Ecosystems Different causes ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Dissecting Microscope (Stereo Microscope) - Principle, Parts, Procedure
Stereo microscope is an optical microscope that is used to observe large, three dimensional and opaque specimens at low magnification. It is also called dissecting microscope. It gives a magnified image of the surface of the object by using reflected light. It is different from compound microscope because compound microscope uses transmitted light through thin ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Distant Hybridization - Definition, Objectives, Barriers, Techniques, Limitations
What is Distant Hybridization (Wide hybridization)? Definition of Distant Hybridization Distant hybridization, or wide hybridization, refers to the crossing of individuals from different species or genera that are more distantly related than varieties within the same species, aiming to introduce novel traits and increase genetic diversity. History of Distant Hybridization Objectives of Distant Hybridization Barriers ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Distribution Of Microorganisms In Aquatic Environment
Types of Waters Inhabited by Microorganisms Biotopes of water microorganisms may include subterranean and/or surface waters, as well as sediments on the ocean floor. Microorganisms of Aquatic Environment Microorganisms inhabit surface waters in all zones; they may be suspended (plankton), cover fixed submerged objects, plants, etc. (periphyton), or reside in sediments at the bottom (benthos). ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
DNA - Definition, Structure, Properties, Types, Functions
What is DNA? DNA is a polymer of deoxyribonucleotides stuck together (or simply deoxynucleotides). It is made up of deoxyadenylate (dAMP), deoxyguanylate (dGMP), deoxycytidylate (dCMP), and deoxythymidylate (dTMP) units (dTMP) (Some authors prefer to use TMP instead of deoxythymidylate because it is only found in DNA.) History of DNA The history of DNA begins with ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
DNA Analyzer - Principle, Parts, Operating, Applications
DNA Analyzer is a precision scientific instrument that is used to automate the process of genetic analysis. It is also commonly referred to as DNA sequencer. It determines the exact order of four nucleotide bases such as adenine (A), guanine (G), cytosine (C), and thymine (T) present in a DNA sample. Modern DNA analyzer combines ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
DNA Fingerprinting - Definition, Steps, Methods, Applications
In the world of genetics, there exists a remarkable technique that allows us to unlock the mysteries hidden within our DNA. DNA fingerprinting, also known as DNA profiling, is a laboratory genetic method that has revolutionized the way we identify individuals, establish relationships, and investigate crimes. By analyzing specific regions of our unique genetic code, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
DNA Helicases - Structure, Types, Mechanism, Functions, Examples
What is Helicase? What is DNA Helicase? History of DNA Helicases The history of DNA helicases begins with their discovery in the mid-1970s. These enzymes, crucial for unwinding DNA strands, have been extensively studied across a wide range of organisms. From bacteria to plants and humans, research on helicases has revealed their essential role in ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
DNA Ladders - Definition, Types, Uses
What is DNA Ladder? Definition of DNA Ladder A DNA ladder is a solution containing DNA molecules of known lengths that are used as a reference to estimate the size of unknown DNA fragments separated through gel electrophoresis. Characteristics of DNA Ladder DNA ladders used for electrophoresis possess several important characteristics to ensure their effectiveness ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
DNA Library - Types, Construction, Applications
What is DNA Library (Genomic, cDNA)? Types of DNA Library There are two main types of DNA libraries: genomic libraries, and cDNA libraries. 1. Genomic Library 2. cDNA Library Genomic Library Construction Steps Genomic Library Construction Steps Creating a cDNA library begins with mRNA, which carries genetic instructions from DNA to ribosomes for protein synthesis. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
DNA Ligase - Structure, Types, Mechanism, Functions
What is Ligase? In biochemistry, ligases are a class of enzymes that incorporate joining of two large molecules by forming new bond. This process which is referred to as ligation, commonly entails a hydrolysis of a indivisible chemical group of one of the substrates which allows formation of new linkages that include C-O, C-S or ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
DNA Methylation - Definition, Mechanisms, Functions
What is DNA Methylation? DNA Methylation Definition DNA methylation is an epigenetic process in which a methyl group (CH3) is added to the DNA molecule. This modification primarily occurs at the 5-carbon position of the cytosine ring, resulting in the formation of 5-methylcytosine (5-mC). It is considered one of the major mechanisms for regulating gene ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
DNA Microarray Principle, Types and Steps involved in cDNA microarrays
The DNA microarray technology is among the most effective technology that can offer an extremely high-throughput and precise overview of the whole transcriptome and genome, which lets scientists understand the molecular processes that underlie natural and malfunctioning biological processes. Microarray technology may accelerate the process of screening thousands of protein and DNA samples at once.
DNA Polymerase - Definition, Mechanism, Structure, Types
What is DNA Polymerase? DNA polymerases Definition DNA polymerases are enzymes that catalyze the synthesis of DNA molecules from nucleoside triphosphates, playing a crucial role in DNA replication and repair across all living organisms. Properties of DNA Polymerase DNA polymerases possess several important properties that contribute to their role in DNA replication. These properties ensure ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
DNA polymerase I - Definition, Structure, Mechanism, Functions
What is DNA polymerase I? Definition of DNA polymerase I DNA polymerase I (Pol I) is an enzyme found in prokaryotes that plays a role in DNA replication and repair, primarily assisting in the removal of RNA primers and filling in the resulting gaps with DNA nucleotides. Structure of DNA polymerase I Mechanism of DNA ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
DNA polymerase II - Definition, Structure, Mechanism, Functions
What is DNA polymerase II? Definition of DNA polymerase II DNA polymerase II (DNA Pol II) is a prokaryotic DNA-dependent DNA polymerase that primarily functions as a backup enzyme in DNA replication and repair processes. It belongs to the B family of DNA polymerases and possesses DNA synthesis and proofreading activities. Structure of DNA polymerase ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
DNA polymerase III (holoenzyme)
What is DNA polymerase III (holoenzyme)? Definition of DNA polymerase III (holoenzyme) DNA polymerase III holoenzyme is the primary enzyme complex in prokaryotes responsible for DNA replication, possessing both synthesis and proofreading capabilities to ensure accurate replication of the genome. Components of DNA polymerase III (holoenzyme) The DNA polymerase III holoenzyme, a central player in ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
DNA polymerase IV - Definition, Structure, Mechanism, Functions
What is DNA polymerase IV? Definition of DNA polymerase IV DNA polymerase IV is a prokaryotic enzyme encoded by the dinB gene, involved in mutagenesis and DNA repair processes, especially during the SOS response to DNA damage. Unlike many polymerases, it lacks proofreading activity, making it error-prone, but it plays a crucial role in translesion ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
DNA Recombination - Definition, Mechanisms, Types
DNA recombination is the process in which the genetic material (DNA) is exchanged between two DNA molecules. It is the natural method for reshuffling of genes, and it is observed in most living organisms. It is the process where the DNA strand is broken and then repaired, and new combination of alleles is formed. It ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
DNA Repair Mechanisms and Types
What is dna repair mechanism? DNA repair is a collection of processes by which a cell identifies and corrects damage to the DNA molecules that encode its genome. dna repair definition Types of dna repair mechanism There are present four types of DNA Repair System such as; 1. Mismatch Repair System Enzyme participate in dna ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
DNA Sequencing - Definition, Principle, Steps, Types, Applications
What is DNA Sequencing? Definition of DNA Sequencing DNA sequencing refers to the techniques used to determine the order of the nucleotide bases adenine, guanine, cytosine, and thymine within a DNA molecule. Methods of DNA Sequencing DNA sequencing is a crucial technique used in various fields of biological research, allowing scientists to unravel the genetic ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
DNase Test - Principle, Procedure, Result, Uses
The DNase test is a differential biochemical test which is used to detect the ability of microorganism to produce an extracellular enzyme called deoxyribonuclease (DNase). It is the process where polymerized DNA present in the medium is hydrolyzed into smaller nucleotide fragments by the action of this enzyme. These degraded products can be absorbed by ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Domain - Definition, Development, Importance, Examples
What is Domain? Definition of Domain In biology, a domain is the highest taxonomic rank used to categorize and group organisms based on shared characteristics and evolutionary history. Domain in the Tree of Life Development of the Domain System The conception and evolution of the domain system, a fundamental framework for the classification of life, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Dot Blot - Protocol, Principle, Definition.
Dot Blot is a simplified technique of western blotting, which is mainly used for the detection of proteins.
Double Beam Balance - Principle, Parts, Procedure, Uses
Double Beam Balance is a mechanical weighing instrument that is used to measure the mass of an object by comparing it with known reference masses. It has two parallel horizontal beams. One beam is coarse beam, which is used for larger weight measurement and another is fine beam, which is used for very small and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Double Circulation - Types, Process, Advantages
What is Double Circulation? Types of Circulatory Systems In the animal kingdom, circulatory systems are fundamental for the transport of nutrients, gases, and waste products. There are primarily two types of circulatory systems: the open circulatory system and the closed circulatory system. Each of these systems has distinct mechanisms and efficiency levels, catering to the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Dounce Homogenizer - Principle, Types, Procedure, Parts, Uses
Dounce Homogenizer is a specialized laboratory instrument used for gentle mechanical disruption of eukaryotic cells and soft tissues. It is also known as a tissue grinder. It was invented by Alexander Dounce in 1954. It consists of a cylindrical glass mortar or tube made up of borosilicate glass and two glass pestles. The two pestles ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Downstream Processing Steps
What is Downstream processing? Downstream processing refers to the procedures required to recover and purify fermentation-produced products. In the step of downstream processing, particles, mostly cells, are separated from the liquid using filtration, centrifugation, and flocculation. Steps Of Downstream Processing Five stages in downstream processing after Fermentation: Stage 1: Solid-Liquid Separation 1. Flotation 2. Flocculation ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Drug-Yielding plants - Cinchona, Digitalis, Papaver and Cannabis
History of medicinal plants The history of medicinal plants is a profound narrative that traces humanity’s relationship with nature, reflecting a continuous quest to alleviate suffering and cure ailments. This exploration begins with primitive practices rooted in superstition and speculation, evolving into a scientific understanding of pharmacology that we recognize today. Classification of drugs The ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Dry Mount Slides - Principle, Preparation, Uses
A dry mount slide is the simplest type of slide preparation in microscopy. It is the process in which a dry specimen is placed directly on the clean glass slide without using any liquid medium. It is the air that remains between the specimen and the objective lens, and the refractive index of air is ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Drying Method of Food Preservation - Types, Methods, Examples
Food Preservation by Drying Purpose of drying The purpose of drying in food processing is multi-fold and serves several important functions. Here are the key purposes of drying: Principle of Preservation by Drying/ Dehydration/ Concentration The principle of drying in food processing is based on the state of water in the food and its effect ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Dutch elm disease (DED) - Cause, Lifecycle, Spread, Management
What is Dutch elm disease (DED)? A deadly fungal disease that infects elm trees and stops water from flowing through their vessels, causing them to wilt and die. The main cause is Ophiostoma ulmi and Ophiostoma novo-ulmi. Dutch phytopathologists Schwarz and Buisman found it in the Netherlands in the early 1920s. It was brought to ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Ecological Succession - Definition, Types, Mechanism, Examples
What is Ecological Succession? Ecological Succession Definition Ecological succession is the systematic and predictable process by which species composition in an ecosystem changes over time, progressing from initial colonization to a mature and stable community. Characteristics of Ecological Succession Ecological succession is a fundamental concept in the realm of ecology, delineating the sequential transformation of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
E. Coli Under The Microscope
E. coli, short for Escherichia coli, is a versatile bacterium that can be found in a variety of environments, including certain foods, soil, and the intestines of animals, including humans. It belongs to the genus Escherichia and exhibits a wide diversity of strains. While many strains of E. coli are harmless and even beneficial, some ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Earthworm - Habitat, Morphology, Anatomy, Significance
What is Earthworm? Classifications of Earthworms Earthworms, commonly known as nightcrawlers, are complex organisms that play a vital role in the ecosystem. Their classification within the biological hierarchy is detailed and sequential, providing a comprehensive understanding of their evolutionary lineage and biological significance. Habit and habitat of Earthworm Earthworms are fascinating creatures that play a ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Eastern blot - Protocol, Principle, Application
A Molecular Biology Technique is used for the identification of Post Translation Modification mostly carbohydrate Epitopes by transferring onto a membrane and analyzed using a probe.
Ebola Virus - Structure, Genome, Replication, Pathogenesis
Ebola Virus Ebola Virus Classification Hosts of Ebola Virus Structure of Ebola Virus Genome of Ebola Virus The genome is composed of a single strand of negative RNA and measures around 18–19 kilobases in length. There are seven proteins in all that are encoded by the genome. Neither the 3′ nor the 5′ end is polyadenylated or ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Ecological Adaptations in Hydrophytes
What are Hydrophytes? Classification of Hydrophytes The classification of hydrophytes is based on their morphological and ecological characteristics, leading to a categorization into five distinct groups. Each group of hydrophytes has adapted to its specific aquatic environment, reflecting the diversity of survival strategies among aquatic plants. Morphology of Hydrophytes The morphology of hydrophytes, or aquatic ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Ecological efficiency - Definition, Factors, Calculation, Applications
What is Ecological efficiency? Energy transfer Energy transfer in an ecosystem is a fundamental process that involves the flow of energy from one trophic level to another. The energy originates from primary production, which occurs in autotrophic organisms such as plants and algae. These photoautotrophs convert solar energy into chemical energy through the process of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Ecological Pyramids - Definition, Types, Examples, Importance, Limitations
What are Ecological Pyramids? Definition of Ecological Pyramids Ecological pyramids are graphical representations that depict the distribution of energy, biomass, or numbers of organisms across different trophic levels in an ecosystem. Features of the Ecological Pyramid The Ecological Pyramid is a fundamental concept in ecology, offering a structured visual representation of the distribution and flow ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Ecology in Wildlife Conservation and Management
India boasts an exceptionally rich wildlife heritage, underpinned by a long-standing tradition of conservation. The ethical foundation of wildlife preservation in India can be traced to ancient times, where conservation principles were embedded within the cultural and spiritual practices of its people. These values were cultivated by sages, emphasizing the connection between humans and nature. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Economic Importance of Algae - Food Industry, Chemical Industry, Agriculture, Medicine
Economic Importance of Algae Overview Algae is a photosynthetic, eukaryotic marine organism. Their size ranges from unicellular microalgae to giant kelp. Algae are characterized by their lack of flowers, formal roots, leaves, or even stems. They can grow anywhere such as in the dirt or on rocks, marine water, freshwater, etc. Algae are variable in shapes, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Economic Importance of Fungi In Medicine, Industry, Agriculture, and Food.
In this article, we will learn about the Economic Importance of Fungi in agriculture, industries, medicine, etc. There are present a huge number of fungi, which has tremendous economic importance to humans. Every day we benefited or were harmed directly or indirectly by those fungi. They help in yielding antibiotics, maintain the soil fertility, cause ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Economic Importance of Gymnosperms
What is a gymnosperm? Uses of Gymnosperms Ecological Importance of Gymnosperms Economic Importance of Gymnosperms 1. Ornamental value of Gymnosperms 2. Food Value of Gymnosperms 3. Medicinal value of Gymnosperms Gymnosperms, comprising conifers, cycads, ginkgoes, and gnetophytes, are significant sources of bioactive compounds with medicinal properties. These plants produce a variety of phytochemicals, including alkaloids, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Economic Importance of Protozoa and Mode of Infection
Protozoa are unicellular, microscopic, eukaryotic protists which are found in everywhere such as water; soil, on the body of plants and animals. They lack a cell wall and their size ranges from 5 to 250 micrometers.
Effect of Antibiotics on the Cell Wall
In the early 20th century there was no treatment to treat infections caused by bacteria. This included tuberculosis and pneumonia, as well as the rheumatic and gonorrhea diseases, and infections of the urinary tract. However, in 1929 the the bacteriologist Alexander Fleming discovered the first real antibiotic, penicillin, heralding a new era of medical science. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Effect of Density of Populations - AP Biology Notes
Population density significantly influences the dynamics of ecosystems, affecting various biological processes and interactions. Understanding the factors that impact population density is crucial for comprehending how species coexist and thrive in their environments. Population regulation is often shaped by density-dependent factors. These factors become more significant as population density increases. One of the primary density-dependent ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Egg Cell - Structure, Types, Functions
What is Egg Cell? Definition of Egg Cell An egg cell, or ovum, is the female reproductive cell in sexually reproducing organisms. It is a haploid cell produced in the ovaries through oogenesis and is essential for fertilization, as it combines with a sperm cell to form a diploid zygote, which can develop into a ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Egg Yolk Agar - Composition, Principle, Preparation, Results, Uses
Egg Yolk Agar modified is based upon the original Egg Yolk Agar formula developed by McClung & Toabe to isolate and differentiate organisms based in Lecithinase, lipase production, and proteolytic activities.
Eggs - Types, Structure, Egg Membranes, Examples
An egg is a biological structure which contains the female gamete and after fertilization it carries the developing embryo. It is an organic vessel that provides protection and nourishment to the embryo till hatching or birth. The major internal component of egg is yolk (vitellin) which acts as reserve food material and supplying energy for ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Elastic Cartilage - Definition, Structure, Functions
What is Elastic Cartilage? Definition of Elastic Cartilage Elastic cartilage is a specialized type of connective tissue characterized by its yellowish appearance and high content of elastic fibers. It is found in body organs that require flexibility and shape maintenance, such as the external ear, epiglottis, and eustachian tube. Elastic cartilage provides strength and elasticity ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Electrocardiogram (ECG) - Purpose, Principle, Parts, Types, Procedure, Application
What is Electrocardiogram (ECG)? Purpose of ECG Test The electrocardiogram (ECG) test is a fundamental diagnostic tool utilized in cardiology to assess the heart’s electrical activity and rhythm. Its purposes are multifaceted, enabling healthcare providers to detect, diagnose, and monitor various cardiac conditions effectively. Working principle of electrocardiograph/Electrocardiogram Waves of Normal ECG A normal electrocardiogram ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Electrofusion Technique for Plants - Requirement, Protocol, Advantages, Uses
What is the Electrofusion of Plant Cells? Electrofusion is a technique used for the fusion of two or more plant cells by the application of an electric field. It is commonly used for the fusion of plant protoplasts in plant biotechnology. In this method the plasma membranes of adjacent cells are temporarily disturbed and the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Electron Microscope - Principle, Types, Parts, Application, Diagram
Electron microscope is a high power microscope that uses a beam of accelerated electrons instead of visible light for illumination and image formation. Due to very short wavelength of electrons, it can overcome the diffraction limit of light microscope lenses. Hence, it gives very high resolving power and very high magnification as compared to compound ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Electron Spin Resonance (ESR) - Principle, Instrumentation, Applications
Electron Spin Resonance (ESR) is also known as Electron Paramagnetic Resonance (EPR). It is a non-destructive spectroscopic technique used for studying materials having one or more unpaired electrons. These unpaired electrons are present in paramagnetic substances. Every electron acts like a small magnet because it has intrinsic angular momentum or spin. When the sample is ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Electron Transport Chain - Diagram, Definition, Steps, Products, Importance
What is the Electron Transport Chain? Electron transport chain Definition The electron transport chain is a series of protein complexes and molecules located in membranes, where electrons are transferred through redox reactions to generate a proton gradient that drives ATP synthesis via oxidative phosphorylation. Electron Transport Chain Animation Video Fundamentals of the Electron Transport Chain ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Electroporation - Principle, Steps, Applications
What is Electroporation? Electroporation is a fascinating technique that temporarily makes cell membranes more permeable by applying brief electric pulses. This method, widely used in labs and medical settings, allows substances like DNA, drugs, or proteins to enter cells by creating tiny pores in the membrane. Imagine zapping cells with a controlled jolt of electricity—this ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Electroporator – Principle, Types, Protocol, Applications
Electroporator is a specialized electronic pulse generator that is used to deliver controlled high-voltage electrical pulses to biological cells. It is used in electroporation process for temporary opening of the cell membrane. It acts on the lipid bilayer membrane of the cell and makes small aqueous pores for short time. Through these pores, different macromolecules ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Elek test - Principle, Procedure, Result
can be described as an test of immunoprecipitation (immunodiffusion) test that determines what specific strain of Corynebacterium Diphtheriae is toxic.
Elements of Life - AP Biology
What do you mean by elements of life? What are essential chemical elements? What are Trace Elements? Basic Elements Required in the Human Body The human body depends on several basic elements to function properly, each playing a critical role in various biological processes. These elements form the foundation of the body’s structure and contribute ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
ELISA Plate Reader (Microplate Reader) - Principle, Parts, Uses
What is ELISA? ELISA (Enzyme-Linked Immunosorbent Assay) is a laboratory technique used to detect and quantify antigen or antibody in a given sample. It is an immunological test in which specific antigen-antibody reaction is used for detection. It is commonly used for detecting toxins, viruses, hormones, proteins and other foreign substances in blood, cell lysate, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
ELISA test - Definition, Principle, Procedure, Types, Steps, Uses
What is ELISA test ? Definition of ELISA ELISA, short for Enzyme-Linked Immunosorbent Assay, is a widely used laboratory technique that detects and measures the presence of specific antibodies or antigens in a sample. It involves the binding of target molecules (antibodies or antigens) to a solid surface, followed by the addition of enzymes or ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
ELISA vs Western Blot - Differences
What is ELISA? ELISA, short for enzyme-linked immunosorbent assay, is a widely used and highly sensitive test in the field of immunoassays. It was first introduced by Eva Engvall and Peter Perlmann in 1971 and has since become a gold standard technique for detecting and quantifying various molecules, including hormones, glycoproteins, proteins, antibodies, and antigens. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
EMB Agar - Composition, Principle, Preparation, Results, Uses
Eosin Methylene Blue (EMB), a microbiological media, is a differentiating medium that slightly inhibits the growth and color of Gram-positive bacteria. It also provides a color indicator to distinguish between organisms that ferment lactose (e.g. E.coli) and those who do not (e.g. Salmonella, Shigella). Holt-Harris, Teague, and Levine first created EMB agar.
Embryo Development of Dicot and monocot embryo
What is Embryo Development in Plants? Development of the embryo (Embryogenesis) The development of the embryo in angiosperms, known as embryogenesis, is a complex and highly regulated process that transforms a diploid oospore (zygote) into a mature embryo. This process involves several key stages and can be categorized into different types based on the patterns ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Embryo Sac - Structure, Types, Development, Function
What is an Embryo Sac? Definition of Embryo Sac The embryo sac is the female gametophyte in flowering plants, located within the ovule, where fertilization occurs, leading to the development of the seed and endosperm. Structure of Embryo Sac The structure of the embryo sac, also known as the mature female gametophyte, is integral to ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Embryological Evolution
The study of embryology, also known as embryos, is a key element of evolution in biology and can identify the commonalities and differences between different species. The embryo of an organism refers to the fertilized egg that it progresses through the stages of development, which are unique to the particular species. In examining how the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Embryology - Definition, Types, Importance
What is Embryology? Definition of Embryology Embryology is the scientific study of the formation, development, and growth of embryos and fetuses within organisms. History of Embryology The historical trajectory of embryology is a testament to humanity’s enduring quest to understand the origins and development of life. This journey, spanning diverse civilizations, offers a rich tapestry ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Embryonic Induction And Organizers
What is Embryonic Induction? Historical Background of Embryonic Induction The historical background of embryonic induction is marked by the pioneering work of Hans Spemann, a German embryologist, and his student Hilde Mangold in the 1920s. Their extensive research on newt species, specifically Triturus cristatus and Triturus taeniatus, led to the discovery of neural induction. In ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Embryonic Stem Cells - Definition, Properties, Applications
What is Embryonic Stem Cell? Definition of Embryonic Stem Cell Embryonic stem cells (ESCs) are pluripotent cells derived from the inner cell mass of a blastocyst, an early-stage embryo, capable of differentiating into any cell type within an organism. History of Embryonic Stem Cell The history of embryonic stem cells (ESCs) is marked by pioneering ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Emulsion PCR - Principle, Procedure, Advantages, Limitations, Uses
What is Emulsion PCR? Principle of Emulsion PCR Emulsion PCR (polymerase chain reaction) is a sophisticated technique designed to amplify individual DNA templates in a high-throughput manner by partitioning the DNA into tiny water-in-oil droplets. Each droplet serves as an independent microreactor, allowing for the separate amplification of distinct DNA fragments. This method leverages the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Endemic, Epidemic, and Pandemic Definition In Microbiology.
Hey there today in this article we will learn about epidemiology. Before we know about the epidemiology, first we need to analyse the term epidemiology. The term epidemiology comes from a Greek word epidemios which mean “among the people” and logos, meaning “study”. Epidemiology is a branch of microbiology in which epidemiologist are concern about ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Endemism - Definition, Characters, Theories, Types, Factors, Examples
What is Endemism? Endemism Definition Endemism is the condition where a species is native to and restricted to a specific geographic area, such as an island or country, and is not found naturally elsewhere. What is an Endemic Species? Types of Endemism Endemism can be categorized into several distinct types, each reflecting different evolutionary and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Endo Agar - Composition, Principle, Preparation, Results, Uses
Endo created Endo Agar to distinguish gram-negative bacteria based on lactose fermentation and inhibit gram-positive bacteria. The latter were not inhibited by bile salts, as was traditional. Endo was able to inhibit gram-positive bacteria using sodium sulfite, basic fuchsin.
Endocrine Glands - Definition, Structure, Functions, Examples
What is Endocrine Glands? Definition of Endocrine Glands Endocrine glands are ductless glands that secrete hormones directly into the bloodstream to regulate various physiological processes in the body. Characteristics of Endocrine Glands Endocrine glands possess several distinct characteristics that differentiate them from other types of glands. Here are the key characteristics of endocrine glands: Overall, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Endocrine System - Definition, Structure, Primary and Secondary glands
What is Endocrine System? Definition of Endocrine System The endocrine system is a network of glands that release hormones directly into the bloodstream to regulate various bodily functions, including metabolism, growth, reproduction, and mood. It works in conjunction with the nervous system to maintain homeostasis and coordinate complex processes within the body. Structure of Endocrine ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Endocrinology - Definition, History, Endocrine system
What is Endocrinology? Definition of Endocrinology Endocrinology is the branch of medicine and biology that studies the endocrine system, its glands, and the hormones they produce. It focuses on how hormones regulate various physiological processes, including growth, metabolism, reproduction, and behavior, as well as the diagnosis and treatment of hormonal disorders. History of endocrinology Endocrinology, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Endocytosis - Definition, Steps, Types, Mechanism, Function, Examples
Endocytosis is a cellular process by which cells internalize substances from their external environment.
Endoplasmic Reticulum (ER) - Structure, Functions and Diagram
What is the Endoplasmic Reticulum? Endoplasmic Reticulum (ER) Definition The endoplasmic reticulum (ER) is a large, membrane-bound organelle found in eukaryotic cells. It plays a crucial role in the synthesis, folding, modification, and transport of proteins and lipids. The ER is divided into two types: the rough ER, studded with ribosomes and involved in protein ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Endosperm - Types, Development, Functions, Examples
What is Endosperm? Definition of Endosperm The endosperm is a tissue found in seeds of flowering plants that provides nourishment to the developing embryo. It is formed from the fertilization of a secondary nucleus by a sperm cell and can vary in structure, including nuclear, cellular, or ruminate types, depending on the plant species. Characteristic ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Endospore - Definition, Formation, Germination, Structure, Resistance
Endospores are dormant, tough, resistant, and non-reproductive structures which are produced by gram-positive bacterial cell (such as bacillus, clostridium) in the phylum firmicutes during the unfavorable condition of the environment.
Endospore Staining - Principle, Procedure, Result
There are two methods which are commonly used to stain bacterial endospore such as Schaeffer Fulton and Klein methods.
Endosymbiosis - Definition, Theory, Evidence, Examples
What is Endosymbiosis? Definition of Endosymbiosis Endosymbiosis is a form of symbiosis in which one organism (the endosymbiont) lives inside the cells or body of another organism (the host), often resulting in mutual benefits for both entities. Endosymbiotic Theory The Endosymbiotic Theory offers a comprehensive explanation for the evolutionary transition from prokaryotic to eukaryotic cells. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Endosymbiotic Theory - Origin of the eukaryotic cell
What is Endosymbiotic Theory? Definition of Endosymbiotic Theory The Endosymbiotic Theory posits that certain organelles in eukaryotic cells, specifically mitochondria and chloroplasts, originated from free-living prokaryotic cells that were engulfed by ancestral eukaryotic cells, leading to a mutually beneficial symbiotic relationship. Origin of the eukaryotic cell 1. Gene Trees and the Complexity of Eukaryotic Origins ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Endotoxin - Definition, Examples, Structure, Virulence Mechanism
Endotoxin definition/what is endotoxin? Endotoxin examples The term”endotoxin” is typically used to describe the pyrogens that Gram-negative bacteria produce. In the field of bacteriology, this complicated compound is also referred to as lipopolysaccharide. It can be located in the membranes on the outside of bacteria such as Escherichia Coli, Salmonella shigella, Vibrio cholerae as well ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Energy Flow in Ecosystem
Energy Flow Energy Flow in Ecosystem Law of Thermodynamics in the Ecosystem Food Chain In the ecosystem, there are basically three different kinds of food chains. In nature, we mostly look at the food web because many living things eat both plants and animals. So, they live in more than one trophic level. Producers are ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Energy Rich Compounds - Phosphoenolpyruvate, 1,3 Bisphosphoglycerate, Thioesters, ATP
What is Energy rich compound? Phosphoenolpyruvate Structure of Phosphoenolpyruvate The structure of phosphoenolpyruvate (PEP) consists of a three-carbon pyruvate molecule with an additional phosphate group attached to one of the carbon atoms. Here is the structural formula of PEP: HO-C=O | P-O-P-OH | CH2-CHO In the structure, the central carbon atom is double-bonded to an ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Enhancer RNAs - Definition, Biogenesis, Functions
What is Enhancer RNA? Enhancer RNAs Detection Functions of enhancer RNAs Biogenesis of Enhancer RNAs 1D eRNAs 2D eRNAs Enhancer RNAs in disease Enhancer RNA and inflammation Enhancer RNA and neurodegenerative disorders Enhancer RNA and cancer Enhancer RNA in diabetes Mechanisms of Enhancer RNAs Transcriptional Noise Transcription-dependent effects Functional activity in cis Functional activity in ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Enhancers and silencers - Definition, Location, Examples, Functions
What are Enhancers and silencers? What is Enhancer? Enhancers play a critical role in regulating gene expression in both prokaryotes and eukaryotes. They are specific regions of DNA that, despite their distance from the genes they influence, serve as crucial elements for the transcriptional activation of genes. Below is a detailed breakdown of what enhancers ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Entamoeba Histolytica - Morphology, Life Cycle, Prevalence, Epidemiology, Pathogenicity, Diagnosis, Prophylaxis and Treatment
Entamoeba histolytica can be described as an anaerobic parasite amoebozoan that is part of the Genus Entamoeba. It is a major cause of infection for humans and other primates , causing amoebiasis. E. histolytica is estimated to affect between 35 and 50 million people across the globe.
Enteroaggregative E. coli (EAEC) - Disease, Pathogenesis, Treatment, Diagnosis
What is Enteroaggregative E. coli (EAEC)? Disease Caused by Enteroaggregative E. coli (EAEC) Pathogenesis Mechanism of Enteroaggregative E. coli (EAEC) The pathogenesis of Enteroaggregative Escherichia coli (EAEC) involves several stages and mechanisms. EAEC is primarily transmitted through the fecal-oral route, often through contaminated food and water sources. The pathogenesis of EAEC is a complex process ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Enteroinvasive E. coli (EIEC) - Transmission, Disease, Pathogenesis, Treatment
What is Enteroinvasive E. coli (EIEC)? Enteroinvasive Escherichia coli (EIEC) is a pathogenic bacteria that shares similarities with Shigella, a bacteria known to cause shigellosis. EIEC infections lead to a syndrome that closely resembles shigellosis, characterized by severe diarrhea and high fever. Unlike other types of E. coli, EIEC is highly invasive and enters intestinal ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Enteropathogenic Escherichia coli (EPEC) - Diseases, Toxins, Mode of Actions, Transmission
Enteropathogenic Escherichia coli (EPEC) Enteropathogenic Escherichia coli (EPEC) are a group of strains of Escherichia coli that have been associated with diarrheal illnesses. The understanding of EPEC has evolved over time with the discovery of different mechanisms of pathogenesis. Here is a summary of the key points about EPEC: Advancements in techniques and a better ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Entner–Doudoroff pathway - definition, Steps.
Entner–Doudoroff pathway is an alternative pathway of Glycolysis. This pathway is found in Gram-negative bacteria, certain Gram-positive bacteria, and archaea. Entner–Doudoroff pathway Definition Entner–Doudoroff pathway containing Organisms Some example of bacteria those contain Entner–Doudoroff pathway are Pseudomonas, Azotobacter, Rhizobium, Agrobacterium, Escherichia coli, Enterococcus faecalis, Xanthomonas campestris, Zymomonas mobilis, Enterococcus faecalis. This pathway also found in ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Enzyme Immobilization - Definition, Methods, Advantages, Disadvantages
Enzyme Immobilization Soluble Enzyme + Substrate———– Product (single time usage of enzyme) Immobilized Enzyme + Substrate———Product (Repeated usage of enzyme) A number of essential considerations must be made when immobilising an enzyme. What is a Support Matrix? It is a substance that facilitates the entrapment of an enzyme. For effective immobilization, a support matrix must ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Enzyme Inhibition - Definition, Types, Mechanism, Examples
What is Enzyme Inhibition? Types of Enzyme Inhibition There are present three types of Enzyme Inhibition such as; 1. Reversible Inhibition Reversible inhibition refers to the temporary cessation of enzyme activity due to the binding of a reversible inhibitor. This binding is not permanent, and the enzyme can regain its activity once the inhibitor is ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Enzymes - Structure, Types, Mode of Action, Functions, Applications, Examples
What are Enzymes? Definition of Enzymes Enzymes are protein molecules that act as biological catalysts, accelerating chemical reactions within living organisms without being consumed in the process. Characteristics Features of Enzymes Enzymes are biological molecules with distinct characteristics and features that enable them to play crucial roles in various biochemical processes. Here are the key ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Enzymes (amylase, protease, lipase) Production
What Are Enzymes? Structure of Enzyme Enzymes Classification Historically, enzymes were given names based on their discoverer. With additional study, classification grew more exhaustive. The International Union of Biochemists (IUB) classifies enzymes into six functional classes based on the sort of reaction they catalyse. Hydrolases, oxidoreductases, lyases, transferases, ligases, and isomerases are the six types ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Eosinophil - Definition, Functions, Features, Structure
What are Eosinophils? Definition of Eosinophils Eosinophils are a type of white blood cells that are involved in combating parasites, regulating allergic reactions, and supporting immune responses. They have distinctive granules in their cytoplasm and play a crucial role in maintaining immune system balance. Characteristics of Eosinophil Eosinophils possess several distinctive characteristics: These characteristics collectively ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Epi-Fluorescence Microscopy - Principle, Parts, Steps, Uses
Epi-Fluorescence Microscopy is defined as an optical imaging method, which is employed in laboratories for visualization of fluorescent-labeled samples. The technique is widely described as an essential approach, and it has been repeatedly applied in cell studies, tissue examinations, and even in material analysis. In this method, illumination is delivered from the same side / ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Epidemiology Crossword Puzzle
Epidemiology is the branch of public health that studies the distribution, patterns, and causes of diseases and health conditions in populations. It aims to identify risk factors for diseases, understand how they spread, and develop strategies to prevent or control health problems. Epidemiologists use data and research to track health trends and inform public health ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Epidermal Tissue System - Epidermis, Stomata, Cuticle
What is Epidermal Tissue System? Epidermal tissue system Components The epidermal tissue system, forming the outermost layer of the plant body, originates from the protoderm. This system is crucial for protecting the plant and regulating its interaction with the environment. The components of the epidermal tissue system include: Epidermis The epidermis is a fundamental component ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Epidermophyton floccosum
Epidermophyton floccosum is a type of filamentous fungus which causes nail and skin infection in human beings. The anthropophilic dermatophyte may cause diseases like tinea pedis (athlete’s foot) and tinea cruris, tinea corporis and even onychomycosis. The diagnostic methods for fungal infection are physical examination, testing for culture, and molecular examination. Treatment for fungal infections ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Epimers - Definition, Characteristics, Examples
What are epimers? Epimer Definition Epimers are a type of stereoisomers that differ in configuration at only one stereogenic center while having the same configuration at all other stereogenic centers. Epimerization Main Characteristics of Epimers The main characteristics of epimers can be summarized as follows: How Do Epimers and Anomers Differ? Epimers and anomers are ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Epistasis - Definition, Causes, Types, Examples
Epistasis is the interplay between genes that influence the character. Genes may mask one to the point that one gene is thought to be "dominant" or they can be combined to create a new characteristic. It's the relation between two genes that could be the basis for a particular phenotype of certain characteristics. Each locus has two alleles that define the phenotypes. They may affect each other in a manner that regardless of the particular allele of one gene it is recessive another dominant variant of. A different expression for epistasis requires a ratio chart, or table.
Epithelial Tissue - Definition, Characteristics, Types, and Functions
Epithelial Tissue is one the types of tissues (epithelial muscular, connective and nerve) in mammals. It is composed of polyhedral cells that are tightly aggregated that adhere firmly to each other, forming sheets of cells that cover the inside of hollow organs as well as covering the body's the surface. Epithelium, also known as epithelial tissue (plural epithelia) comprises cells that are laid out in continuous sheets, the form of single or multiple layers.
Epstein-Barr Virus (EBV) or Human Herpesvirus 4 - Structure, Genome, Replication
Epstein-Barr Virus (EBV), also known as Human Herpesvirus 4, is a virus that belongs to the herpesvirus family. It is one of the most common viruses in humans and is estimated to infect over 90% of people worldwide at some point in their lives. EBV is primarily transmitted through contact with infected saliva, such as ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Equisetum – Classification, Structure, Reproduction and Life Cycle
What is Equisetum? Taxonomic Rank Name Division Sphenophyta Class Sphenopsida Order Equisitales Family Equisitaceae Genus Equisetum Equisetum Characteristics Equisetum, commonly known as horsetail, encompasses a distinctive group of plants that display unique morphological and ecological characteristics. These features highlight the evolutionary significance of Equisetum and its adaptability to various environments. Equisetum Morphology The structural components ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Ergastic Substances of Plant Cells
What are Ergastic Substances? Types of Ergastic Substances Ergastic substances of plants exist in three forms: 1. Reserve Materials Reserve materials are non-living inclusions in plants that serve as essential nutritional components for plant growth and development. They are categorized into three main types: carbohydrates, nitrogenous matters, and fats and oils. Each type plays a ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Erythrocyte Sedimentation Rate (ESR): Principle, Methods
Erythrocyte Sedimentation Rate (ESR) can be described as a commonly used test used to detect non-specific signs of inflammation result of infection cancers, or certain autoimmune disorders. It is defined as the rate that Red Blood Cells (RBCs) accumulate over an hour.
Escherichia coli(E. coli) morphology, arrangement, Cultural Characteristics, Diagnosis
Scientific classification of Escherichia coli Domain Bacteria Phylum Proteobacteria Class Gammaproteobacteria Order Enterobacterales Family Enterobacteriaceae Genus Escherichia Species E. coli Binomial name Escherichia coli Escherichia coli E. coli Habitat Geographical distribution of Escherichia coli Reservoir, source, and transmission of infection E.coli Morphology and Arrangement Antigenic Structure of E.coli Heat Stable Lipopolysaccharide (LPS) is the major ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Esculin Hydrolysis test - Principle, Procedure, Result, Uses
The Esculin hydrolysis test is a biochemical test which is used for the identification and differentiation of certain bacteria, mainly Enterococcus species and Group D streptococci from other streptococci. It is also used for identifying some other organisms such as Listeria species and members of Bacteroides fragilis group. It is based on the ability of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Ethanol Metabolism - Steps, Factors, Enzymes, Importance
What is Ethanol Metabolism? Definition of Ethanol Metabolism Ethanol metabolism is the biological process by which the body breaks down and eliminates ethanol, primarily in the liver, through a series of enzymatic reactions that convert it into less toxic compounds, ultimately producing energy and releasing water and carbon dioxide. Location of Ethanol Metabolism Distribution of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Ethanol Production (Alcohol) - Ethanol fermentation
What is Ethanol? What is Ethanol (Alcohol) Fermentation? Ethanol Formula The molecular formula for ethanol is C2H6O, which indicates that it contains two carbon atoms and one oxygen atom. The hydroxyl group (-OH) at the end of the two-carbon chain is denoted by the structural formula for ethanol, C2H5OH. Properties of Ethanol Ethanol, commonly known ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Ethical Aspects of Biological Research
What is Ethical Aspects of Biological Research? Ethical considerations are of utmost importance in biological research to ensure the responsible and humane treatment of living organisms, respect for participants’ rights, and the integrity of scientific inquiry. Ethical aspects of biological research encompass various principles and guidelines that researchers should adhere to. Here are some key ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Ethidium Bromide Solution Preparation and use
Ethidium bromide is used to visualize DNA in agarose gels and in many cesium chloride gradient protocols.
Ethnobotany - Introduction, Concept, Scope and Objectives
What is Ethnobotany? Definition of Ethnobotany Ethnobotany is the scientific study of how people from different cultures use and interact with plants for purposes such as food, medicine, and rituals. It examines both traditional knowledge and cultural practices related to plants. History of Ethnobotany Concept of Ethnobotany Scope of Ethnobotany Ethnobotany in India Ethnobotany in ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Ethnobotany and Legal Aspects
In this article you will learn about Ethnobotany as a tool to protect interests of ethnic groups. Sharing of wealth concept with few examples from India. Biopiracy, Intellectual Property Rights and Traditional Knowledge. Ethnobotany is the branch of science which deals with the study of how different plants are used by indigenous people for their ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Ethology (Animal Behaviour) Introduction, History
What is Ethology? Definition of Ethology Ethology is the scientific study of animal behavior in natural conditions, focusing on understanding behavior as an evolutionary adaptation. History of Ethology The history of ethology is a fascinating journey that has shaped our understanding of animal behavior and its evolutionary roots. Charles Darwin, renowned for his groundbreaking work ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Eubacteria - Definition, Structure, Characterisitcs, Types, Examples
What is Eubacteria? Definition of Eubacteria Eubacteria, also known as true bacteria, are prokaryotic microorganisms that belong to the domain Bacteria. They are single-celled organisms lacking a nucleus, with DNA organized in a single circular chromosome. Eubacteria can be gram-negative or gram-positive and have economic, agricultural, and medical significance. Examples include E. coli, Lactobacilli, and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Euglena - Definition, Characteristics, Structure, Reproduction, Importance
What is Euglena? Euglena is a unicellular microscopic organism which belongs to the group of protists and it shows the characteristics of both plant and animal. It is generally found in fresh water bodies like ponds lakes and marshy places. It is a eukaryotic organism and the cell contains nucleus and other membrane bound organelles. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Euglena Eyespot - Definition, Function, Types, Structure, Proteins
Eyespot help in cell’s phototaxis, it senses the intensity and direction of light source and responds to it. In response, it helps the organism in swim towards the light (positive phototaxis), or away from it (negative phototaxis).
Euglena Under The Microscope
What is Euglena? Requirements for Microscopy of Euglena Under The Microscope With these simple yet indispensable requirements, the microscopic realm of Euglena can be unlocked. By skillfully preparing a well-mounted slide with a carefully placed cover slip, the compound microscope becomes a portal to the hidden wonders of the single-celled organisms. The dropper serves as ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Eukaryotic Cell - Definition, Structure, Functions, Examples
What is Eukaryotic Cell? Definition of Eukaryotic Cell A eukaryotic cell is a type of cell characterized by a membrane-bound nucleus and the presence of various organelles within its cytoplasm, distinguishing it from prokaryotic cells which lack a true nucleus. Eukaryotic cells are found in organisms such as plants, animals, fungi, and many unicellular entities. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Eukaryotic DNA Replication - Definition, Steps, Singnification
Have you ever wondered how your body creates new cells? Or how genetic information is passed down from one generation to the next? The answer lies in a fascinating process called DNA replication. In this article, we’ll dive deep into the world of eukaryotic DNA replication, exploring its intricacies, importance, and the cutting-edge research surrounding ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Eukaryotic Gene Regulation - Mechanisms, Regulatory Elements
Eukaryotic gene regulation is a fundamental aspect of molecular biology that plays a critical role in the expression of genes within eukaryotic cells. This intricate system governs when, where, and how much specific genes are expressed, which is essential for the proper development and functioning of organisms, ranging from unicellular protozoa to complex multicellular organisms, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Eukaryotic Transcription
Although the procedure of synthesis of RNA is the same in prokaryotes as well as eukaryotes however, the process is much more complicated in eukaryotes. In eukaryotes it is possible to synthesize RNA in the nucleus.
Eutrophication - Definition, Causes, Types, and Effects
What is Eutrophication? Definition of Eutrophication Eutrophication is the process in which a water body becomes overly enriched with nutrients, leading to the excessive growth of algae and plankton. This often results in the deterioration of water quality, depletion of oxygen, and ecological imbalances in the affected ecosystem. Causes of Eutrophication – What causes eutrophication? ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Evidences of Evolution
What is Evolution? Evolution is a fundamental biological process that describes the changes in the inherited characteristics of populations of organisms over successive generations. It is the process by which species have emerged, diversified, and adapted to their environments over millions of years. At its core, evolution is driven by the following key concepts: Evolution ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Evolution - Definition, Types, Advantages, Examples
What is Evolution? Definition of Evolution Evolution is the process by which species change over time through the gradual accumulation of genetic variations, driven by mechanisms like natural selection, genetic drift, and mutation, leading to the development of new traits or species. Evolution Theory The theory of evolution explains how species change over time through ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Evolution of Parazoa and Metazoa
Origin of Parazoa Choanoflagellate: Link to sponges Sponges’ internal chambers are bordered by a series of specialised cells known as choanocytes (choano = collar; cyte =cell). These are the cells that feed sponges. Each choanocyte, like choanoflagellates, possesses a collar of tentacles enclosing a single anterior flagellum. By undulating dozens of flagella, choanocytes generate a ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Excretion in Annelida - Nephridia
Excretion in Annelida What is nephridia? Nephridia are specialized excretory structures found in many invertebrates, including annelids, that play a crucial role in eliminating metabolic wastes and maintaining osmotic balance. These tubular organs function similarly to kidneys in higher animals, facilitating the removal of waste products and regulating internal fluid composition. In annelids, such as ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Excretory System and Osmoregulation in Fish
Structure of The Kidney The kidney serves as a vital organ in the excretory system of many animals, functioning to filter waste from the bloodstream and regulate fluid balance. While mammalian kidneys are more complex than their fish counterparts, understanding their structure and function provides insight into their crucial role in maintaining homeostasis. Functions of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Excretory System of Earthworm
The earthworm, a vital detritivore in soil ecosystems, possesses a sophisticated excretory system that plays a pivotal role in waste elimination and osmoregulation. This system is primarily composed of specialized tubular structures known as nephridia. Originating from the ectoderm, nephridia are analogous to the kidneys observed in vertebrates, serving as the primary excretory organs in ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Exocrine Glands - Definition, Structure, Functions, Types, Examples
What is Exocrine gland? Definition of Exocrine gland An exocrine gland is a gland that releases its secretions through ducts onto epithelial surfaces outside of the body. Characteristics of Exocrine Glands Exocrine glands possess several characteristics that distinguish them from other types of glands in the body. Here are some key characteristics of exocrine glands: ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Exocytosis - Definition, Types, Steps, Examples
Exocytosis is a type of process, in which involves the movement of materials from the inside of a cell to the exterior of the cell by the use of energy.
Exon - Definition, Types, Structure, Functions
What are exons? The history of the term “exon” dates back to 1978 when Walter Gilbert, an American biochemist, introduced the concept. Gilbert proposed a new perspective on the structure of genes, suggesting that the traditional idea of a cistron should be replaced by a transcription unit consisting of regions that would be lost from ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Experimental Group - Definition, Importance, Examples
What is Experimental Group? Definition of Experimental Group The experimental group, in scientific research, refers to the group subjected to specific changes or treatments in a variable to observe and evaluate potential outcomes, in contrast to a control group which remains unaltered or standardized for comparison. How Does an Experimental Group Work? In the context ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Experiments on DNA - Watson and Crick, Griffith, Chargaff, Hershey and Chase, Avery, McCarty, and MacLeod
Many individuals believe that in the 1950s, American biologist James Watson and English physicist Francis Crick discovered DNA. In actuality, this is not true. DNA was discovered by the Swiss chemist Friedrich Miescher in the late 1860s. Then, in the decades that followed Miescher’s discovery, other scientists, notably Phoebus Levene and Erwin Chargaff, conducted a ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Expressing Cloned genes in Animal cells and its Applications
Animal cells are ideal for recombinant protein production because they possess the ability to carry out post-translational modifications, a process that is often lacking in bacterial cells. This capability makes animal cells essential for the commercial synthesis of various biological products, including antibodies, hormones, growth factors, cytokines, and viral coat proteins, which are used in ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Expression of MHC Molecules
1. The SXY–CIITA Regulatory System 2. TNF- And IFN-Induced Expression Of Mhc Class I 3. Expression Of Mhc Class Ib Genes 4. Other Regulatory Pathways Governing Mhc Class II Gene Expression
External Morphology of Insects - Head, Eyes, Antennae, Mouth parts, Wings, Legs
The morphology of insects encompasses their structural features, including body shape, size, and arrangement of various parts. Insects possess a three-part body plan consisting of the head, thorax, and abdomen. Insects also exhibit a variety of appendages and surface modifications that serve specific functions, such as camouflage, locomotion, and sensory perception. Their exoskeleton, made of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Extinction - Background extinction, Mass extinction
What is Extinction? What is Background extinction? Factors Involved in Background Extinction Background extinction, the natural rate of species loss throughout Earth’s history, is influenced by various factors that shape the delicate balance of ecosystems. While not as sensational as mass extinctions, background extinction occurs gradually as species struggle to adapt to environmental changes. Understanding ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Extra-embryonic Membranes in Chick - Definition, Types, Development, Functions
What is Extra-embryonic Membranes? Types of Extra-Embryonic Membranes During chick development, four types of extra-embryonic membranes are formed: Each of these extra-embryonic membranes is composed of two germ layers. The amnion and chorion consist of the extra-embryonic ectoderm and the somatic layer of mesoderm, collectively known as the somatopleure. On the other hand, the yolk ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Extremophiles - Definition, Classification, Examples
Extremophiles Definition Importance in Research Classifications of Extremophiles There are numerous types of extremophiles found all over the world, and each corresponds to the manner in which its environmental niche differs from mesophilic circumstances. These categories are not exhaustive. Many extremophiles are characterised as polyextremophiles because they belong to many groups. Thermococcus barophilus, for instance, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Extremophiles - Microbiology of Extreme Environments Definition, Types, Examples
Microbiology of extreme environments focuses on the study of microorganisms that are capable of surviving and thriving in these harsh and inhospitable conditions. These microorganisms have evolved unique adaptations that allow them to withstand extreme temperatures, pressures, pH levels, salinity, and radiation exposure. Here are some key points about the microbiology of extreme environments: Studying ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Extrinsic Pathway of Apoptosis - Definition, Mechanism, Functions, Regulation
The extrinsic pathway of apoptosis is a process whereby cells initiate programmed cell death in response to external signals, such as those from neighbouring cells or the immune system. This route is activated by the binding of particular ligands to cell surface death receptors, such as tumour necrosis factor (TNF) or Fas ligand. The binding ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Eye and Ear Microbiome - Normal Flora of Eye & Ear
What is Eye and Ear Microbiota (Microbiome) or Normal Flora of Eye & Ear? Normal Flora of the Ear Microorganism Type Category Staphylococcus spp. Gram-positive Bacteria Alloiococcus otitis Gram-positive Bacteria Corynebacterium spp. Gram-positive Bacteria Microbacterium spp. Gram-positive Bacteria Bacillus spp. Gram-positive Bacteria Arthrobacter spp. Gram-positive Bacteria Turicella otitidis Gram-positive Bacteria Micrococcus spp. Gram-positive Bacteria Moraxella ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Facilitated Diffusion - Definition, Principle, Examples
What is Facilitated Diffusion? Facilitated diffusion Definition Facilitated diffusion is a passive transport process in which specific molecules move across a biological membrane with the aid of specialized transmembrane proteins, following their concentration gradient without the direct use of energy. Principle of Facilitated diffusion – How does facilitated diffusion work? The principle of facilitated diffusion ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Facilitated Diffusion vs Active transport
What is Facilitated Diffusion? Facilitated diffusion is a specialized mechanism of passive transport across biological membranes. Unlike simple diffusion, which allows molecules to move freely based on their concentration gradients, facilitated diffusion employs specific transmembrane proteins to assist in the transport of molecules or ions. This process is spontaneous and does not necessitate direct energy ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Factor affecting bacterial growth
In the context of human beings,”growth” is a reference to the increase in size; as an example changing from a tiny newborn to a huge adult. While bacteria can grow in size prior to the division of cells, growth in bacteria is a term used to describe increasing the amount of organisms, instead of the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Factors Affecting Fermentation Characteristics of Starter Cultures
Many variables can affect the fermentation process of lactic acid bacteria (LAB) starters, including temperature, pH, strain capability, growth medium, inhibitors, bacteriophage, incubation period, heat treatment of milk, etc. To achieve the best activity of lactic acid bacteria during the manufacturing of fermented milks, caution is required. The following parameters significantly affect the growth and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Factors affecting the growth of microorganisms in food
Foods that are both animal and plant source play a significant role in the development of microbial communities. The ability of microorganisms develop or multiply in such food is contingent on the environment.
Factors Affecting The Growth Of Microorganisms In Foods
Interactions between microorganisms, animals, and plants are constant and natural. The ecological function of microorganisms and their role in the various biochemical cycles of nature are clearly documented. The human food supply is primarily composed of animals and plants or products that are derived from them, it's reasonable to assume that the food we consume may contain microorganisms that interact with food.
Factors Of Ecosystem - Definition, Types
Ecological factors are environmental elements that have an effect on organisms and contribute to their distinctive behavioral patterns. These causes create dynamic population or species shifts in a certain geographical location. Types of Ecological Factors Abiotic Factors Abiotic elements are non-living components of an organism’s surroundings. A biotope is a habitat characterised by a certain ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Factors That Affects Enzyme Activity
What is Enzyme? Factors That Affects Enzyme Activity Enzyme activity, a crucial aspect of biological processes, is influenced by several key factors that dictate the rate and efficiency of enzymatic reactions. Understanding these factors is vital for comprehending the intricacies of enzyme functioning. Let us delve into the six main factors that affect enzyme activity: ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Fasciola hepatica - Definition, Structure, Reproducation, Life Cycle
Fasciola hepatica – Classification Kingdom Animalia Phylum Platyhelminthes Class Trematoda Subclass Digenea Order Echinostomida Genus Fasciola Species hepatica Fasciola hepatica General Characteristics Habitat of Fasciola hepatica Hosts of Fasciola hepatica History and distribution of Fasciola hepatica Epidemiology of Fasciola hepatica Morphology of Fasciola hepatica/Structure of Fasciola Hepatica Shape, Size and Colour External Morphology Internal Morphology The architecture of F. hepatica’s body ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Fascioliasis: Causative agent, Life cycle, Symptoms, Treatment.
Fascioliasis is an infectious disease caused by Fasciola parasites, which are flatworms referred to as liver flukes. The adult (mature) flukes are found in the bile ducts and liver of infected people and animals, such as sheep and cattle. In general, fascioliasis is more common in livestock and other animals than in people.
Fasciolopsis Buski - Morphology, Life Cycle, Pathogenicity, Diagnosis, Prophylaxis and Treatment
What is Fasciolopsis Buski? History and Distribution of Fasciolopsis Buski Its discovery dates back to the mid-19th century and its distribution spans several regions in Asia, where it continues to be a health concern. Habitat of Fasciolopsis Buski Its habitat is closely tied to regions where aquatic plants, freshwater, and specific snail species coexist, making ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
FASTA - Definition, Programs, Working, Steps, Applications
What is FASTA format? FASTA format is a text-based format commonly used for representing nucleotide or protein sequences. It is named after the FASTA software package, which introduced this format. The FASTA format is widely used in bioinformatics and genomics for storing and exchanging sequence data. FASTA file looks like: A typical FASTA file consists ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Fate Map - Definition, Construction and Applications
What is Fate Map? A fate map is a diagram or representation of an egg or blastula that depicts the expected fate or destiny of each cell or region at a later stage of development. Fate maps are indispensable tools in embryological experiments as they provide researchers with valuable information about the normal developmental outcomes ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Fate of Pyruvate - Acetyl CoA, Lactate, Alcohol Formation
The fate of pyruvate is the different metabolic pathway in which pyruvate can enter after it is formed at the end of glycolysis. It is the process that depend on the presence or absence of oxygen in the cell environment. In aerobic condition, pyruvate is moved into the mitochondria where it is converted into Acetyl-CoA, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Fatty acid - Definition, Structure, Types, Functions
What is Fatty acid? Fatty acids are essential components in biochemistry, playing significant roles in various biological processes. These carboxylic acids consist of an aliphatic chain, which can be either saturated or unsaturated. In nature, most fatty acids have a straight chain with an even number of carbon atoms, ranging from 4 to 28. They ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Feedback Inhibition - Definition, Process, Functions, Examples
What is Feedback Inhibition? Definition of Feedback Inhibition Feedback inhibition is a cellular regulatory mechanism in which the end product of a biochemical pathway inhibits the activity of the first enzyme in that pathway, preventing overproduction of the end product. Enzymes, Substrates, and Products Process of Feedback Inhibition Feedback inhibition, a cardinal regulatory mechanism within ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Feedback Mechanism - Definition, Types, Mechanism, Examples
What is Feedback mechanism? Definition of Feedback mechanism A feedback mechanism is a regulatory system within a process or organism that responds to changes by either amplifying (positive feedback) or counteracting (negative feedback) them to maintain equilibrium or homeostasis. Open and Closed-Loop Feedback Mechanisms Feedback loops are integral components in the maintenance of homeostasis within ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Feeder Pathway - Pathways, Mechanism, Importance
Feeder pathway is the metabolic process in which different non-glucose carbohydrates are changed into intermediates that can enter glycolysis. It is the process that allows fructose, galactose, mannose and stored polysaccharides like glycogen to be converted into common glycolytic compounds. These intermediates then move into the normal glycolytic steps for further breakdown. In this pathway ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Fehling's Test - Principle, Procedure, Result
This test also can differentiate between ketone functional groups and water-soluble carbohydrates.
Fermentation - Definition, Types, Principle, Products, Stages, Limitations
Fermentation is among the oldest techniques for processing food. The term "fermentation" refers to a procedure where chemical changes take place in organic substrates through the action of enzymes created by microorganisms. For instance yeast enzymes transform starches and sugars into alcohol, and proteins are transformed into peptides or amino acids. The fermentation process takes place without oxygen which produces ATP (energy).
Fermentation Foods - Bread
In breadmaking, microorganisms are useful in two primary ways: (1) they can produce gas to leaven the dough, giving it the desired loose, porous texture, and (2) they can produce flavorful substances. They may also play a role in dough conditioning. Leavening Leavening by Bread Yeasts Leavening by Other Microorganisms Leavening by Chemicals Continuous Breadmaking ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Fermentation Foods - Malt Beverages
Beer and ale are the most widely produced and consumed malt beverages in this country, and they will be explored here. They are constructed from malt, hops, yeasts, water, and malt adjuncts. Malt is produced from germinated and dried barley grains that have had their sprouts or germs removed. The dried blooms of the hop ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Fermentation Foods - Vinegar
At normal temperatures, the normal progression of changes in fruit juices is alcoholic fermentation by yeasts, followed by oxidation of the alcohol to acetic acid by acetic acid bacteria. When enough acetic acid is created, vinegar is the result. Vinegar is a condiment produced from sweet or starchy sources through alcoholic fermentation followed by acetic ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Fermentation Foods - Wines
Unless otherwise indicated, the term wine refers to the beverage produced by the alcoholic fermentation of grapes or grape juice by yeasts, followed by ageing. However, wines can be prepared by fermenting the juices of fruits, berries, rhubarb, dandelions, and honey, among others. Grape Wine The majority of grape wines are either red or white. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Fermentation Media - Media Used For The Growth of Microorganisms in Industries
What is Fermentation media? For a good output of product during a fermentation process, the selection of the optimal microorganisms and fermentation media is crucial. As it provides nutrients and energy for the growth of microorganisms, the quality of fermentation media is vital. This medium serves as a substrate for the production of a product ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Fertilization - Changes in Gametes, Monospermy and Polyspermy
Special features of the gametes for fertilization Both gametes, the sperm and the egg, possess special features that enable successful fertilization. Egg: Sperm: In summary, the egg and the sperm possess specialized features that are essential for fertilization. The egg has protective coverings, recognition mechanisms, and cortical granules to prevent polyspermy and ensure compatibility with ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Fertilization - Definition, Types, Process
Fertilization Definition External and Internal Fertilization Fertilizin and Antifertilizin Fertilizin Antifertilizin Process of Fertilization The two sequential steps of the fertilisation process are as follows: 1. The egg’s activation; 2. The amphimixis. 1. Activation of the Egg The process of activation of eggs is completed in following stages : (i) Movement of the sperm towards ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Filtration - Definition, Mechanisms, Types, Examples, Application
What is Filtration? Filtration is utilised to separate a dispersion based on particle size. The filtered mixture is put to an appropriate porous material filter. Particles smaller than the filter’s pores can pass through and enter the filtrate, while larger particles are retained on the filter’s surface. Filtration is a process that is used to ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Filtration Sterilization - Types, Mechanism, Uses
Filtration is the most popular method to sterilize heat sensitive liquid and gases, without exposure to denaturing temperatures. Instead of killing microorganisms that cause contamination the process simply eliminates them. It is the process of choice to sterilize chemical solutions for antibiotics radioisotopes, toxic chemicals or vaccines, as well as carbohydrates, all of which are ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Fimbriae and Pili - Definition, Structure, Types, Functions, Differences.
Fimbriae and pili are interchangeable words employed to indicate short, hair-like structures on the outsides of procaryotic cells. Same as flagella, they are made of protein. Fimbriae are smaller and harder as compared to flagella, and lightly smaller in diameter. They emerge from the bacterial cell surface and involved in different functions such as adhesion, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Fish Aquarium - Components, Contents, Preparation and Maintenance
What is an Aquarium? Types of Aquarium An aquarium can be categorized based on its purpose, size, and the type of aquatic life it contains. Below are the primary types of aquariums, explained in detail: Major Aquarium Accessories Aquarium accessories are essential to maintaining a balanced and healthy environment for aquatic life. These tools and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Fish Diseases - Bacterial, Viral and Parasitic
Fish diseases encompass a broad spectrum of health issues that can significantly impact the well-being, growth, and survival of various fish species. These diseases can arise from multiple types of pathogens, including bacteria, viruses, fungi, and parasites, as well as environmental stressors. Bacterial diseases, caused by organisms such as Aeromonas, Vibrio, and Edwardsiella, often manifest ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Fish Fins - Structure, Types, Functions
What are Fish Fins? Origin of Fins The origin of fish fins has long fascinated biologists and paleontologists, as it provides insight into the evolutionary trajectory of vertebrates. Although the earliest chordates did not possess paired appendages, it is widely accepted that tetrapod limbs evolved from the fins of ancestral fish. However, the precise mechanisms ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Fish Preservation and Processing Methods and Steps
Fish is a vital protein source that requires meticulous handling to maintain its quality and safety. This necessity arises from fish’s susceptibility to spoilage, particularly in warm tropical climates, where high temperatures expedite the activities of bacteria, enzymes, and the oxidation of fats. In regions such as Nigeria, inadequate handling has resulted in significant losses, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Fisheries - Definition, History, Inland, Marine, Factors influencing, Importance
What is Fisheries? History of Fisheries The history of fisheries has evolved alongside human civilization, with evidence suggesting that fish were a crucial resource as early as the Old Stone Age. Fisheries have grown from basic hunting and preservation methods to a complex science that combines multiple disciplines for efficient fish cultivation and sustainable resource ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Fishery By-products - Examples, Uses
Fishery by-products refer to the various materials derived from fish processing that are not intended for direct human consumption but have significant value in various industries. These by-products include fish meal, fish oil, fish skin, bones, and other remnants that arise during the cleaning and filleting of fish. They play a crucial role in waste ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Fishing Crafts And Gears - Definition, Types, Examples
Fishing crafts and gears are integral components of the fishing industry, facilitating the capture of aquatic species across various environments. Fishing crafts, which include boats, skiffs, and canoes, are specifically designed to navigate diverse water bodies, ranging from freshwater lakes to expansive ocean waters. These vessels vary in size, shape, and construction materials, reflecting the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Flagella - Definition, Structure, Types, Functions, Rotation, Examples
What is Flagella? Definition od Flagella Flagella are slender, whip-like appendages extending from certain cells, primarily serving the purpose of motility and, in some organisms, functioning as sensory organelles. They are found across various organisms, from bacteria and archaea to eukaryotic cells. Types of Flagella Flagella, whip-like appendages found in various organisms, play a pivotal ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Flagella Staining - Principle, Procedure, Result
Flagella can not be seen under a bright-field microscope by using ordinary stains. A simple and useful method has been used for visualization of flagella is known as wet mount technique.
Flagellar Movement Mechanisms and Chemotaxis.
Flagellar movement, or locomotion helps in the movement of motile bacteria. Bacteria do not drift aimlessly, they move either towards nutrients (sugars and amino acids) or away from toxic substances such as bacterial waste products. When a bacterial cell moves towards a chemical substance or away from repellents is called chemotaxis. Motile bacteria additionally can ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Flame Photometer - Principle, Parts, Procedure, Applications
What is Flame Photometer? Principle of Flame photometer The flame photometer is based on the principle that alkali and alkaline earth metal atoms are excited in the flame and that the light emitted when the excited atoms revert to the ground state can be measured. When you introduce a sample containing metal compounds into a ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Flash chromatography - Principle, Instrumentation, Protocol, Applications
What is Flash chromatography? Principle of Flash column chromatography Flash column chromatography equipment Flash chromatography General consist of following parts 1. Pump Systems Type of pump There are different types of pumps commonly used in flash chromatography systems, each offering specific capabilities and functionality. Here are some notable types of pumps: The selection of a ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Flora vs Fauna - Differences between Flora and Fauna
The term "flora" can be understood as the naturally found native plants in one particular area. Flora refers to all kinds of life in the plant kingdom, but is typically used to describe the vegetation of an area.
Floriculture - Definition, Importance, Scope
What is Floriculture? Definition of Floriculture Floriculture is a branch of horticulture that focuses on the cultivation, management, and marketing of flowering and ornamental plants, including flowers, foliage, and other decorative plants, for use in gardens, landscaping, and the floral industry. Importance and uses of floriculture Floriculture plays a crucial role in various sectors due ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Flow Cytometry - Principle, Process, Uses
What is Flow cytometry? Flow cytometry Instrumentation Flow cytometry Principle Information Obtained from Flow cytometry The flow cytometer has various clinical and scientific applications. The determination of the type and amount of white blood cells in blood samples is a typical clinical application. By treating properly processed blood samples with a fluorescently tagged antibody and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Flow Cytometry - Types, Purpose, Reagents, Examples, Application
What is Flow Cytometry? Definition of Flow cytometry Flow cytometry is a laser-based technology used to analyze and measure physical and chemical characteristics of cells or particles in a fluid mixture. It provides rapid and quantitative information about cell size, complexity, and fluorescence intensity, enabling various applications in research and clinical settings. Purpose of flow ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Flower Culture - Principle, Protocol and Importance
What is Flower Culture? Principle of Flower Culture Protocol of Flower Culture The protocol outlined below provides a systematic approach for the successful culture of flower buds or mature flowers, ensuring optimal growth and minimizing contamination. Importance of Flower Culture Below are key aspects highlighting the importance of flower culture:
Fluid Mosaic Model of Plasma Membrane
What is Fluid Mosaic Model of Plasma Membrane? – Fluid Mosaic Model Definition The fluid mosaic model is one method to comprehend biological membranes, consistent with the majority of experimental findings. According to this hypothesis, membrane components such as proteins and glycolipids form a mobile mosaic in the fluid-like environment formed by a sea of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Fluorescence Microscopy - Principle, Parts, Uses
Fluorescence microscope is an advanced optical microscope that uses fluorescence for viewing the specimen. It produces a bright coloured image of the specimen in a dark background. It is mostly used for biological and chemical samples where a specific part of the sample is to be seen clearly. In this microscope, fluorescent dyes, proteins or ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Fluorescence Spectrophotometry - Principle, Parts, Advantages, Uses
Fluorescence spectrometry is an analytical technique that is used to measure the light emitted by a substance after absorption of electromagnetic radiation. It is also known as fluorimetry. It is a very sensitive method for detecting small amount of substance. In this method, the sample is first exposed with a particular wavelength of high energy ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Folin-Wu Method For Estimation of Blood Glucose - Principle, Procedure
What is Folin-Wu Method? Folin-Wu method is a old colorimetric method which is used for estimation of glucose in blood. It was developed in 1919 by Otto Folin and Hsien Wu. It is based on oxidation-reduction reaction. The blue colour is produced and this colour intensity is measured for glucose level. In this method the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Food Chain - Definition, Types, Parts, Examples
What is a Food Chain? A food chain refers to the sequence of events in an ecosystem in which one living organism consumes another, which is then consumed by a larger organism. A food chain is the movement of nutrients and energy from one creature to another at different trophic levels. Features of Food Chain ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Food Irradiation - Definition, Symbol, Process, Applications, Disadvantages
What is irradiation in food? Food irradiation definition Food irradiation refers to the process of exposing food and its packaging to ionizing radiation, such as gamma rays, x-rays, or electron beams. This method is used to improve food safety and extend the shelf life of products by effectively destroying microorganisms responsible for spoilage and foodborne ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Food Microflora - Molds
What are Molds? Morphological Characteristics of Molds In their classification and identification, they are based on their morphology (i.e. their form and structure as determined by their microscopic and macroscopic appearance). 1. Hyphae and Mycelium of Molds 2. Reproductive Parts or Structures of Molds (a) Asexual Spores of Molds (b) Sexual Spores of Molds These ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Food Poisoning by Bacillus cereus - Foodborne Toxins
What is Bacillus cereus? Bacillus cereus is a pathogenic bacterium known for causing food-borne illnesses. Here is information about Bacillus cereus: Biological characteristics of Bacillus cereus Bacillus cereus possesses specific biological characteristics that contribute to its survival and potential to cause illness. Here are the key characteristics of Bacillus cereus: Sources of contamination Bacillus cereus ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Food poisoning by Listeria monocytogenes - Listeriosis
What is Listeriosis? Listeriosis, also known as listeria infection, is a foodborne illness caused by the bacterium Listeria monocytogenes. It is a significant cause of foodborne illnesses worldwide. Here are some key points about listeriosis: It is important to note that the information provided here is a general overview of listeriosis. For specific guidance and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Food Preservation - Chemical Preservatives with Types, Examples
What are Chemical preservatives? How Foods Get Chemical Preservatives? Food can acquire chemical preservatives through various means: Role of chemical preservatives Chemical preservatives play a crucial role in food preservation by performing several functions: Classification of chemical preservatives Chemical preservatives can be classified into different categories based on their nature and origin. Here are three ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Food Preservation by chemicals - Food Additives
What are food additives? According to the Food Safety Standard Authority of India (FSSAI). Food additive may be defined as any substance not normally consumed as a food by itself or used as a typical ingredient of the food, whether or not it has nutritive value, the intentional addition of which to food for a ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Food Preservation by Irradiation
Food radiation (the process of applying ionizing radiations to food items) is a technique that enhances the safety and prolongs the shelf-life of food by eliminating or reducing pests and microorganisms. As with pasteurizing milk, and making preserves for vegetables and fruits radiation could make food safer for consumers.
Food Preservation By Low Temperatures
Low temperatures are employed to stop chemical reactions and the action of enzymes in food and to stop or slow the development and activities of microorganisms found in food items.
Food Preservation by Using High Temperatures
The utilization of high temperatures to preserve food items is based on their damaging effects on microorganisms as well as their spores.
Food Preservation method by Low Temperature - Refrigeration, Chilling, Freezing
Food preservation through low-temperature treatment is a widely used and effective method to extend the shelf life of various food products while maintaining their quality. By carefully managing temperature during handling, transportation, and storage, both physical and biological deteriorations can be controlled, ensuring that the food remains fresh for a longer period. Low-temperature treatment involves ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Food Spoilage General Principles - Chemical Changes Caused by Microorganisms
When food is called "spoiled", it usually means that there is decay or decomposition of an unfavorable nature. Foods unfit for consumption are not considered spoiled. Spoiling could be caused by one or more of these:
Food Technology, Bioengineering and Bioreactor
What is Bioengineering? Bioengineering and Bioreactor Calculating the Reaction Rate To calculate the reaction rate of the fermentation of sucrose to ethanol and carbon dioxide, we can use the balanced chemical equation and the stoichiometry of the reaction. The balanced chemical equation for the fermentation of sucrose is: C12H22O11 (aq) + H2O (l) → 4C2H5OH ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Food Vacuole - Definition, Types, Formation, Structure, Functions
What is Food Vacuole? Definition of Food Vacuole A food vacuole is a membrane-bound organelle found in certain cells, especially protozoan microorganisms, that encloses and digests ingested nutrients using digestive enzymes, subsequently releasing the digested molecules into the cytoplasm for cellular utilization. Structure Of Food Vacuole The food vacuole, a specialized cellular compartment, is characterized ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Food Web - Definition, Types, Examples
What is Food Web? Definition of Food Web Characteristics of the food web Trophic Levels in a Food Web Energy Flow Types of Food Webs There are different kinds of food webs that differ in how they are put together and what they show or stress about the organisms in the ecosystem they show. Scientists ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Foodborne Giardiasis - Definition, Pathogenesis, Contamination
What is Foodborne Giardiasis? Characteristics of Giardia Giardia is a genus of microscopic, single-celled parasites that can cause the infection known as giardiasis. Here are some characteristics of Giardia: Overall, Giardia is a highly adaptable and resilient parasite that can cause a range of symptoms in humans and animals. By practicing good hygiene and food safety ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Foodborne Infection by Shigella - Shigellosis Food Poisoning
What is Shigella infection? Biological characteristics of Shigella Shigella bacteria possess several distinctive biological characteristics that contribute to their ability to cause infection and survive in various environments. Here are the key biological characteristics of Shigella: Sources and transmission of Shigella infection Epidemiology of Shigella infection The epidemiology of Shigella infection provides insights into the historical background, transmission dynamics, and global burden of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Foodborne Microorganism - Bacteria
To identify bacteria in food, microscopic examination is the first step. It can determine the structure, shape, size, aggregation and staining reactions. These characteristics could be particularly important.
Foodborne Microorganism - Yeasts
The term "yeast", which is similar to mold, is often used, but it can be difficult to define. It refers to fungi that are not filamentous, but unicellular, ovoid, or spheroid, and can reproduce by budding and fission. Yeasts can be beneficial or harmful to foods. Yeast fermentations play a role in the production of bread, wine, vinegar, and surface-ripened dairy products. Yeasts can be grown for enzymes or for food. When yeasts cause spoilage in sauerkraut, fruit juices and sirups as well as honey, jellies, meats and wine, they are considered undesirable.
Foodborne Viruses - Definition, Examples, Detection, Prevention
What are foodborne viruses? Foodborne viruses are those that can be contracted by eating or drinking contaminated food or water. They can withstand extremes in temperature and humidity as well as hostile conditions like low pH (acidity). Because of this, they can survive infectively in food and water for much over a month. These viruses ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Forest Ecosystem - Definition, Types, Functions
What is Forest Ecosystem? Types- Forest Ecosystem 1. Coniferous Forest (Boreal Forest) 2. Temperate Deciduous Forest 3. Temperate Evergreen Forest 4. Tropical Rainforests 5. Temperate Rainforests 6. Subtropical Rainforests 7. Tropical Seasonal Forests 8. Tropical Evergreen Rainforest 9. Tropical Deciduous Rainforest 10. Taiga/Boreal 11. Mixed Forests 12. Mediterranean Forests Components of Forest Ecosystem A. Abiotic ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Formation and Fate of Germ Layers
What is Germ layer? Fate of The germ layers 1. Ectoderm 2. Mesoderm 3. Endoderm 4. Neural crest Formation of Three Germ Layers (i) Formation of Endoderm (ii) Formation of Mesoderm (iii) Formation of Ectoderm FAQ
Fossils - Definition, Types, Formation, Dating, Examples
What is Fossils? Definition of Fossils Fossils are the preserved remains or traces of ancient organisms that provide evidence of past life on Earth. Types of Fossils Fossils come in various forms, providing valuable insights into the past life on Earth. Here are some of the different types of fossils: Furthermore, fossils can be classified ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Four Types of Protein Structure With Diagram - Primary, Secondary, Tertiary and Quaternary
Proteins, as complex biological molecules, play an essential role in the myriad of processes in living organisms. Consisting of amino acids, proteins can be envisioned as polypeptide structures formed through long chains of these amino acid residues. Therefore, it’s not surprising that they are one of the most abundant organic molecules present in living beings. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Fragmentation - Definition, Steps, Importance, Advantages, Disadvantages
What is Fragmentation? Definition of Fragmentation Fragmentation is a form of asexual reproduction in which an organism or part of it breaks into smaller pieces, each capable of developing into a fully mature individual. General Steps of Fragmentation Fragmentation is a pivotal biological process characterized by its systematic progression through distinct stages. This method of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Frameshift Mutation - Definition, Types, Causes, Examples
What is Frameshift Mutation? Definition of Frameshift Mutation A frameshift mutation is a genetic alteration caused by the insertion or deletion of nucleotides in a DNA sequence, which shifts the reading frame of codons and results in the production of an altered and typically nonfunctional protein. Causes of Frameshift Mutation The main causes of frameshift ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Frank-Starling Law of the heart
What is Frank-Starling Law? Mechanism of the Frank-Starling mechanism The mechanism underlying left ventricular performance is intricately linked to the Frank-Starling Law, which establishes the relationship between preload and cardiac output. This relationship can be observed through the Frank-Starling curves, which depict how variations in left ventricular end-diastolic volume (EDV) or pressure influence stroke volume ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Frederick Griffith Experiment - Bacterial transformation
Griffith Experiment & Transforming Principle Frederick Griffith, a British bacteriologist, conducted a series of studies with Streptococcus pneumoniae bacteria and mice in 1928. Griffith was not attempting to detect genetic material; rather, he was attempting to produce a vaccine for pneumonia. Griffith utilised two strains of bacteria identified as R and S in his tests. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Freeze Fracture Technique - Principle, Protocol, Applications
What is Freeze Fracture Technique? Principle of Freeze Fracture Technique The principle of the freeze-fracture technique is based on the physical separation of biological membranes at their hydrophobic core when the sample is frozen and then fractured. Here are the key aspects of this principle: Overall, the freeze-fracture technique provides valuable insights into the functional ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Fructose Metabolism Pathway - Fructolysis
Location of Fructolysis Why does fructose metabolism or fructolysis occur in liver cells? Properties and Sources of Fructose Absorption of Fructose From Fructose to Fat/Fructolysis/fructose metabolism pathway Steps of fructose metabolism pathway 1. Step 1 2. Step 2 3. Step 3A Metabolic Pathway Notes: At this point, the liver cell can use the same steps ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Fruit and Vegetable Crops - Production, origin and distribution, Management, Identification
What are Fruit and vegetable crops? Fruit and vegetable crops refer to the plants cultivated primarily for their edible parts, which are rich in nutrients and essential for a balanced diet. Here’s a breakdown of what these crops entail: Production of fruit and vegetable crops The production of fruit and vegetable crops is a fundamental ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Funaria - Structure, Characteristics, Reproduction
Funaria is a moss you’ll often find thriving in damp, shady areas like forest floors or along stream banks. Unlike typical plants, it lacks true roots, stems, or leaves, absorbing water and nutrients directly through its surface. If you take a closer look, you’ll spot its vibrant green tufts topped with tiny, capsule-like structures—these hold ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Fungi - Definition, Characteristics, Morphology, Importance, Examples
What is Fungi? Definition of Fungi Fungi are eukaryotic organisms that include yeasts, molds, and mushrooms. They are heterotrophic, meaning they obtain nutrients by absorbing dissolved molecules from their surroundings, and they play a vital role in decomposing organic matter. Fungi are classified in the kingdom Fungi and are distinct from plants, animals, and bacteria, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Fungi: Types of Fungi and Their Reproduction.
In this article, we will learn about the Types of Fungi and Their Reproduction. There are present 5 types of fungi such as Chytridiomycota, Zygomycota, Glomeromycota, Ascomycota, and Basidiomycota. Fungi reproduce by vegetative, sexual, and asexual method. The sexual reproduction is accomplished by the mating of haploid hyphae and form a diploid spore called a ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Fusarium spp - Definition, Structure, Pathogenesis
Kingdom: Fungi Division: Ascomycota Class: Sordariomycetes Order: Hypocreales Family: Nectriaceae Genus: Fusarium Fusarium is a large genus of filamentous fungi belonging to the hyphomycetes group, which is extensively distributed in soil and closely associated with plants. The majority of species are saprobes and are relatively abundant constituents of the soil microbiome. Certain species generate mycotoxins ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Fusarium Wilt - Causes, Hosts, Symptoms, Diagnosis, Prevention
What is Fusarium Wilt? Fusarium wilt is a prevalent soil-borne fungal affliction produced by Fusarium oxysporum, affecting various plants such as tomatoes, bananas, cucumbers, and beans, resulting in progressive wilting and eventual plant mortality. Causative Agent of Fusarium Wilt Primary causal organism – Fusarium oxysporum is the dominant species responsible for Fusarium wilt across diverse ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
G Protein Coupled Receptors - Structure, Functions, and Mechanism
What are G Protein Coupled Receptors? Structure of G Protein Coupled Receptors Classification of G Protein Coupled Receptors The G protein-coupled receptor (GPCR) superfamily encompasses a vast array of receptors, with at least 831 human genes, approximately 4% of the protein-coding genome, predicted to code for GPCRs. Despite the lack of detectable shared sequence homology ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
gab Operon - Definition, Structure, Regulation
What is gab operon? Structure of gab operon There are three structural genes that make up the gab operon: Regulation of gab operon Differential Regulation of Promoters The expression of the genes in the operon is controlled by three promoters that work in different ways. Two of these promoters are controlled by the sigma factor ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Galactose (Gal) Operon - Structure, Regulation
What is Gal operon? The galactose operon is the unit in bacteria that is responsible for the metabolism of D-galactose, and it is organized with four structural genes (galE, galT, galK and galM). It is the process where these genes are required both for catabolic breakdown of galactose and for anabolic formation of compounds like ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Galactose Metabolism - Steps, Importance, Leloir Pathway
What is Galactose? Galactose is a monosaccharide sugar that is an aldohexose. It is a C-4 epimer of glucose having the same structure as glucose, except that the atoms around carbon no. 4 are arranged differently. This sugar is around 65% of the sweetness of sucrose and is less sweet. It is paired with glucose ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Gamete - Types, Formation, Functions, Examples
What is Gamete? Definition of Gamete A gamete is a haploid reproductive cell, such as a sperm or egg, that carries half the genetic material of an organism and fuses with another gamete during fertilization to form a diploid zygote, initiating the development of a new organism. Types of Gamete Gametes, or reproductive cells, are ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Gametogenesis - Definition, Types, Steps
What is gametogenesis? Gametogenesis Definition Gametogenesis is the biological process through which precursor cells undergo cell division and differentiation to form mature sex cells or gametes. Spermatogenesis 1. Formation of Spermatids Primary germinal cells or primordial cells refer to the male germinal cells that create sperm. The primordial cells undergo the following three steps in ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Gamma-ray Spectroscopy - Definition, Principle, Parts, Uses
Gamma-ray Spectroscopy is a non-destructive analytical technique used for qualitative and quantitative study of gamma-ray energy spectra. It is used to study gamma rays emitted from radioactive source. The unstable atomic nuclei emit gamma-ray photons at specific energy level. This occurs when the nuclei pass into more stable ground state. These gamma-ray emissions are different ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Gardnerella Vaginalis - Habitat, Morphology, Genome, Treatment
Domain: Bacteria Phylum: Actinomycetota Class: Actinomycetia Order: Bifidobacteriales Family: Bifidobacteriaceae Genus: Gardnerella Species: G. vaginalis What is Gardnerella Vaginalis? Gardnerella vaginalis is a micro-aerophilic coccobacillus that is a constituent of the vaginal microbiota. This bacterium, while present in the vaginal flora, does not inherently lead to bacterial vaginosis unless its populations become predominant. Contrary to some ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Gas Chromatography - Definition, Parts, Principle, Working, uses
Gas chromatography is a chromatographic technique which is used for separation and analysis of volatile substances. It is mainly used for the compounds which can be vaporized without decomposition. In this technique, the sample is injected into a heated chamber. The sample is converted into vapour and carried by an inert gas through a column. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Gas Treatment in Food Preservation Technique
What is Gas Treatment in Food Preservation? Gas treatment is a crucial tool in food preservation, utilizing different gases and their mixtures to modify or control the atmosphere surrounding food products. By doing so, the shelf life of perishable foods can be extended, preventing microbial spoilage and degradation. Here’s an overview of gas treatment as ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
GasPak Anaerobic System - Principle, Parts, Application
GasPak Anaerobic System is a self-contained airtight apparatus that is used in microbiology laboratory for cultivation of strict anaerobic bacteria. These bacteria cannot grow in presence of oxygen and need oxygen free condition for their survival and growth. The system contains a sealed jar or container in which culture plates are kept with a gas ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Gastrointestinal Amebiasis by Entamoeba histolytica
What is Gastrointestinal Amebiasis? Characteristics of Entamoeba histolytica Entamoeba histolytica is a pseudopod-forming anaerobic protozoan parasite that is responsible for causing amebiasis in humans. Here are some key characteristics of Entamoeba histolytica: Life Cycle of E. histolytica Gene Structure and Organization Cell Biology and Biochemistry Sources of contamination of Amebiasis Amebiasis can be sourced from ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
GAT-B (Biotech) - Previous year question papers Download
GAT-B (Biotech) Previous Year Question Papers Download: Strengthen your GAT-B (Biotechnology) exam preparation with previous year question papers. Download a complete set of past GAT-B question papers to familiarize yourself with the exam format, identify key topics, and enhance your problem-solving abilities. These papers provide valuable insights into the types of questions you can expect, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
GATE Biotechnology (BT) Previous Year Question Papers
Download GATE Biotechnology (BT) Previous Year Question Papers Ace your GATE Biotechnology (BT) exam with our extensive collection of previous year question papers. These past papers are essential for understanding the exam pattern, mastering key topics, and practicing time management. By revisiting questions from previous years, you can sharpen your problem-solving skills and gain valuable ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
GATE Life Sciences (XL) Previous Year Question Papers
GATE Life Sciences (XL) Previous Year Question Papers Download: Boost your GATE Life Sciences (XL) exam preparation with access to previous year question papers. Download the comprehensive collection of past GATE Life Sciences (XL) question papers to understand the exam pattern, improve time management, and enhance your problem-solving skills. These question papers cover all the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
GATE Life Sciences (XL) syllabus
Number of tests Once in a year Fellowship/ Assistantship Subject to fulfilling the admission criteria of the admitting institutes. Administering institutes IISc Bangalore and 7 IITs Organizing Institute of Exam One of the administering institutes Medium of examination English Mode of examination Computer based test (CBT) Subject papers allowed Maximum TWO Paper combinations Combination of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
GATE Syllabus for Biotechnology (BT) PDF
The Graduate Aptitude Test in Engineering (GATE) for Biotechnology (BT) 2024 encompasses a detailed and rigorous syllabus designed to evaluate the knowledge and understanding of candidates in various domains of biotechnology. The syllabus is segmented into three primary sections: General Aptitude, Engineering Mathematics, and Core Discipline, with the Core Discipline carrying the most significant weightage. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Gause’s Principle With laboratory and Field examples
Gause’s Principle, also known as the competitive exclusion principle or Gause’s law, is a fundamental concept in ecology that describes the competition between species for limited resources. It states that two species that compete for the same resources cannot coexist in the long term at constant population values. When one species has even a slight ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Gel Electrophoresis System - Definition, Principle, Parts, Types, Procedure
What is Gel Electrophoresis System? Definition of Gel Electrophoresis System Gel electrophoresis is a laboratory technique that uses a gel as a medium to separate and analyze biomacromolecules such as DNA, RNA, and proteins based on their size and charge. An electric field is applied to move the molecules through the gel, with smaller or ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Gel Filtration Chromatography - Principle, Components, Steps, Types, Application
Gel Filtration Chromatography (GFC) is a chromatographic technique used for separation of molecules on the basis of their size and shape. It is also called size exclusion chromatography when water based buffer is used for the separation. It is mainly used for separation of biological molecules like proteins, nucleic acids and polysaccharides. In this technique, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Gel Permeation Chromatography - Definition, Principle, Parts, Steps, Applications
Gel Permeation Chromatography (GPC) is a chromatographic technique used to separate polymers and other large molecules according to their size in solution. It is also known as Size Exclusion Chromatography (SEC). In this technique, the polymer sample is dissolved in a suitable solvent and then passed through a column which contains porous gel beads. These ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Gel Staining Procedure for PAGE
Staining protein gels using Coomassie Brilliant Blue R-250 is common to see proteins that are resolved using SDS-PAGE. It is extremely sensitive and suitable for long-term storage of gels.
Gelatin Hydrolysis Test - Purpose, Principle, Procedure, Result.
The gelatin proteins derived from the animal connective tissue, collagen. Gelatin is produced when collagen is boiled in water. A gelatin hydrolysis test is used to detects the presence of gelatinases. Gelatinases are extracellularly secreted by some bacteria which hydrolyze or digest gelatin.
Gene Cloning - Steps, Definition, Applications
What is Gene cloning? “DNA Cloning” is a molecular biology technique that is utilized to create exact copies, or clones, of one particular gene or DN.” History of Gene cloning Principle of Gene Cloning Requirements for Gene Cloning Restriction Enzyme Digestion and Ligation Enzyme Source Recognition Sequence Restriction Digest EcoRI Escherichia coli 5’GAATTC3’CTTAAG 5′—G↓AATTC—3’3′—CTTAA↑G—5′ ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Gene Expression and Cell Specialization - AP Biology Notes
What is gene expression, and how does it relate to cell specialization? Gene expression is a fundamental biological process through which the information encoded in a gene is utilized to produce functional products, primarily proteins. This mechanism plays a crucial role in cell specialization, often referred to as cell differentiation, wherein generic cells evolve into ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Gene Expression Profiling - Definition, Uses, Limitations
What is gene expression? What is Gene Expression Profiling? Gene Expression Profiling Definition Gene expression profiling (GEP) is a technology for identifying the genes that are active in a given sample of cells or tissue. This technique enables profiling of genes that are differentially expressed in disease states; thereby providing diagnostic and prognostic information. Tools ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Gene frequencies - Definition, Calculation, Importance
What is Gene frequencies? Gene frequencies, also known as allele frequencies, refer to the relative proportions of different alleles at a particular locus or gene within a population. They represent the prevalence or abundance of specific alleles in relation to the total number of alleles in the gene pool. Gene frequencies are typically expressed as ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Gene Interaction - Definition, Types, Examples, Importance
What is Gene Interactions? Definition of Gene Interactions Gene interactions refer to the relationships between multiple genes where the expression of one gene can influence, or be influenced by, the expression of another gene, collectively determining specific phenotypic traits in an organism. Types of Gene Interaction Gene interactions can be categorized into two primary types: ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Gene Mapping - Definition, Types, Applications
Gene mapping, also known as genome mapping or genome mapping, is an important technique used by scientists to establish the location of genes on a chromosome. It entails determining the location of a gene, quantifying the distance between genes, and establishing landmarks within the genome. Just like landmarks help us make our way around a ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Gene Pool - Definition, Types, Working, Importance, Evolution, Examples
What is Gene Pool? Definition of Gene Pool The gene pool refers to the total collection of genes and alleles present within a population of a particular species. How Gene Pools works? Factors Affecting Gene Pool Several factors can influence the composition and dynamics of a gene pool. These factors include: These factors interact and can ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Gene Prediction - Definition, Methods, Importance
What is Gene Prediction? Example Gene: A sequence of nucleotides coding for protein Gene Prediction Problem: Determine the beginning and end positions of genes in a genome atgcatgcggctatgctaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgggatccgatgacaatgcatgcggctatgctaatgaatggtcttgggatttaccttggaatgctaagctgggatccgatgacaatgcatgcggctatgctaatgaatggtcttgggatttaccttggaatatgctaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgcggctatgctaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatcctgcggctatgctaatgaatggtcttgggatttaccttggaatgctaagctgggatccgatgacaatgcatgcggctatgctaatgaatggtcttgggatttaccttggaatatgctaatgcatgcggctatgctaagctgggaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgcggctatgctaatgcatgcggctatgctaagctcatgcggctatgctaagctgggaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgcggctatgctaatgcatgcggctatgctaagctcggctatgctaatgaatggtcttgggatttaccttggaatgctaagctgggatccgatgacaatgcatgcggctatgctaatgaatggtcttgggatttaccttggaatatgctaatgcatgcggctatgctaagctgggaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgcggctatgctaatgcatgcggctatgctaagct Gene atgcatgcggctatgctaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgggatccgatgacaatgcatgcggctatgctaatgaatggtcttgggatttaccttggaatgctaagctgggatccgatgacaatgcatgcggctatgctaatgaatggtcttgggatttaccttggaatatgctaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgcggctatgctaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatcctgcggctatgctaatgaatggtcttgggatttaccttggaatgctaagctgggatccgatgacaatgcatgcggctatgctaatgaatggtcttgggatttaccttggaatatgctaatgcatgcggctatgctaagctgggaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgcggctatgctaatgcatgcggctatgctaagctcatgcggctatgctaagctgggaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgcggctatgctaatgcatgcggctatgctaagctcggctatgctaatgaatggtcttgggatttaccttggaatgctaagctgggatccgatgacaatgcatgcggctatgctaatgaatggtcttgggatttaccttggaatatgctaatgcatgcggctatgctaagctgggaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgcggctatgctaatgcatgcggctatgctaagct Bioinformatics and the Prediction of Genes Utilising computational algorithms and tools to analyse genomic data, bioinformatics plays an essential role in the prediction of genes. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Gene Silencing - Definition, Process, Techniques, Applications
Gene silencing, a mechanism of reducing or suppressing gene expression, is critical in managing gene expression in cells. Genes, which are responsible for protein production, have distinct expression spectra that determine the amount of protein produced by a gene in a specific cell type. When the expression profile of genes is altered, however, it can ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Gene Therapy - Definition, Types, Vectors, Applications
Gene therapy is a groundbreaking field of medicine that focuses on the modification of cells to treat or prevent genetic disorders by repairing or replacing defective genetic material. It holds the potential to cure a wide range of genetic diseases by directly addressing the underlying genetic abnormalities. In this series of articles, we aim to ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
General description of Fibre Yielding Plants
Fibre-yielding plants have played a crucial role in the advancement of human civilization, second only to food plants in their utility. Early humans relied on these plants to meet essential needs such as clothing, shelter, and tools. While animal products provided some solutions, plant fibers offered lighter and more flexible alternatives for tasks such as ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
General Description of Legumes Plants and Their Uses
What are Legumes? Nutritional Value of Legumes Legumes are highly regarded for their nutritional value, making them essential components of a balanced diet. These foods offer a wealth of benefits due to their rich nutrient profile, including proteins, carbohydrates, dietary fiber, vitamins, and minerals. Their bioactive compounds further enhance their appeal by contributing to various ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
General Description of Timber Yielding Plants
What are Timber plants? Important timber yielding plants 1. Tectona grandis Tectona grandis, commonly known as teak, is a prominent species within the family Verbenaceae. Renowned for its exceptional qualities, teak is one of the most significant commercial timber crops in tropical regions. 2. Dalbergia sissoo Roxb Dalbergia sissoo Roxb, commonly known as shisham or ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
General description of Vegetable Oils and Fats
What are Vegetable Oils and Fats? Vegetable oils and fats have been integral to human civilization since ancient times, with evidence of their use in various cultures for food, body care, and practical applications like soap-making. While early humans primarily relied on animal fats, different civilizations, including the Chinese, Hindus, and Egyptians, developed methods to ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
General descriptions of Beverage Plants and Beverages With Examples, and Importance
What are Beverages? Examples Of Nonalcoholic Beverages Containing Caffeine Coffee Tea Cocoa and Chocolate Mate Guarana Khat Cola Cassine Examples of Alcoholic beverages 1. FERMENTED BEVERAGES Fermented beverages represent a significant category within the alcoholic beverage industry, encompassing a diverse array of products derived from the fermentation of various plant materials. Here, we explore key ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
General descriptions of Legumes Plants With Examples, Importance
What are Legumes? Examples of Legumes Legumes encompass a wide range of plants, each with distinct characteristics and uses. The following are notable examples, categorized by their types and key attributes: Forage Legumes Many legumes are cultivated specifically for forage or green manuring rather than human consumption. These include: Examples of Tree Legumes Tree legumes ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
General descriptions of Spices With Definition, Examples, Importance
What are Spices? Spices obtained from roots and rootstalks Spices obtained from barks Spices obtained from flowers or flower buds Spices obtained from Fruits Spices derived from fruits encompass a diverse range of botanical origins, each contributing unique flavors and uses. Here, we explore notable examples, including their botanical names, families, parts used, morphology, and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
General Protocol for Western Blotting
Principle of Western blotting The principle of Western blotting involves the separation of proteins based on their size through gel electrophoresis, followed by the transfer of the separated proteins onto a solid support (blotting), and the detection of the target protein using specific antibodies (detection). In the first step, gel electrophoresis, proteins are separated based on ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Genetic Code - Definition, Characteristics, Wobble Hypothesis
What is a Genetic Code? The genetic code is a set of rules that living cells use to decipher the information encoded in genetic material (DNA or mRNA sequences). The ribosomes are responsible for carrying out the translation process. Using tRNA (transfer RNA) molecules to carry amino acids and to read the mRNA three nucleotides ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Genetic Crossword Puzzle
Genetics is the branch of biology that focuses on genes, heredity, and variation in living organisms. It studies how traits and characteristics are passed from one generation to the next through genetic material (DNA or RNA in some viruses). Genetics covers topics such as gene expression, mutation, genetic recombination, and the roles of genes in ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Genetic Engineering - Definition, Tools, Steps, Advantages, Applications, Examples
What is Genetic Engineering? Definition of Genetic Engineering Genetic engineering is the deliberate manipulation of an organism’s DNA using advanced techniques to modify, add, or remove specific genes, resulting in desired genetic traits or functions. Basic Tools of Genetic Engineering Genetic engineering involves the manipulation and transfer of genes from one organism to another. To ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Genetic variation - Definition, Types, Causes, Examples
What is genetic variation? Genetic variation is the differences that are found in the DNA sequences among individuals of the same species. It’s what makes every organism a bit different from others even they belong to same population. Inside populations, variation is mostly caused by mutations, recombination / crossing over (during meiosis), and sometimes by ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Genus - Definition, Advantages, Uses, Examples
What is Genus? Definition of Genus A genus is a taxonomic rank in biological classification that groups together species with shared characteristics or evolutionary lineage, positioned above species and below family. Classification System The Naming System In the realm of biological taxonomy, the system of binomial nomenclature stands as a cornerstone for naming organisms. This ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Geographical Indications - Definition, Process, Benefits, Examples
What is Geographical Indication? A Geographical Indication (GI) is basically a sign / mark used on products that come from a particular location and have qualities or reputation mainly due to that place. It’s considered as one of the forms of Intellectual Property Rights (IPR) which protects names or signs linked with geographic origin rather ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Gerhardt's test - Principle, Procedure, Result
Gerhardt's test is a type of laboratory test which is performed for the qualitative detection of ketone bodies in urine.
Germplasm conservation Methods - Ex situ and In situ conservation
What is Germplasm conservation? Germplasm conservation is the process of preserving the genetic material of plants and animals for future use. It is the protection and maintenance of all hereditary material present in a species. The germplasm includes all genes and alleles which are transferred from one generation to the next generation. This process is ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Giardia intestinalis - Morphology, Life Cycle, Prevalence, Epidemiology, Pathogenicity, Diagnosis, Prophylaxis and Treatment
What is Giardia Intestinalis? Classification of Giardia Intestinalis Domain: Eukaryota Phylum: Metamonada Order: Diplomonadida Family: Hexamitidae Genus: Giardia Species: G. duodenalis History and Distribution of Giardia Intestinalis Giardia intestinalis has a long and significant history as one of the earliest recognized protozoan parasites affecting humans. Its study has evolved over the centuries, revealing important aspects of its distribution ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Giardiasis - Definition, treatment, symptoms, diagnosis, prevention.
Giardia is an infectious parasite and responsible for the diarrheal illness known as giardiasis. Giardia mainly infects humans, cats, and dogs. Giardia Classification Domain: Eukaryota (unranked): Excavata Phylum: Metamonada Order: Diplomonadida Family: Hexamitidae Subfamily: Giardiinae Genus: Giardia Giardia Giardia Characteristics Giardia infection/Giardiasis Giardiasis definition Giardiasis is an intestinal infection caused by the protozoan Giardia lamblia. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Gibberellin - Definition, Structure, Biosynthesis, Functions, Uses
What is Gibberellin? Definition of Gibberellin Gibberellin is a class of diterpenoid plant hormones that regulate various developmental processes, including stem elongation, germination, flowering, and dormancy. Structure of Gibberellin Biosynthesis of Gibberellin Gibberellins, a class of plant hormones, play a pivotal role in various growth and developmental processes. The intricate pathway leading to the synthesis ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Gibbs Free Energy
Gibbs free energy is also referred to as the Gibbs function. Gibbs energy, also known as free enthalpy, is the measurement used to determine the highest amount of work that can be done in a thermodynamic process when temperatures and pressures remain constant. Gibbs free energy can be identified by the symbol “G”. Its value ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Giemsa Stain- Principle, Procedure, Results, Uses
Giemsa stain is a polychromatic nucleic acid stain that is used mainly for demonstrating different blood cells and parasites in stained blood films. It is named after the German chemist Gustav Giemsa. It belongs to a group of stains known as Romanowsky stains. These are neutral stains made from a mixture of oxidized methylene blue, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Giolitti-Cantoni Broth for Staphylococcus aureus
Giolitti Cantoni Broth Base with the addition of potassium tellurite is utilized to enrich selectively Staphylococcus aureus, a food-borne pathogen, from suspected items, according to ISO.
Gland - Definition, Structure, Types, Functions, Examples
What is Gland? Definition of Gland A gland is a group of specialized cells or an organ that produces and releases substances, such as hormones or secretions, for use within the body or for elimination from the body’s surface or cavities. Characteristics of Glands Glands possess several characteristic features that distinguish them from other types ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Glands - Classification, Structure, Functions, Examples
A gland is a part of the body that makes and releases substances like hormones, enzymes, or fluids to help the body function. Think of it like a tiny factory—some glands send their products directly into the bloodstream to control things like growth, energy, or mood (these are called endocrine glands, like the thyroid or ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Glandular Epithelium - Functions, definition, structure, examples
Definition Glandular epithelium The glandular epithelium comprises a set of tissues that is not the epithelium that covers and lines that is specifically designed to secrete and produce of different macromolecules. Due to its primary role it is often referred to as”the secretory epithelium. It is situated under the lining and covering epithelium. It may ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Glass Bulb Pipette - Everythig You Need to Know
Glass Bulb Pipette is a glass laboratory instrument used for measuring and transferring a definite volume of liquid. It is also known as volumetric pipette or belly pipette. It is used where accurate measurement of liquid is required. It has a bulb like part at the middle. This bulb holds the liquid inside it. The ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Glass Dropper Pipette - Types, Protocol, Uses
Glass dropper pipette is a small glass device used to transfer liquid in drop by drop form. It is also called as eye dropper or Pasteur pipette. It is mainly used when a small quantity of liquid is to be taken and dispensed in controlled drops. It is generally made of three parts. A rubber ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Glass Serological Pipettes - Everythings You Need to Know
Glass serological pipettes are usually described as long, cylindrical measuring tools used for transferring the Liquid volumes that are needed in Cell Culture work, And many other wet-lab procedures, and it is worth mentioning that they are typically calibrated for delivering (TD) readings with graduations marked clearly,even if the spacing sometimes looks tight. These pipette’s ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Global Warming - Definition, Causes, Effects, Solution
What is Global Warming? Definition of Global Warming Global warming is the long-term increase in Earth’s average surface temperature, primarily caused by the buildup of greenhouse gases like carbon dioxide and methane due to human activities such as burning fossil fuels and deforestation. This leads to climate changes and various environmental impacts. Causes of Global ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Gluconeogenesis - Definition, Steps, Reactions, Substrates, Importance
What is Gluconeogenesis? Gluconeogenesis Definition Gluconeogenesis is a metabolic process that synthesizes glucose from non-carbohydrate precursors, such as lactate, glycerol, and amino acids, primarily in the liver and kidneys, to maintain blood glucose levels during fasting or low carbohydrate intake. Location of Gluconeogenesis – Where does Gluconeogenesis Occur? Gluconeogenesis primarily occurs in the liver, which ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Gluconic Acid Production
Gluconic Acid is the 16 stereoisomers of 2,3,4,5,6-pentahydroxyhexanoic acid. It is an inorganic chemical. It occurs naturally in honey, plants, and wine. The first carbon of glucose is oxidised to form gluconic acid, which has antibacterial and chelating effects. Please include the chemical composition and further details. Properties Of Gluconic Acid Chemical formula C6H12O7 Molecular ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Glucose Tolerance Test - Principle, Procedure, Types, Applications
What is a Glucose Tolerance Test? Glucose Tolerance Test (GTT) is a medical test which is used to measure how effectively the body processes the glucose (sugar) from blood into the tissues. It is most commonly performed as Oral Glucose Tolerance Test (OGTT). It is mainly used for diagnosis of metabolic conditions like prediabetes type ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Glycocalyx - Definition, Composition, Types, Functions.
Glycocalyx definition The cell membrane of bacteria, epithelia is surrounded by a pericellular matrix, which is known as Glycocalyx. It is a carbohydrate-enriched coating that covers both eukaryotic cells and prokaryotic cells, particularly bacteria Glycocalyx composition and structure Types of Glycocalyx Based on the bacterial species the structural features and chemical composition of glycocalyces can ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Glycogen - Structure, Functions, Examples
What is Glycogen? Definition of Glycogen Glycogen is a branched polysaccharide made of glucose units that serves as the primary form of glucose storage in animals, fungi, and bacteria. It is primarily stored in the liver and muscles and acts as a readily mobilized energy source when the body needs glucose. Characteristics of Glycogen Glycogen ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Glycogenesis - Enzymes, Steps, Regulation, Importance
What is Glycogenesis? Definition of Glycogenesis Glycogenesis is the biological process of synthesizing glycogen from glucose molecules, primarily in the liver and muscles, for energy storage and glucose homeostasis. Key Enzymes in Glycogenesis Glycogenesis is the biochemical process that converts glucose into glycogen for storage in the liver and muscle tissues. This process relies on ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Glycogenesis vs Glycogenolysis
What is Glycogenesis? What is Glycogenolysis? Differences between Glycogenesis and Glycogenolysis – Glycogenesis vs Glycogenolysis Glycogenesis and glycogenolysis are two key metabolic processes that govern the storage and release of glucose in the body. While they are related, they have opposing functions. Glycogenesis stores glucose in the form of glycogen, whereas glycogenolysis breaks down glycogen ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Glycogenolysis - Enzymes, Steps, Regulation, Functions
What is Glycogenolysis? Glycogenolysis Definition Glycogenolysis is the enzymatic process of breaking down glycogen, a stored polysaccharide, into glucose-1-phosphate and glucose to provide energy or maintain blood sugar levels during fasting or increased energy demand. Glycogenolysis Location Glycogenolysis occurs in the cytoplasm of cells, primarily in the liver and skeletal muscles, with minimal activity in ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Glycolysis - Definition, Steps, Enzymes, Regulation, Result
What is glycolysis? Definition of glycolysis Glycolysis is a metabolic process in which glucose, a six-carbon sugar, is broken down into two three-carbon pyruvate molecules, producing a net gain of two ATP and two NADH molecules. This anaerobic pathway occurs in the cytosol and is a key step in cellular energy production. Major Features of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Glycolysis 10 Steps With Diagram and ATP Formation
What is Glycolysis? Glycolysis 10 Steps Glycolysis is a central metabolic pathway that facilitates the breakdown of glucose into pyruvate through a series of enzymatic reactions. This process is methodically organized into ten distinct steps, divided into two primary phases: the Preparatory phase and the Payoff phase. Preparatory Phase: Payoff Phase: In summary, glycolysis is ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Glycoprotein - Definition, Structure, Functions, Examples
What is Glycoprotein? Definition of Glycoprotein A glycoprotein is a complex molecule composed of a protein covalently bonded to one or more carbohydrate chains, playing diverse roles in biological processes and cell-to-cell interactions. Glycoprotein Structure Methods used to study glycoproteins Glycoproteins, with their intricate structures and multifaceted roles in biological systems, necessitate advanced methodologies for ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Gnetum – Characteristics, Classification, Morphology, Anatomy And Reproduction
What is Gnetum? Gnetum represents a unique genus within the Gnetaceae family and the Gnetales order, characterized as a group of gymnosperms. The Gnetales order consists of three distinct extant genera: Ephedra, Gnetum, and Welwitschia, each exhibiting remarkable morphological differences. Historically, the phylogenetic placement of Gnetum has been contentious. While earlier classifications positioned it closer ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
GOD-POD Method For The Estimation of Blood Glucose - Principle, Procedure
What is GOD-POD Method for Glucose Estimation? GOD-POD method is referred to as Glucose oxidase-peroxidase method (Trinder method). It is a enzymatic method which is used for estimation of blood glucose. It is highly specific and it gives true glucose value. This method is based on two step enzymatic reaction and colour development. In first ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Golgi Apparatus - Definition, Structure, Functions, and Diagram
The principal purpose for Golgi's main function is Golgi apparatus is to transfer vesicles or packets of different cell products, to various areas of the cell.
Golgi Body (Golgi Complex) - Structure, Functions
What is Golgi Body (Golgi Complex)? Definition of Golgi Body (Golgi Complex) The Golgi body, also known as the Golgi complex or Golgi apparatus, is a membrane-bound organelle found in most eukaryotic cells. It functions primarily in the processing, packaging, and distribution of proteins and lipids, which are transported in vesicles to various destinations within ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Gonadal hormones - Secretion, Functions, Mechanism, Regulation
What is Gonad? Origin of Gonads Structure and Location of Gonads 1. Ovaries 2. Testes Gonadal hormones Female Gonad Hormones Female gonad hormones play a crucial role in the reproductive system and the development of female characteristics. The two major hormones produced by the ovaries are progesterone and estrogens. Overall, estrogens and progesterone are essential ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Gonads (Ovaries and Testes)- Structure, Hormones, Regulation, Disorders, Functions
What are Gonads? Definition of Gonads Gonads are reproductive glands in organisms that produce gametes (sperm in males and eggs in females) and secrete sex hormones (such as testosterone, estrogen, and progesterone) essential for sexual development and reproduction. In males, they are called testes, while in females, they are referred to as ovaries. Structure of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Gradient PCR - Definition, Principle, Process, Functions
Gradient PCR is referred to as a PCR optimization method where a range of annealing temperatures is tested at the same time in a single run. It is done in a thermal cycler that contain a gradient block, and this block is made in such way that one side hold lower temperature while the opposite ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Graduate Aptitude Test - Biotechnology (GAT-B) syllabus
Number of tests Once in a year Exam conducted by NTA Fellowship/ Assistantship M.Sc. Biotechnology & Allied Areas Rs.5000/- per monthM.Sc. Agricultural Biotechnology Rs.7500/- per monthM.Tech/M.V.Sc programmes Rs.12000/- per month Administering institutes DBT supported Post-Graduate (DBT-PG) programmes Medium of examination English only Mode of examination Computer based test (CBT) Exam pattern Number of tests (per ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Gram Negative bacteria - Definition, Structure, Characteristics, Importance
Gram-negative bacteria are a type of bacteria identified by their reaction to the Gram stain test, where they lose the purple dye and take up a red or pink counterstain. This happens because their cell walls are thinner and structurally different compared to Gram-positive bacteria. Instead of a thick peptidoglycan layer, they have a smaller ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Gram Positive bacteria - Definition, Structure, Characteristics, Examples
Gram-positive bacteria are a group of bacteria classified based on how they react to a lab test called the Gram stain. When stained, these bacteria hold onto a purple dye because of their thick, mesh-like cell wall made of peptidoglycan. This sturdy layer acts like a protective shield, unlike Gram-negative bacteria, which have thinner walls ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Gram Staining - Principle, Procedure, Results, Uses
Gram-staining used to differentiate between Gram-Positive and Gram-Negative Bacteria.
Gram-Negative Bacteria - Structure, Characteristics, Examples
Gram-negative bacteria are a diverse group of microorganisms known for their unique cell structure, which plays a key role in how they interact with the environment and cause infections. Unlike Gram-positive bacteria, Gram-negative bacteria have a thin peptidoglycan layer sandwiched between two membranes. The outer membrane contains lipopolysaccharides (LPS), which can trigger strong immune responses ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Gram-Sure Test -Principle, Procedure, Result, uses
Gram-Sure Test is a rapid qualitative diagnostic test used for the differentiation of aerobic Gram-negative and Gram-positive bacteria. It is mainly applied for bacteria that are rods or coccobacilli in shape. This test works by detecting the presence of a specific enzyme known as L-alanine aminopeptidase. This enzyme is present almost exclusively in Gram-negative bacterial ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Grassland Ecosystem - Definition, Types, Components
Grassland Ecosystem Definition Geographical distribution Different Names of Grasslands Other Names of Grasslands Place Name of the grassland North America Prairies Eurasia (Europe and Asia) Steppes Africa Savanna South America Pampas India Grassland, Savanna Brazil Campos Venezuela Llanos South Africa Veld Australia Down Savannas are a popular term for tropical grasslands. They are found in ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Grazing Food Chain - Definition, Types, Examples and Features
What is Grazing Food Chain? Definition of Grazing Food Chain The grazing food chain is a type of food chain in which energy flows from photosynthetic producers to herbivores and then to carnivores. It starts with green plants that convert sunlight into energy through photosynthesis and is characterized by the consumption of plant material by ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Grocott-Gomori’s Methenamine Silver Staining - Principle, Procedure, Applications
Grocott-Gomori’s Methenamine Silver (GMS) stain is the histological staining method that is used mainly for the detection of fungal microorganisms in tissue sections and smears. It is the process that was first developed by Gomori and later modified by Grocott, and it is used because of its high sensitivity to demonstrate carbohydrates present in the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Growth and Metamorphosis in Insects
What is Metamorphosis in Insect? Types of Insect Metamorphosis Insects exhibit remarkable diversity in their developmental processes, primarily classified into three distinct types of metamorphosis: ametabola, hemimetabola, and holometabola. Each type demonstrates unique features that influence the life cycle, habitat, and ecological roles of various insect species. What is the endocrine control of moulting in ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Growth at 42 Test - Principle, Procedure, Result, Uses
Growth at 42°C Test is a physiological laboratory test used to identify and differentiate bacteria based on their ability to grow at 42°C temperature. It is done because 42°C is higher than the normal incubation temperature (35–37°C) and many bacteria cannot tolerate this heat. Bacteria that can grow at this temperature are considered to have ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Gymnosperms - Characteristics, Life Cycle, Examples, Economic Importance
Curious about gymnosperms and their role in the plant kingdom? Whether you’re wondering, “Is a pine tree a gymnosperm?” or “What’s the difference between gymnosperms and angiosperms?”, this guide unlocks the answers. Gymnosperms (from the Greek for “naked seeds”) are a group of seed-producing plants that include conifers, cycads, and ginkgos. Unlike angiosperms (flowering plants like the petunia, which is an angiosperm), gymnosperms do not produce ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
HACCP - Definition, History, Principle, Steps, Advantages
HACCP, short for Hazard Analysis Critical Control Points, is a practical system designed to keep food safe throughout its production. Rather than relying solely on end-product testing, it tackles potential risks—like harmful bacteria, unwanted chemicals, or even physical hazards—by spotting where things could go wrong during processes like cooking, cooling, or packaging. Once these critical ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Haemagglutination Test - Principle, Procedure, Result, Material
What is Hemagglutination assay? Haemagglutination Test Principle The fundamental principle underlying the hemagglutination test revolves around the interaction between antigens and antibodies present on the surface of Red Blood Cells (RBCs). When these antigens encounter their corresponding complementary antibodies or vice versa, they bind together, resulting in the agglutination or clumping of the RBCs. This ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Haemophilus influenzae - Habitat, Morphology, Pathogenesis, Treatment
What is Haemophilus influenzae? Scientific classification of H. influenzae Infection Domain: Bacteria Phylum: Pseudomonadota Class: Gammaproteobacteria Order: Pasteurellales Family: Pasteurellaceae Genus: Haemophilus Species: H. influenzae Geographical Distribution and Habitat of H. influenzae Infection The geographical spread of H. influenzae and its habitat are both shaped by factors like vaccination coverage and population immunity. Geographical Distribution Habitat ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Hand Washing Steps And Guidelines By CDC and WHO with Video and Infographic
Handwashing is a fundamental and essential practice in basic hygiene that helps to prevent the transmission and spread of infectious agents. Poor hygiene practices can have a significant impact on causing various infections, including those affecting the skin, respiratory tract, and gastrointestinal system. Respiratory and gastrointestinal infections are often associated with a lack of or ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Hanging Drop Method (Motility test) - Principle, and Procedure, Result, Uses
Hanging drop technique allows for the analysis of living microorganisms. This involves fixing the Microbial suspension into a drop of liquid over the slide of glass.
Hanta Virus - Definition, Structure, Genome, Replication
Hanta Virus Structure of Hanta Virus Genome Structure of Hanta Virus Epidemiology of Hanta Virus Transmission of Hanta Virus Replication cycle of hantaviruses Pathogenesis of Hanta Virus The recognition of hantaviruses by macrophages (M) or dendritic cells (DCs) induces proinflammatory cytokines, which alter the phenotype of endothelial cells (ECs) from anti- to pro-adhesive. Pro-adhesive ECs ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Haploid - Definition, Importance, Examples
What is Haploid? In the realm of cellular biology, the term “haploid” denotes a specific chromosomal state in which a cell or organism possesses half the number of homologous chromosomes typically found in somatic cells. Derived from the Greek word “haplous,” which translates to “single,” the concept of haploidy is pivotal in understanding the genetic ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Hatchery Management of Major Cultivable Fin-Fishes
What is Hatchery Management? Hatchery Management of Indian Major Carp Hatchery management plays a pivotal role in the aquaculture of Indian major carps (IMC), which are essential for food security and nutrition in India. This management process involves various systematic practices to ensure successful breeding, rearing, and incubation of carp species such as Catla (Catla ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Haworth Projection - Definition, Characterisitcs, Examples
What is Haworth projection? Characteristics of Haworth projection The Haworth projection is a two-dimensional representation used to depict the three-dimensional structure of cyclic carbohydrates, such as monosaccharides and disaccharides. It provides valuable information about the arrangement of atoms and functional groups within the molecule. Here are some key characteristics of the Haworth projection: The Haworth ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Heart Infusion Agar - Composition, Principle, Preparation, Results, Uses
The most meticulous organisms that have a high nutritional requirements can be developed using infusion media. Meat infusions were among the first media utilized to cultivate bacteria. Huntoon created a medium with fresh beef heart and peptone that was later named the Heart Infusion Aggar. He showed that it can be utilized to help support the growth of fastidious nutritional microorganisms, without the need for enrichment like blood from animals. Heart Infusion Agar can be used as a general-purpose growth medium. It is recommended for cultivation of fastidious and nutritious microorganisms and as a medium for basal growth that can be used for a wide range of purposes.
Heat and Acetic Acid Test for Proteinuria - Principle, Procedure, Result, Uses
What is Heat and Acetic Acid Test? Heat and acetic acid test (heat coagulation test) is a simple qualitative and semi quantitative test which is used for detection of excess protein in urine sample. Mainly albumin is detected but globulin may be present also. It is done as a screening test for proteinuria. Principle of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Heat Coagulation Test of Proteins - Principles, Procedure, Result
agulation of proteins is a test in biochemistry to find whether there are proteins such as albumin and globulin found in proteins. The coagulation of proteins in reaction the heat stimulus is an typical phenomenon. The process of coagulation by heat of proteins happens in two phases; denaturation or Agglutination, or the dissociation of the protein denatured in the form it is in.
Heat Treatment for Food Preservation
Heat Treatment as a Food Preservation What is the Role of heat treatment in food preservation? Heat treatment plays a vital role in food preservation by offering various benefits that help ensure food safety, extend shelf life, and improve the overall quality of food products. The following points highlight the key roles of heat treatment ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Hektoen Enteric Agar - Composition, Principle, Preparation, Results, Uses
Hektoen Enteric Agar, a selective and differential medium, is used to distinguish Salmonella and Shigella species from other Enterobacteriaceae. Sylvia King, William I. Metzger introduced the medium in 1968. They developed HE Agar medium during their time at the Hektoen Institute, Chicago, in order to improve the recovery of Salmonella and Shigella from clinical specimens.
HeLa Cells - Definition, Characteristics, Significance, Applications
What Are HeLa Cells? Definition of HeLa Cells HeLa cells are an immortal human cell line derived from the cervical cancer tissue of a patient named Henrietta Lacks. First cultured in 1951, these cells have the unique ability to divide and proliferate indefinitely in vitro, making them invaluable for scientific and medical research. Their widespread ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Helicobacter pylori - Definition, Morphology, Pathogenesis, Treatment
What is Helicobacter pylori? Scientific classification of Helicobacter pylori Domain: Bacteria Phylum: Campylobacterota Class: “Campylobacteria” Order: Campylobacterales Family: Helicobacteraceae Genus: Helicobacter Species: H. pylori Morphology of Helicobacter pylori Helicobacter pylori is a Gram-negative bacterium with distinctive features that make it highly adapted to its environment. Its unique structure plays a critical role in its mobility and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Helminths - Structure, Classification, Life Cycle, Infection, Pathogenesis
What are Helminths? Classification of Helminths Helminths, a diverse group of invertebrates, are primarily recognized for their elongated, flat, or round bodies. They are categorized into two main classes: flatworms (Platyhelminthes), which include flukes (trematodes) and tapeworms (cestodes), and roundworms (Nematoda). The classification of helminths is essential for understanding their biology, life cycles, and modes ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Hemagglutination Inhibition Test
The nucleic acids of many viruses encode surface proteins (such as hemagglutinin (HA) of influenza virus) that agglutinate red blood cells (RBC) of numerous species. Hemagglutination is the process by which viral hemagglutinins react with red blood cells to form a lattice of agglutinated cells that settle unevenly in a tube or microtiter well. Unagglutinated ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Hematocrit Centrifuge -Principle, Procedure, Parts, Uses
A hematocrit centrifuge is a laboratory instrument which is used to determine the hematocrit value of blood. It is the percentage volume of red blood cells present in the total volume of whole blood and this value is also referred to as packed cell volume (PCV). It is commonly used in hematology laboratories for routine ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Hematopoiesis - Definition, Process, Locations
What is Hematopoiesis? Hematopoiesis, derived from the Greek words “haima” meaning blood and “poiein” meaning to make, is the process through which blood cells are formed from hematopoietic stem cells. It is a crucial and continuous process necessary for maintaining the appropriate levels of circulating blood cells within the body. All cellular components of blood, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Hematoxylin and Eosin (H&E) Staining - Principle, Procedure, Result, Uses
Hematoxylin and Eosin (H&E) stain is the routine staining method used in histology and histopathology for observing the basic structure of tissues. It is the process in which two dyes are applied on colorless tissue sections so that the cellular parts become clearly visible under the microscope. Hematoxylin behaves as a basic dye and it ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Hemocytometer and Haemocytometry
Despite all the technical advances in scientific laboratories, the Neubauer Chamber is still the most widely used method for cell counting worldwide. This technical data sheet was created to assist experienced and novice researchers in performing a cell count using a Neubauer or Hemocytometer. These principles can be applied to any cell-counting chamber. However, the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Hemoglobin - Definition, Structure and Function
What is Hemoglobin? What is Globin Chain? The globin chain refers to the specific combination of protein subunits that make up different types of hemoglobin. Hemoglobin is composed of four globin chains, which can vary depending on the specific type of hemoglobin. The different types of hemoglobin and their corresponding globin chains are as follows: ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Henderson Hasselbalch Equation - Principle, Uses, Practice, Examples
The Henderson-Hasselbalch equation is a handy formula used in chemistry and biology to estimate the pH of a solution, especially when dealing with buffers—mixtures that resist changes in acidity or alkalinity. Think of it like a cheat sheet for predicting how acidic or basic a solution will be based on the balance between a weak ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Hepatitis A Virus - Structure, Replication, Pathogenesis, Genome, Transmission
Hepatitis A is a liver inflammation brought on by the hepatitis A virus (HAV). Primarily, the virus is transmitted when an uninfected (and unvaccinated) individual consumes food or water contaminated with the faeces of an infected individual. The disease is strongly linked to unclean water or food, inadequate sanitation, poor personal hygiene, and oral-anogenital contact. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Hepatitis B Virus - Structure, Replication, Pathogenesis, Genome, Transmission
Hepatitis B is a viral infection that causes liver inflammation, sometimes leading to serious liver damage. The hepatitis B virus (HBV) is transmitted through contact with the blood or other body fluids of an infected person. This can occur through sexual contact, sharing needles, or from an infected mother to her baby at birth. Symptoms ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Hepatitis C virus - Structure, Replications, Pathogenesis, Genome Structure
Hepatitis C is a viral infection that causes liver inflammation, sometimes leading to serious liver damage. The hepatitis C virus (HCV) is spread through contaminated blood, and it can be acute or chronic. Acute hepatitis C is a short-term illness that occurs within the first 6 months after someone is exposed to the virus. Chronic ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Hepatitis D Virus - Structure, Genome, Replication, Pathogenesis,
Hepatitis D, commonly referred to as “delta hepatitis,” is a viral infection of the liver (HDV). Hepatitis D is only transmitted to individuals who are simultaneously infected with the hepatitis B virus. Hepatitis D is transmitted when blood or other body fluids from an infected individual enter the body of an uninfected person. Hepatitis D ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Hepatitis E Virus - Structure, Genome, Transmission, Replication, Diagnosis, Treatment
Hepatitis E Virus Taxonomy and Classification of Hepatitis E Virus Structure of Hepatitis E Virus Genome of Hepatitis E Virus Epidemiology of Hepatitis E Virus Transmission of Hepatitis E Virus Genomic Replication Strategy Replication of Hepatitis E Virus/Life cycle of hepatitis E virus (HEV) Pathogenesis of Hepatitis E Virus Clinical Manifestations of Hepatitis E Virus Laboratory Diagnosis of Hepatitis E Virus Hepatitis E virus ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Herbarium - Definition, Technique, Importance, Examples
Herbariums are fascinating repositories of plant life, offering a unique window into the diverse flora that populates our world. In this comprehensive article, we’ll delve into the definition, importance, and captivating examples of these botanical treasure troves, providing you with a deeper understanding of these remarkable institutions. What is a Herbarium? – Meaning of Herbarium ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Herdmania - Characteristics, Anatomy (With Diagram), Nervous System
Domain Eukaryota Kingdom Animalia Phylum Chordata Subphylum Tunicata Class Ascidiacea Order Stolidobranchia Family Pyuridae Genus Herdmania Authority Lahille, 1888 What is Herdmania? Herdmania is a solitary ascidian which is included under the Subphylum Tunicata of the Phylum Chordata. It is a sessile marine animal and the adult remains attached to hard substratum like rocks or ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Herpes simplex virus 1 (HSV-1)
Herpes simplex viruses (HSVs) are highly host-adapted viruses that can cause a variety of diseases in human hosts. (a) herpes simplex virus type 1 (HSV-1) and (b) herpes simplex virus type 2 (HSV-2) are the two forms of HSVs (HSV-2). Both types share DNA homology, antigenic determinants, tissue tropism, and illness symptoms, but their epidemiology ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Hershey–Chase experiment On DNA
Hershey–Chase experiment Experiment DNA as Genetic Material Observation Conclusion Why is DNA Considered a Genetic Material? It was found that DNA was the most important part of most species’ genes. There were some important exceptions, such as viruses whose genes were made of RNA. But what makes DNA different from other molecules that can be ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Heterogeneous Nuclear RNA (hnRNA)
What is Heterogeneous Nuclear RNA (hnRNA)? Properties of hnRNA Processing of hnRNA During processing, the hnRNA undergoes the following chemical modifications: 1. Packaging of hnRNA with protein 2. Polyadenylation or Poly (A) tail formation 3. RNA splicing 4. 5′ Capping Mature mRNA One central coding segment, two untranslated segments, one on either side of the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Heterotroph - Definition, Types, Importance, Examples
What is Heterotroph? Definition of Heterotrophs Heterotrophs are organisms that rely on eating other living things for their nutrition and energy, as they cannot produce their own food. Types of Heterotrophic Nutrition In the natural world, living things use different ways to get their food when they can’t make it themselves. These are the main ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
High Pressure Homogenizer - Principle, Types, Parts, Uses
Homogenizer is a mechanical device used to make a uniform and stable mixture of two substances which normally do not mix well. It is used in food, dairy, pharmaceutical and cosmetic industries. It forces a liquid or semi-fluid product through a narrow gap called homogenizing valve under very high pressure. In this process, the liquid ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
High Throughput Sequencing (HTS) - Principle, Steps, Applications
What is High Throughput Sequencing (HTS)? Working Principle of High Throughput Sequencing (HTS) High-throughput sequencing (HTS) technologies High-throughput sequencing (HTS) technologies have revolutionized genomic research by enabling rapid and detailed analysis of genetic material. The principal HTS technologies can be categorized into next-generation sequencing (NGS) and third-generation sequencing. Each of these technologies has distinct methodologies, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
High-Pressure Processing (HPP) - Dfinition, Principle, Process, Applications
What is High-Pressure Processing (HPP)? When was High Pressure Processing invented? High Pressure Processing (HPP) was invented in June 1899 by Bert Holmes Hite, a researcher from the University of West Virginia. Hite demonstrated the inactivation of microorganisms using high hydrostatic pressure, marking the first documented use of pressure as a food preservation method. Following ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Hippurate Hydrolysis Test - Principle, Procedure, Result
Hippurate Hydrolysis Test is a biochemical test used for detecting the enzyme hippuricase(hippurate hydrolase) in microorganism. It is used for checking whether the organism can hydrolyze sodium hippurate or not. This process occurs when bacteria having hippuricase is exposed to sodium hippurate. The substrate is hydrolyzed and two end products is formed. The reaction is ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Histology - Definition, Methods, Careers, Importance
What is Histology? Definition of Histology Histology is the scientific study of the microscopic structure of biological tissues. Sample preparation Methods in Histology Histological analysis necessitates meticulous sample preparation to ensure accurate microscopic observation. The preparation techniques vary based on the specimen type and the intended observation method. Herein, we delineate the primary steps involved ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
History and Scope of Microbiology
What is Microbiology? Microbiology is the study of microorganisms, which are tiny, single-celled organisms that are found almost everywhere on Earth. These microorganisms include bacteria, viruses, fungi, algae, and protozoa, and they play vital roles in many aspects of our lives. Microbiology encompasses a wide range of disciplines and applications, including the biology of microorganisms, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
History of Life - Overview, Chemogeny, Biogeny, RNA World, Major Events in History of Life
Historical Overview Throughout human history, the origin of life has captivated our curiosity and inspired various creation myths involving supernatural forces. However, ancient Greek thinkers were the first to approach the topic from a scientific standpoint, proposing the concept of spontaneous generation as a mechanism for complex organic forms to arise from simpler inorganic matter. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
History of Microbiology
The Emergence of Microbiology: Uncovering Microbes Microbiology, the study of microscopic living organisms, is a relatively recent scientific field that has significantly advanced our understanding of biology and disease. The foundation of microbiology can be traced back to the mid-19th century, during a period of considerable growth and development in the biological sciences. Key Developments ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
History of the Microscope
Microscopes have been around for the ages. Roman philosophers had mentioned "burning glass" within their works. However, the first microscope of this type was not invented until the 1300's. Two lenses were set on opposite sides of the tube. This tube of magnifying power was the basis for our modern-day microscope.
History, Branches, and Career Opportunities of Microbiology
What is Microbiology? Microbiology, derived from the Greek words μῑκρός (mīkros) meaning ‘small’, βίος (bíos) meaning ‘life’, and -λογία (-logía) meaning ‘study of’, is the scientific discipline focused on the study of microorganisms. These microorganisms can be unicellular (single-celled), multicellular (comprising multiple cells), or acellular (lacking cellular structure). The field encompasses several sub-disciplines, including virology, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Homeostasis - Definition, Mechanism, Types, Importance, Examples
What is Homeostasis? Definition of Homeostasis Homeostasis is the process by which living organisms maintain a stable internal environment despite external changes, ensuring optimal functioning of physiological systems. This involves regulating various parameters such as temperature, pH, and ion concentrations through feedback mechanisms that include receptors, control centers, and effectors. Components and Process of Homeostasis ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Homogenizer - Principle, Parts, Types, Procedure, Uses
Homogenizer Definition A homogenizer is a device used to mix, emulsify, and evenly distribute particles in liquids, creating a uniform and homogeneous mixture. Principle of Homogenizer Parts of Homogenizer 1. Homogenizing Valve – It is the main part where actual homogenization occur, the liquid is forced by a very small gap creating high velocity & ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Homology Modeling - Definition, Steps, Diagram, Applications
The technique of homology modeling, which is also referred to as comparative modeling, is a robust computational approach that is widely employed in the domain of structural biology. The technique enables researchers to forecast the spatial arrangement of a protein or any other macromolecule by utilizing its amino acid sequence and the established configuration of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Honey bee - Definition, Types, Behaviour
What is Honey bee? Types of Honey bee There are several different types or species of honey bees. The most well-known and widely recognized species is the Western honey bee (Apis mellifera), which is native to Europe, Africa, and the Middle East. However, there are other species of honey bees as well. Here are a ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Hopkin's Cole Test - Principle, Procedure, Result, Uses
Hopkins-Cole test is a biochemical test used to detect tryptophan amino acid in proteins. It is also known as glyoxylic acid reaction. This test was discovered in 1901 by Hopkins and Cole. It is based on the reaction of glyoxylic acid with the indole ring of tryptophan. In this test the protein solution is mixed ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Hormones - Definition, Structure, Types, Functions, Examples
What are Hormones? Definition of Hormones Hormones are chemical messengers produced by endocrine glands that travel through the bloodstream to regulate various bodily functions by interacting with specific target cells or organs. Characteristics or properties of hormone Below are some key characteristics of hormones: Endocrine Glands and Their Major Hormones Endocrine Gland Associated Hormones Chemical ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Hornworts - Morphology, Life Cycle, Importance, Examples
What are Hornworts? Habitat of Hornworts Hornworts, a group of non-vascular plants, exhibit specific habitat preferences and distribution patterns. Their environmental requirements and widespread presence are outlined as follows: Characteristics Features of Hornworts Hornworts exhibit several distinct characteristics that highlight their unique biological and ecological adaptations. These features are outlined as follows: Morphology of Hornworts ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Horticultural - Scope, Branches, Importance, Classification
What is Horticultural? Short Definition of Horticulture Horticulture is the science and art of cultivating garden crops, including fruits, vegetables, ornamental plants, spices, and medicinal herbs. It involves the intensive management of these plants through processes such as planting, growth manipulation, harvesting, and marketing, focusing on both production and enhancement within smaller, often protected environments. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Host Pathogen Interaction
Host Pathogen Interaction What is Infection? Types of Infection Infectious agents (pathogens) that cause infections include: What is Invasion? A Survey of Bacterial Invasins Spreading Factors Enzymes that Cause Hemolysis and/or Leucolysis Typically, these enzymes act on the animal cell membrane by inserting into it (creating a pore that leads to cell lysis) or by ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Host-Parasite Interactions - Definition, Types, Mechanism, Examples
What is Host-Parasite Interactions? Types of Hosts In parasitology, hosts play vital roles in the life cycle of parasites. Each type of host has a specific function that contributes to the survival and development of the parasite. Understanding these types helps in comprehending how parasites interact with their hosts and spread diseases. Below are the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Hot Air Oven – Definition, Principle, Parts, Uses & Procedure
A hot air oven is a laboratory device that sterilizes materials using dry heat. The main parts of a hot air oven are the outer cabinet, insulation, inner chamber, heating elements, thermostat, fan, and control panel. It works on the principle of heat conduction and convection. What is Hot Air Oven? Definition of Hot Air ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
How L-arabinose operon different from other operons?
How L-arabinose operon different from other operons? Nevertheless, Englesberg et al. discovered that the ara operon’s function differs significantly from that of the lac operon. Thus, the following paradigm was hypothesised: The arabinose system: genes and behavior How the ara system works? DNA looping: discovery, proof and biological use – helical-twist experiment
How are samples prepared for a transmission electron microscope?
What is transmission electron microscope? A transmission electron microscope (TEM) is an electron microscope that transmits electrons through a sample to observe it. Scientists use transmission electron microscopes to analyze materials and examine their microstructural and compositional properties. A transmission electron microscope transmits a highly focused beam of electrons through a sample to observe and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
How Are Vaccines Made?
A typical vaccine has an ingredient that resembles the microorganism that causes illness and is typically made from weak or dead forms from the microbes, their toxicants, as well as one or more of the surface proteins.
How do you access gene sequences from NCBI? - Step by Step Process
Curious about how to get gene sequences from NCBI? Whether you’re a student, researcher, or just a genetics enthusiast, NCBI is an amazing resource for all things genetic. It can be a bit overwhelming at first, but don’t worry—I’m here to guide you through the whole process. In this easy-to-follow, step-by-step guide, we’ll walk you ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
How is plant cell cytokinesis different from animal cell cytokinesis?
Cell division is a crucial process that allows organisms to grow, repair, and reproduce. One important aspect of cell division is cytokinesis, the process of separating one cell into two daughter cells. While cytokinesis is a universal process, it can vary greatly between different types of cells. In this article, we will compare and contrast ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
How Neurons Communicate - Resting membrane potential
The nervous system relies on neurons to carry out various functions, ranging from basic motor reflexes to complex processes such as memory formation and decision-making. Unlike human communication through words and body language, neurons communicate through electrical and chemical signals. Similar to a committee member, a single neuron typically integrates and processes information from multiple ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
How to balance a centrifuge? - Centrifuge Balancing
What is Centrifuge? What is Centrifuge Balancing? Why it is important to balance a centrifuge? – Why is centrifuge balanced? What Happens if a Centrifuge is Unbalanced? How Centrifuge Works? What is Centrifuge Tube? How to balance in different centrifuge? If you are utilising a portable benchtop instrument, you must ensure that the centrifuge is ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
How to calibrate a Microscope With a Stage Micrometer?
Method of Calibrating a Microscope Importance of Microscope Calibration FAQ
How to Calibrate ph Meter? Step By step procedure and requirement
A pH meter is an instrument that is used to measure the pH of a solution, and it is the value that shows how acidic or alkaline the solution is. It is the process where a glass electrode and a reference electrode are placed in the sample, and the potential difference formed between them is ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
How to construct a Phylogenetic tree?
Ever wondered how scientists unravel the family ties between different species or genes? It often starts with building something called a phylogenetic tree. Think of it like sketching out a massive family tree, but for life itself. These trees are powerful diagrams that map out evolutionary relationships, showing us who shared a common ancestor and when ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
How to Use a Compound Microscope
A compound microscope is a laboratory instrument with high magnification power, which is consists of more than one lenses.
How to Use a Micropipette?
Standard laboratory equipment for measuring and transferring minute amounts of liquid includes micropipettors. You’ll put them to use all through the semester and into subsequent upper-level courses. If you want reliable results from your tests, you must become an expert user of these tools. Objective Parts of a micropipette Different sizes of micropipettes The laboratory’s ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
How To Use A Microscope Properly
Making a Wet Mount Staining a Slide (After Making a Wet Mount) Adjusting Focusing Tension There is a ring on the inside portion of the right-hand focusing knob on all other compound microscope versions (490 and above). This ring can be manually adjusted to increase or decrease tension. Changing the Eyepiece (M Series Microscope) A ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
HPLC - Principle, Instrumentation, Types, Uses, Diagram
HPLC (High-performance liquid chromatography) is a liquid chromatography technique used to separate, identify and quantify different components present in a liquid mixture. It is also called high-pressure liquid chromatography. It is used when accurate separation is needed in a mixture. In this technique, a liquid solvent is used as mobile phase and the column is ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Human Astrovirus - An Overview
Astrovirus is a type of virus that can cause gastroenteritis (also known as stomach flu) in humans. The virus is highly contagious and is primarily spread through close contact with infected individuals or through contaminated food or water. Symptoms of astrovirus infection may include diarrhea, vomiting, abdominal pain, and fever. Most people recover from an ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Human Brain - Definition, Structure, Characteristics, Functions
What is Human Brain? Definition of Brain The brain is the central organ of the human nervous system, responsible for processing information, controlling bodily functions, and facilitating cognition, emotions, and behaviors. Characterisitcs Features of Human Brain The human brain possesses several characteristic features that contribute to its complexity and functionality. Here are some key characteristics ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Human Cell Structure and Functions
A human cell is the basic unit that makes up your body, kind of like tiny rooms in a massive mansion working together to keep everything running. Picture it as a microscopic bubble with a flexible outer layer—the membrane—that decides what enters or exits. Inside, there’s a gooey mix called cytoplasm, packed with tiny machines ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Human Circulatory Circuit - Definition, Characteristics, Types, Importance
What is Human Circulatory Circuit? Definition of Human Circulatory Circuit The human circulatory circuit, also known as the cardiovascular system, is a complex network comprising the heart and blood vessels that facilitate the continuous flow of blood throughout the body, ensuring the transport of oxygen, nutrients, and waste products to and from cells. This system ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Human Circulatory System - Definition, Structure, Organs, Functions
What is Human Circulatory System? Definition of Human Circulatory System The human circulatory system is a complex network of blood vessels, including arteries, veins, and capillaries, driven by the heart, responsible for transporting nutrients, oxygen, hormones, and waste products throughout the body. Features of Circulatory System The human circulatory system, a cornerstone of physiological functionality, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Human Cytomegalovirus - Structure, Genome, Replication, Pathogenesis
Cytomegalovirus (CMV) is a widespread virus whose manifestations in immunocompromised patients with congenital CMV disease range from asymptomatic to severe end-organ dysfunction. Human cytomegalovirus is a member of the herpesviruses, Herpesviridae, or human herpesvirus-5 (HHV-5) family of viruses. Infections with the human cytomegalovirus are frequently associated with the salivary ducts. An infection with CMV may ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Human Digestive System - Organs, Structure, Functions
What is Digestive System? How Does the Digestive System Work? Types of Digestive System The digestive system can be categorized into two primary components: the gastrointestinal (GI) tract and the accessory digestive organs. Understanding these components is essential for comprehending how the body processes food and absorbs nutrients. Each part plays a distinct role in ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Human Female Reproductive System - Organs, Structure, Functions
What Is Reproduction? Reproduction refers to the process where organisms create more of themselves. However, although the reproductive system is vital to maintaining a species’ existence, unlike other body systems it is not essential for keeping an individual alive. Two types of sex cells (GAH-meetz) are involved in the human reproductive process. In the female’s ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Human Heart - Definition, Location, Anatomy, Structure, Functions
Definition of Human Heart The human heart is a vital organ that continuously pumps blood throughout the body, providing oxygen and nutrients to cells and removing waste products. It is a hollow muscular organ located in the chest, primarily on the left side, and consists of four chambers that contract in a coordinated manner to ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Human Immunodeficiency Virus (HIV) - Overview
What is Human Immunodeficiency Virus (HIV)? Classification of HIV Human Immunodeficiency Virus (HIV) is classified into two primary types: HIV-1 and HIV-2. Both types belong to the Retroviridae family, specifically under the genus Lentivirus. These viruses exhibit significant diversity, which is crucial for understanding their epidemiology, transmission dynamics, and treatment options. Morphology of HIV Virus ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Human Male Reproductive System - Organs, Structure, Functions
The male reproductive system includes a number of hormones and organs that are involved in reproduction. These hormones and organs can be found either inside or outside of the pelvis. Organs of the Male Reproductive System External male reproductive structures: Internal male reproductive organs: External male reproductive structures The scrotum contains the testes, epididymides and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Human Microbiome and Normal Flora of Human Body
The human body is home to trillions of tiny organisms, like bacteria, fungi, and viruses, that live on the skin, in the mouth, gut, and other areas. This community of microbes is called the human microbiome. Most of these organisms aren’t harmful—in fact, many are essential for health. They help digest food, produce vitamins, and even ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Human Papillomavirus (HPV) - Definition, Structure, Genome, Replication, Pathogenesis, Treatment
Human Papillomavirus (HPV) Structure of Human Papillomavirus (HPV) Genome Structure of Human Papillomavirus (HPV) Functions of viral proteins Protein Function E1 Viral DNA replication E2 Control of viral transcription, DNA replication, and segregation of viral genomes E4 Favor and support the HPV genome amplification; regulate the expression of late genes; control virus maturation; facilitate the release ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Human Skin Microbiome - Normal Flora of Skin, Hair, and Nail
typical flora of skin, hair, and nails is the stable community of microorganisms—mostly bacteria and fungus—that live on the outside surfaces of the human body without causing damage under typical circumstances. These communities, sometimes referred to as the skin microbiome, occupy ecological niches, fight against infections, and generate molecules that stop microbial invasion, therefore safeguarding ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Human Teeth - Structure, Types, Functions
Human teeth play a crucial role in the process of digestion, enabling the breakdown of food into smaller, manageable pieces before swallowing. Unlike some animals that can consume food in one large gulp, humans rely on their teeth to perform various functions essential for effective mastication. This article provides an overview of the structure, types, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Humoral Immunity - Definition, Mechanism
What is the humoral immune response/What is humoral immune response? Humoral immunity definition Humoral immunity, also known as the humoral immune response, refers to the branch of the immune system that produces antibodies in response to extracellular pathogens and foreign substances, primarily mediated by B-lymphocytes and plasma cells in the body’s extracellular fluids. History The ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Hyaline Cartilage - Definition, Structure, Functions
What is Hyaline Cartilage? Hyaline cartilage is a type of connective tissue found in various parts of the human body, characterized by its glossy and smooth appearance. Here are some key points about hyaline cartilage: Overall, hyaline cartilage serves as an important connective tissue in the body, contributing to the proper functioning and structure of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Hyaline Casts in Urine - Types, Morphology, Clinical Significance
Urinary casts are small, cylinder-shaped, tube-shaped particles that can be detected by a microscopic analysis of urine. Casts are the only kidney-specific components discovered in the urine sediment. It is believed that Tamm-Horsfall mucoprotein (uromodulin) released by renal tubular epithelial cells forms the fundamental matrix of all casts. Any components present in the tube filtrate, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Hybridization –Types, Procedure, advantages, and limitations.
Hybridization is the process in which two organisms that belong to different varieties, subspecies, species, or even genera are crossed, and it results in the formation of a hybrid that carries genetic characters from both parents. It is the crossing that occurs naturally or by human interference where the genetic materials from two distinct parents ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Hybridization Probes - definition, uses, Preparation, Types.
Hybridization Probes Definition Hybridization probes are a small nucleotide sequence that is used for the detection of complementary sequences (DNA or RNA) in a nucleic acid sample. DNA Probes detects the complementary DNA with the help of a hybridization reaction. This is achieved by permitting the probes to base pair with the sample nucleic acid ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Hydrogen Sulfide (H2S) Test - Principle, Procedure, Result
What is Hydrogen Sulfide (H2S) Test? The Hydrogen Sulfide (H2S) test is a routine biochemical method used in bacteriology, it is the process by which the capacity of a strain to produces hydrogen sulfide gas is detected in selective or differential media, this is referred to as an important aid for separating Salmonella and Proteus ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Hydrophobic Interaction Chromatography (HIC)
What is Hydrophobic Interaction Chromatography (HIC)? Principle of Hydrophobic Interaction Chromatography (HIC) Protocol of Hydrophobic Interaction Chromatography (HIC) Factors that Affect Hydrophobic Interaction Chromatography (HIC) Uses of Hydrophobic interaction chromatography Advantages of Hydrophobic interaction chromatography Limitations of Hydrophobic interaction chromatography FAQ
Hymenolepis nana - Morphology, Life cycle, Pathogenicity, Diagnosis, Prophylaxis and Treatment
What is Hymenolepis nana? History and Distribution of Hymenolepis nana Hymenolepis nana, known as the dwarf tapeworm, has a significant historical and geographical context that sheds light on its prevalence and impact on human health. The name “Hymenolepis” originates from the Greek words for membrane and covering, referring to the thin shell surrounding its eggs, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Hypersensitivity - Definition, Types, Mechanisms, Examples
What is Hypersensitivity? Definition of Hypersensitivity Hypersensitivity is an abnormal and exaggerated response of the immune system to a substance (antigen) that is usually harmless. It can lead to allergic reactions and immune-related diseases. Causes Of Hypersensitivity Diseases Hypersensitivity is caused by various immune responses that can be triggered by different types of antigens. The ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Hypersensitivity Type I, II, III and IV- Summary in table form
Hypersensitivity (also known as hypersensitivity response or intolerance) is a term used to describe undesirable reactions that are caused by the immune system, which includes autoimmunity and allergies. These are typically called an overreaction of the immune system, and these reactions can be harmful and uncomfortable. It is an immunologic term , and should not be misinterpreted as a psychiatric term of being hypersensitive, which refers that a person is hypersensitive to physical (ie sounds, touch light, sound, etc.) or emotional stimuli. However, there is a link between the two , studies have demonstrated that with ADHD (a mental disorders) tend to experience hypersensitivity reactions, such as asthma, allergies, or eczema and more than people who don't have ADHD.
Hyphae - Definition, Types, Structure, Production, Functions, Examples
What is Hyphae? Definition of Hyphae Hyphae are the elongated, branching filamentous structures of fungi and actinobacteria, collectively forming the mycelium, which is essential for their growth and development. Hyphae Types Fungal hyphae, the filamentous structures integral to the growth and development of fungi, exhibit a diverse range of types based on various criteria. Here, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Hypothalamus - Definition, Structure, Functions
What is Hypothalamus? Definition of Hypothalamus The hypothalamus is a small but crucial part of the vertebrate brain located beneath the thalamus. It regulates various physiological functions, including body temperature, hunger, thirst, and circadian rhythms, by linking the nervous system to the endocrine system through the pituitary gland. Additionally, it plays a role in controlling ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Hypotonic Solution - Definition, Importance, Examples
What is hypotonic solution? Definition of Hypotonic solution A hypotonic solution is one that has a lower solute concentration compared to another solution, leading to a net movement of water into the region of higher solute concentration, typically across a semipermeable membrane. What Happens to Cells when it is placed in a hypotonic Solution? When ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
IIT JAM - Biotechnology Previous year question papers Download
IIT JAM Biotechnology Previous Year Question Papers Download: Elevate your IIT JAM Biotechnology exam preparation with our extensive collection of previous year question papers. Download these past papers to gain insights into the exam format, identify frequently tested topics, and practice with real questions from previous years. These question papers are crucial for understanding the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
IIT-JAM Biotechnology syllabus
Number of tests Once in a year Subject included Biotechnology, Geology, Chemistry, Mathematics, Economics, Mathematical Statistics Organizing authority IIT Madras is the Organizing Institute for JAM 2024 Exam conducted by IITs JAM Score Card Validity M.Sc programmes in IITsAdmissions in IISc, IISER Pune, IISER Bhopal, JNCASR, NITs Medium of examination English only Mode of examination ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Immune Response - Definition, Factors, Types, Examples
What is Immune Response? Primary Immune Response The immune response can be divided into four distinct phases when the body encounters an antigen for the first time. These phases include the lag phase, exponential phase, plateau phase, and decline phase. Each phase plays a crucial role in the overall immune response. In addition to the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Immunity - Definition, Types, Mechanism, Components, and Immunization
What is Immunity? Definition of Immunity Immunity is the body’s ability to resist or protect itself against harmful pathogens or diseases. What is Immune System? Lymphoid Organs Primary lymphoid organs Secondary lymphoid organs Tertiary lymphoid organs How does Immunity Work? Mechanism of Immunity Types of Immunity The primary purpose of the immune system is to ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Immunodeficiencies - Definition, Types, Animal models(Nude and SCID mice)
What is Immunodeficiency? General Features Of Immunodeficiency Diseases Prior to beginning our examination of specific disorders, it is necessary to review some common characteristics of immunodeficiencies. Classification of Immunodeficiency Immunodeficiency diseases are categorised as A. Congenital or Primary Immunodeficiencies 1. B-Cell Immunodeficiencies (a) X-linked hypogammaglobulinemia, (b) selective immunoglobulin deficiencies, (c) hyperIgM syndrome, and (d) interleukin-12 ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Immunodiffusion Reaction
Immunodiffusion refers to the movement of antigen or antibody within the gel. Add the reactants to the wells. They diffuse to the area of lower/no concentration. A gradient of the reactants' concentration forms as they diffuse into the gel. Immunoprecipitation takes place in a region with an equivalent concentration of both the antibody and antigen. This is represented by bands.
Immunoelectrophoresis - Principle, Procedure, Applications, Advantages and Disadvantages
What is Immunoelectrophoresis? Immunoelectrophoresis is defined as the separation of proteins by electrophoresis followed by their identification through immunologic (antigen-antibody) reactions. Immunoelectrophoresis Definition Immunoelectrophoresis is a biochemical technique that combines electrophoresis and antibody-antigen reactions to separate and identify proteins based on their antigenic properties. Objectives of Immunoelectrophoresis Principle of Immunoelectrophoresis The method is based on ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Immunofluorescence Assay - Principle, Protocol, Types, Uses
What is Immunofluorescence Assay? Definition of Immunofluorescence Assay Immunofluorescence is a laboratory technique used to detect specific proteins or antigens in biological samples by using antibodies labeled with fluorescent molecules, allowing visualization under a fluorescence microscope. Requirements of Immunofluorescence Assay Objective of Immunofluorescence Assay Principle of Immunofluorescence General Steps of Immunofluorescence Assay Types of Immunofluorescence ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Immunofluorescence Quenching Solution Preparation and Application
Immunofluorescence Quenching Solution is used in immunofluorescence and immunocytochemistry applications.
Immunoglobulin A (IgA Antibody) - Structure, Subclasses and Functions
What is Immunoglobulin A (IgA Antibody)? Definition of Immunoglobulin A (IgA Antibody) Immunoglobulin A (IgA) is an antibody that plays a key role in the immune function of mucous membranes. It is the second most abundant immunoglobulin in the body and provides protection against antigens and pathogens in the gastrointestinal, respiratory, and genitourinary tracts. Subclasses ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Immunoglobulin D (IgD) - Definition, Properties, Structure and Functions
What is Immunoglobulin D (IgD Antibody)? Properties Of Igd Measurement Of Igd The measurement of IgD, an immunoglobulin found in body fluids, has evolved over time with the development of more sensitive techniques. This article explores various methods used to measure IgD and discusses the challenges and considerations associated with each method. From traditional techniques ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Immunoglobulin E (IgE) - Definition, Structure and Functions
What is Immunoglobulin E (IgE Antibody)? Definition of Immunoglobulin E (IgE Antibody) Immunoglobulin E (IgE) is a type of antibody that is involved in allergic reactions and defense against parasites. It is the least abundant but highly potent class of immunoglobulins found in mammals. Structure of Immunoglobulin E (IgE Antibody) Molecular Level of Immunoglobulin E ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Immunoglobulin G (IgG Antibody)- Definition, Structure, Subclasses and Functions
What is Immunoglobulin G (IgG Antibody)? Definition of Immunoglobulin G (IgG Antibody) Immunoglobulin G (IgG) is the most common type of antibody in the human body, representing approximately 75% of serum antibodies. It plays a crucial role in protecting against bacterial and viral infections by binding to specific antigens and activating immune responses. Structure of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Immunoglobulin M (IgM Antibody) - Definition, Structure, Functions
What is Immunoglobulin M (IgM Antibody)? Definition of Immunoglobulin M (IgM Antibody) Immunoglobulin M (IgM) antibody is the first antibody produced by the immune system in response to an infection or foreign substance. It is a large pentameric antibody that plays a crucial role in the body’s initial immune response. Fundamentals of IgM IgM, or ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Immunological Tolerance - Definition, Mechanism, Types
Definition of Immunological Tolerance Immunological tolerance is a state of specific immunologic nonreactivity to a specific antigen to which an individual has been previously exposed. Immune tolerance stops the immune system from responding to self-antigens. Mechanisms of Tolerance The proposed mechanisms of tolerance are clonal deletion, clonal anergy, and suppression. Clonal deletion: Clones of B ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Immunology Crossword Puzzle
Immunology is the branch of biological and medical sciences that studies the immune system, which is the body’s defense mechanism against harmful organisms, pathogens (like bacteria, viruses, fungi, and parasites), and other foreign substances. Immunologists work to understand how the immune system functions in both health and disease, including autoimmune disorders, hypersensitivities (like allergies), immunodeficiencies, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Immunotherapy For Tumors
Oncologists and immunologists have long been optimistic about the potential of immunologic techniques to treat cancer patients. The primary interest in an immunologic approach stems from the fact that the majority of existing cancer treatments rely on medications that kill dividing cells or stop cell division, and these treatments have severe side effects on normal ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Implantation of embryo in Humans - Definition, Process
What is Implantation? Time of Implantation Site of Implantation Implantation stages Implantation is a complex process that involves a series of stages in the embryonic development of mammals. These stages are crucial for the successful attachment and invasion of the blastocyst into the uterine wall. The five recognized stages of implantation are migration and hatching, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
IMViC Test - Principle, Procedure, Result, Uses, Examples
IMViC test is a group of four biochemical tests which are used in microbiology laboratory to identify and differentiate Gram-negative bacteria especially coliform group and Enterobacteriaceae family. These tests are commonly performed after Gram staining and the reactions are stable and used as important identification tests. IMViC is an acronym in which I stands for ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
In Silico drug designing and role of bioinformatics
The conventional approach to drug discovery and development in the pharmaceutical industry is frequently characterized by prolonged timelines, high expenses, and a propensity for setbacks. The drug discovery process has been revolutionized by the emergence of bioinformatics and advancements in computational technologies, leading to the development of a new approach known as in silico drug ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
In Vitro Fertilization - Definition, Principle, Procedure, Applications
What is In Vitro Fertilization (IVF)? Why IVF is done? IVF is performed for various reasons related to infertility and certain health conditions. Here are some common reasons why IVF may be done: Additionally, for individuals who do not have a functional uterus or face significant health risks during pregnancy, IVF with a gestational carrier ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Inbreeding Depression and Heterosis
What is Inbreeding depression? Definition of Inbreeding depression Inbreeding depression is the reduced biological fitness and health of offspring resulting from the mating of closely related individuals, which increases homozygosity and exposes deleterious recessive alleles. History of Inbreeding depression History of Inbreeding Depression Effects of Inbreeding Inbreeding, or the mating of closely related individuals, has ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Incinerator - Definition, Principle, Procedure, Types, Applications
Definition of Incinerator An incinerator is a specialized furnace designed for burning potentially dangerous materials in a controlled manner, typically at high temperatures, to eliminate pollutants and safely dispose of waste. Working principle of Incinerator Operating procedure of Incinerator Parts of Incinerator Primary Chamber – It is the main combustion chamber where the waste materials ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Inclusion Bodies - Definition, Classification, Examples
What are Inclusion Bodies? Inclusion bodies are thick in size, spherical and aggregated proteins typically found inside the cells of protokaryotes thanks to the overexpression of heterologous proteins. Inclusion bodies comprise small particles that are freely suspended and floating in the cell wall. This is why they are also known as inclusions of the cytoplasm. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Incomplete Dominance - Definition, Mechanism, Examples
What is Incomplete Dominance? Definition of Incomplete Dominance Incomplete dominance is a genetic scenario where the heterozygous phenotype is an intermediate blend of the two homozygous phenotypes, with neither allele being fully dominant or recessive. Concept of Dominance In genetics, the concept of dominance revolves around the relationship between alleles of a single gene. To ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Incubator - Definition, Principle, Parts, Types, Procedure, Use
Laboratory Incubator is a laboratory instrument which is used to grow and maintain microbial culture and cell culture. It is an insulated chamber. It maintain fixed temperature and other suitable condition for growth. Humidity and gases like carbon dioxide (CO₂) and oxygen (O₂) are also controlled in it. It gives contamination free environment to the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Indirect ELISA- Introduction, Steps, Advantages and Protocol
What is Indirect ELISA? Indirect ELISA Principle The principle of an indirect ELISA involves the use of two binding steps to detect and quantify specific antibodies in a sample. The first step involves the incubation of the primary antibody with the antigen of interest. The primary antibody specifically recognizes and binds to the target antigen, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Indole Test - Principle, Procedure, Result, Uses
What is Indole test? It is a biochemical test used in microbiology to determine the bacteria is producing enzyme tryptophanase. This enzyme help in breaking down amino acid tryptophan. This process occurs when bacteria having tryptophanase utilize tryptophan and the end products is formed. These are indole pyruvic acid and ammonia. In this test bacteria ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Induced Breeding In Fishes - Principle, Mechanism, Procedure, Advantages
What Is Induced Breeding (hypophysation)? Induced breeding is the process in which fishes are stimulated to reproduce under controlled conditions when natural spawning does not occur in captivity. It is the technique where hormonal preparations are used to activate the maturation of gonads and to release the gametes. This is referred to as hypophysation because ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Induced Mutation - Definition, Mechanism, Examples
What is Induced Mutation? Mechanism of induced mutation Induced mutations occur when external agents, known as mutagens, alter the structure or sequence of DNA. These mutations can arise through several mechanisms that affect how DNA bases interact or replicate. Let’s explore the primary mechanisms responsible for induced mutations. Base Replacement by Base Analogs Base analogs ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Industrial centrifuge - Definition, Parts, Types, Uses
What is an Industrial centrifuge? An industrial centrifuge is a machine that uses centrifugal force to separate or purify materials. Centrifuges work by spinning a sample at high speeds, using gravitational force to separate the components of the sample based on their density, size, or shape. Industrial centrifuges can be used for a wide range ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Industrial Designs - Objectives, Rights, Infringements, Defences of Design Infringement
What are industrial designs? Objectives of Industrial Designs The objectives of industrial designs are multifaceted, aiming to balance aesthetic appeal, functionality, and legal protection. Here are the primary objectives: Rights in Industrial Designs The rights associated with industrial designs are crucial in safeguarding the visual and non-functional aspects of a product. These rights ensure that ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Infertility in male and female - Causes, Diagnosis and Management
What is Infertility? Definition of Infertility Infertility is the inability to conceive or achieve a successful pregnancy after a year or more of regular, unprotected sexual intercourse. Causes of Infertility in Male There are several potential causes of infertility in males. Some common factors that can contribute to male infertility include: Causes of Infertility in ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Inflammation - Definition, Causes, Symptoms
What is an inflammation? Definition of inflammation Inflammation is the immune system’s response to injury or infection, characterized by redness, swelling, warmth, and pain at the affected site. Causes of inflammation Inflammation can be triggered by a variety of factors, each capable of initiating an inflammatory response. The following are among the most common causes: ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Influenza A Virus - Structure, Genome, Replication, Treatment, Prevention
What is Influenza Virus? Classification of Influenza Virus Influenza viruses are often classified into three species: influenza A, influenza B, and influenza C. Only types A and B are relevant to human health. Despite the fact that both viruses are capable of infecting humans, genus A often causes widespread disease and epidemics. Influenza A Virus ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Infrared Spectroscopy (IR Spectroscopy) - Principle, Instrumentation, Application
Infrared (IR) Spectroscopy is an analytical technique used to study and identify chemical substances by using infrared light. In this technique, the chemical bonds present in a molecule absorb infrared radiation. The bonds are not rigid, they behave like spring and show stretching and bending vibrations. When the absorbed frequency matches with the natural vibration ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Innate Immunity - Definition, Types, Mechanism
What is Innate Immunity ? Definition of Innate Immunity Innate immunity refers to the body’s natural, non-specific defense mechanisms that provide an immediate response to invading pathogens without prior exposure. It serves as the first line of defense against infections and is present from birth. Features of Innate immunity Innate immunity possesses distinctive features that contribute ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Innate Immunity vs. Acquired Immunity (Adaptive immunity)
Innate immunity is the naturally-occurring immunity generated through genetic factors and the body's physiology.
Innate immunity begins at birthand continues throughout one's life.
Inoculating Loops and Needles - Principle, Parts, types, Procedure, Applications
Inoculating Loops and Needles are essential microbiology laboratory tools used for transferring, streaking, and culturing microorganisms under aseptic conditions. What is Inoculating Loops and Needles? Definition of Inoculating Loops and Needles Inoculating loops and needles are handheld tools used in microbiology laboratories to transfer and manipulate microorganisms. Inoculating loops are wire loops with a small ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Insect Circulatory System - Structure, Function,and Evolution
The insect circulatory system is an open system characterized by the circulation of hemolymph, a fluid that functions similarly to blood in vertebrates, throughout a body cavity known as the hemocoel. Unlike closed circulatory systems, where blood is confined within vessels, the hemolymph in insects bathes the internal organs directly. The primary component of this ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Insect endocrine system - Structure and Functions
The insect endocrine system is a complex network of glands and neurosecretory cells that regulates essential physiological processes, including growth, molting, metamorphosis, and reproduction. It operates primarily through the release of hormones such as ecdysone and juvenile hormone. Ecdysone, produced by the prothoracic glands, controls the molting process, enabling the insect to shed its exoskeleton ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Insect Excretory System - Structure And Functions
The excretory system of insects is primarily designed to eliminate nitrogenous waste while conserving water, reflecting their adaptation to terrestrial environments. Insects utilize a specialized structure known as Malpighian tubules, which are thin, tubelike organs extending from the gut. These tubules absorb waste products and excess salts from the hemolymph (the insect equivalent of blood) ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Insect morphology (Morphology of Pest)
Taxonomy of Pests The taxonomy of pests plays a crucial role in understanding and managing these organisms effectively. Taxonomy, as the science of classifying organisms, provides a systematic framework for organizing and categorizing pests based on their characteristics, relationships, and evolutionary history. By studying the taxonomy of pests, researchers and pest control professionals can gain ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Insect Nervous System - Structure and functions
The insect nervous system is a complex and highly organized network that facilitates a wide array of functions crucial for the survival and adaptation of insects. It comprises two primary components: the central nervous system (CNS) and the peripheral nervous system (PNS). The CNS consists of a dorsal brain and a ventral chain of segmental ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Insect Plant Interaction - Theory of co-evolution, role of allelochemicals
What is Insect Plant Interaction? What are the main types of interactions between insects and plants? Insect-plant interactions are essential components of ecological dynamics, influencing biodiversity, ecosystem functioning, and agricultural productivity. These interactions can be categorized into three primary types: antagonism, commensalism, and mutualism. Each type encompasses specific relationships characterized by distinct functional roles and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Insect Respiratory System - Structure and functions
The respiratory system of insects is a sophisticated network designed for efficient gaseous exchange. This system relies on a series of internal tubes known as tracheae, which permeate the insect’s body, extending to all tissues, including muscle fibers. Unlike in vertebrates, where oxygen is transported via blood, the tracheal system allows oxygen to reach its ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Insects - General Features, Distribution and Success of Insects on the Earth
What are Insects? Definition of Insects Insects are small, six-legged invertebrates belonging to the class Insecta. They have a three-part body (head, thorax, and abdomen), a chitinous exoskeleton, compound eyes, and a pair of antennae. Insects are the most diverse group of animals, with over a million species, and play crucial roles in ecosystems as ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Insects as Vectors - Features, Types, Examples
What are insect vector? Vectors play a crucial role in the transmission of pathogens and parasites that cause infectious diseases in both plants and animals. By definition, a vector is an organism that carries a disease-causing agent and facilitates its spread among hosts. Understanding the dynamics of vector transmission is essential for developing effective control ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Integral Protein - Definition, Types, Structure, Functions, Examples
What is Integral Protein? Definition of Integral Protein An integral protein is a type of protein that is permanently anchored within the cellular membrane, often spanning its entire width, and plays crucial roles in various cellular functions due to its specific functional domains. Integral Protein Types Integral proteins, a pivotal component of cellular membranes, can ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Integrated Pest Management - Cultural, biological, chemical, genetic control
What is Integrated Pest Management? Integrated Pest Management Approach The concept of integrated pest management (IPM) emerged as a response to the limitations of relying solely on chemical pesticides for pest control. The excessive use of pesticides led to the development of resistant pest populations, necessitating a more comprehensive approach. IPM takes into account all ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Integrated Plant Disease Management (IDM) - Definition, Components, Procedure, Programs
What is Integrated Plant Disease Management? Components of Integrated Disease Management (IDM) Integrated Disease Management (IDM) is a multifaceted approach designed to address plant diseases through the coordinated application of various control strategies. The primary components of IDM work synergistically to create a robust framework that mitigates disease impact while promoting sustainable agricultural practices. The ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Integument And Exoskeleton of Fish - Dermis, Epidermis, Scales, Chromatophores
Fish Integument (Skin) Epidermis And Dermis Epidermis The epidermis is the outermost layer of the skin, derived from the ectoderm, and consists of multiple layers of epithelial cells. These layers vary in thickness depending on the species, age, size, and reproductive stage of the organism. The cells in the epidermis are arranged in specific layers, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Integument In Vertebrates - Structure, Functions and Derivatives.
What is Integument? The integument refers to the outermost covering of the body in animals, which includes the skin and its associated structures. The skin is the largest organ of the body and serves as a protective barrier between the internal organs and the external environment. In addition to the skin, the integument includes other ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Intellectual Property in Biotechnology - Objective, Applications, Moral Issues
Intellectual property (IP) in biotechnology pertains to the legal protections afforded to innovations derived from biological sciences. Biotechnology itself involves utilizing living organisms or their components to develop new products or processes. This broad field encompasses various entities, from pharmaceutical companies to agricultural firms. Historically, biotechnology has roots stretching back to ancient practices, such as ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Intellectual Property Rights - Definition, Types, Importance, Examples
What is Intellectual Property Right? Intellectual Property Right (often shortened as IPR) is described as a legal right that is given to protect creations of the mind, such as inventions, literary works, designs, and symbols used in commerce. Protection is granted so that creators are recognized and rewarded for their work, even when enforcement is ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Interactions In communities - Types, Definition, Examples
Short-term interactions 1. Predation Example of Predation 2. Pollination Example of Pollination 3. Seed dispersal Example of Seed dispersal Symbiosis: long-term interactions Mutualism, commensalism, parasitism, neutralism, amensalism, and competition are the six forms of symbiosis. These are distinguished by the extent to which they benefit or hurt each partner. 1. Competition Example of Competition 2. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Intermediate Filaments - Definition, Structure, Function
What are intermediate filaments? Types of intermediate filaments The intermediate filaments are extremely varied in terms of their biochemical properties, but can be classified into four major kinds based on their morphology and localization: 1. Type I IF proteins 2. Type II IF proteins 3. Type III IF proteins 4. Type IVIF proteins Characteristics of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Interphase - Definition, Stages, Control, Importance
What is Interphase? Definition of Interphase Interphase is the phase in the eukaryotic cell cycle during which the cell grows, replicates its DNA, and prepares for cell division, encompassing the G1, S, and G2 sub-stages. Stages of Interphase 1. Gap 1 2. Synthesis In summation, the Synthesis phase is a critical juncture in the cell ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Intrinsic Pathway of Apoptosis - Definition, Process
Intracellular stimuli, such as DNA damage, predominantly trigger apoptosis via the intrinsic route. The intrinsic apoptosis pathway, which is comprised of conserved signalling proteins, is physically connected with mitochondria and sensitive to mitochondrial oxidative stress in vertebrates. Members of the Bcl family linked to the mitochondrial membrane have an effect on the process, including the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Introduction and scope of Plant Anatomy
What is Plant anatomy? Scope of Plant Anatomy Plant anatomy, the study of the internal structures of plants, encompasses a wide range of topics and applications. Its scope extends across various disciplines and industries, providing essential insights into plant biology, ecology, evolution, and practical applications in fields such as agriculture, medicine, and environmental science. Below ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Introduction of Microbiology and Microbe
Introduction of Microbiology What is Microbiology?, Microbiology is an advanced biology course that studies unicellular (single cell), multicellular (cell colony), or acellular (lacking cells) microorganisms, including bacteria, archaea, algae, fungi, protozoa, and viruses. The term biology is the combination of two important words such as bios, which means “living organisms”, and logy, which means “the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Introduction To Coelomates Metamerism
What is Metamerism? Occurrence of Metamerism The occurrence of metamerism, a body organization in which segments are repeated serially along an organism’s body, can be observed across several distinct groups in the animal kingdom. This type of segmentation, although relatively rare, provides significant structural and functional advantages, contributing to the adaptability and evolution of certain ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Introduction to Ecology - Definition, Types, History, levels of organization
What Is Ecology? Ecology is the scientific discipline that focuses on understanding the interactions between living organisms and their environment. It explores how organisms, both plants and animals, interact with each other and their surroundings, including the physical and biological components of their environment. Ecology draws upon various scientific fields, such as biology, geography, geology, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Introduction to Parasitology - History, Branches, Significance
What is Parasitology? History of Parasitology The history of parasitology encompasses a rich tapestry of discoveries and advancements that highlight humanity’s ongoing struggle to understand and combat parasitic organisms. This narrative intertwines with the broader history of medicine, particularly in the context of tropical diseases, where many parasites are prevalent. Below is a structured overview ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Intron - Definition, Structure, Functions
What is Intron? Origin of Introns Types of Introns Group I introns, Group II introns, Nuclear pre-mRNA introns, and Transfer RNA itrons are the four types of introns. 1. Group I introns 2. Group II Introns 3. Spliceosomal introns/Nuclear pre-mRNA Introns 4. Transfer RNA introns Intron Structure Intron Function Splicing Steps of Splicing Splicing occurs ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Introns vs Exons - Difference, Definition, Functions, Structure
Introns are non-coding DNA DNA sequences in a gene. They are removed through RNA splicing during maturation of the product of RNA.
Inverted Fluorescent Microscope - Principle, Protocol, Parts, Uses
What is Inverted Fluorescent Microscope? Ever peeked into the world of living cells? Scientists use a nifty tool called an inverted fluorescent microscope for this. Unlike regular microscopes, this one flips the script—literally. Imagine the lenses sitting above the sample and the light source shining from below. This upside-down setup makes it perfect for studying cells chilling at the bottom ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Inverted Microscope - Principle, Procedure, Parts, Uses
What is an Inverted Microscope? An inverted microscope is literally an inverted microscope. The lights and lenses are positioned above the specimen stage and the objective lenses are below. This allows the user to critically observe the samples from below; this is important because many living specimens and cells to be observed are in petri ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Iodine Test - Principle, Procedure, Result, Uses
Iodine testing is a chemical test that distinguishes mono- or diaccharides from polysaccharides such as amylase, glycogen, and dextrin. Starch-iodine is a variant of this test. It's used to determine if there is glucose in the leaves.
Ion Exchange Chromatography – Principle, Protocol, Applications, Examples
Ion Exchange Chromatography (IEC) is a chromatographic separation technique used to separate and purify molecules based on their net surface charge. It works mainly for charged biomolecules like proteins, peptides, amino acids and nucleic acids. In this method, separation depends on electrostatic attraction between the sample and the charged stationary phase. Ion exchange chromatography is ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Iron and Manganese Cycles - Steps, Importance
Importance Iron Cycle Manganese and Mercury Cycles Couple Iron-Manganese cycle References
Iron-Hematoxylin Staining - Principle, Procedure, Uses
Hematoxylin is extracted from a leguminous plant, known as Haematoxylon campechianum, thus it is a natural dye. It forms hematein by oxidation (Ripening).
Isolation of Bacillus thuringiensis (Bt) from Soil sample
Bacillus thuringiensis (Bt) is a Gram positive bacteria. It is a spore forming bacteria. It is found naturally in different environment like soil water dead insects and plant surface. It is known for producing special protein crystal during sporulation phase. These protein crystal is known as delta endotoxin (Cry and Cyt proteins). When these crystal ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Isolation of Microorganism From Air
The microbial content of the outer atmosphere is changing with the season, it contains various pollen, algae, mosses, grains, spores of fungi, ferns, bacteria, and viruses.
Isolation of Microorganisms from Soil
Soil contain different types of microorganisms which are listed below; Principle of Isolation of Microorganisms from Soil During this process, the soil sample is collected from the study site. After that, the soil sample is dissolved in distilled water and then serial dilution is performed. Then the spread-plate/streak plate method is performed on the sample ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Isomerism - Definition, Types, Examples, Structures
Isomerism Definition Isomerism refers to the phenomenon where more than one compound has identical chemical formulas, but different chemical structures. Chemical compounds with identical chemical formulae, but differ in the properties and arrangement of the atoms within the molecule are known as isomers. Thus, compounds with isomerism are referred to as isomers. The term “isomer” ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Isomerism - Definition, Types, Explanation, Examples
What is Isomerism? Definition of Isomerism Isomerism is the phenomenon in chemistry where molecules or ions have the same molecular formula but differ in their spatial arrangement or bond connectivity. Different Types of Isomerism Isomerism, a fundamental concept in chemistry, can be classified into two primary types: structural isomerism and stereoisomerism. Let’s delve into these ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Japanese Encephalitis (JE) Virus
Japanese Encephalitis (JE) Virus Structure of Japanese Encephalitis (JE) Virus Genome of Japanese Encephalitis (JE) Virus Epidemiology of Japanese Encephalitis (JE) Virus Transmission of disease Replication of Japanese Encephalitis (JE) Virus Signs and symptoms of Japanese Encephalitis (JE) Virus Japanese encephalitis (JE) is a viral infection that can cause inflammation of the brain. Symptoms of JE virus infection can range from mild ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Jaw Suspension In Vertebrates - Types, Structure, Functions, Example
What do you mean by jaw suspensorium? Jaw suspension in vertebrates refers to the way the lower jaw is attached to the upper jaw or the skull, enabling efficient biting and chewing. This attachment is achieved through modifications in the visceral arches, which are part of the splanchnocranium in the vertebrate skull. The vertebrate skull ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Karyotype and Idiogram - Definition, Procedure, Steps, Applications
What is Karyotyping? Definition of Karyotyping Karyotyping is a laboratory technique used to visualize and analyze the number, size, and shape of chromosomes in an individual’s cells, aiding in the detection of genetic abnormalities and chromosomal disorders. What is Idiogram? An idiogram is a diagrammatic representation of a karyotype, which showcases all the morphological features ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Karyotyping - Definition, Steps, Procedure and Applications
What is Karyotyping? Karyotyping: What’s the Deal? Definition of Karyotyping Karyotyping is a diagnostic technique that examines an individual’s chromosomes to identify genetic abnormalities, structural changes, and chromosome number variations. What is a karyotype? Karyotyping Procedure/Steps of Karyotyping Staining and banding Staining and Banding techniques used in karyotyping: Applications of Karyotyping Medical Genetics: Prenatal Diagnostics: ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Keto Enol Tautomerization - Definition, Mechanism, Examples
What is Keto Enol Tautomerization? Keto Enol Tautomer Structure The structure of a molecule plays a significant role in determining the favorability and stability of keto and enol forms during keto enol tautomerization. In general, ketones are more favored over enols in many common molecular structures. However, the presence and nature of the α-carbon (the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Ketone Bodies - Definition, Structure, Production, Functions
What are Ketone Bodies? Definition of Ketone Bodies Ketone bodies are water-soluble molecules produced by the liver during periods of low glucose availability, serving as alternative energy substrates for various tissues. The primary ketone bodies include acetoacetate, beta-hydroxybutyrate, and acetone. Structure of Ketone Bodies For detailed visual representations of these structures, you may refer to ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Keystone Species - Types, Characteristics, Their Role in Ecosystem Stability, Examples
What are Keystone Species? Characteristics of Keystone Species Keystone species are vital to the functioning and stability of ecosystems, exhibiting several distinct characteristics that set them apart from other species. Their influence on ecological dynamics is profound, and understanding these traits is essential for appreciating their role in maintaining biodiversity and ecosystem health. Types of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Kidney - Structure, Anatomy, Urine Formation, acid-base balance, and Function
What is Kidney? Features of Kidney The kidney is a remarkable organ with several notable features. Here are some key features of the kidney: These features highlight the vital role of the kidneys in maintaining homeostasis and overall health. Structure of Kidney The structure of the kidney is characterized by its bean-like shape and various ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Kingdom Animalia - Different Phylum, Classification, Characteristics
Overview of Kingdom Animalia The Kingdom Animalia is a large group of multicellular eukaryotic organisms that are heterotrophic in their nature. They get their food from outside sources. While they cannot create their own food and this is among the most characteristic traits of plant cells, animal cells do not have a cell wall like ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Kingdom Monera - Classification, Characteristics, Importance, Examples
What is Monera? Definition of Monera Monera is a historical biological kingdom encompassing prokaryotes, which are unicellular organisms lacking a distinct nucleus. This kingdom primarily included bacteria and archaea, and its members are characterized by the absence of membrane-bound organelles. Over time, taxonomic classifications have evolved, and the term “Monera” is less commonly used today. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Kingdom Protista - Characteristics, Classification, Reproduction, Life Cycle, Examples
Kingdom Protista is described as a group of eukaryotic organisms which is neither plant nor animal nor fungus. It is the group that consists of organisms having a true nucleus and other membrane-bound organelles, and it is considered as the most diverse group among the eukaryotes. It is the historical classification used to place all ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Kinyoun stain (Acid Fast Cold) Method - Principle, Procedure, Result
Kinyoun method also known as Kinyoun stain (cold method), was first developed by Joseph J. Kinyoun.
Kirby Bauer Disk Diffusion Susceptibility Test Protocol
What is Kirby Bauer Disk Diffusion test? The Kirby-Bauer disk diffusion test is a laboratory method used to determine the effectiveness of antibiotics against bacterial strains. The test is named after its inventors, Drs. Paul Kirby and Robert Bauer, who developed it in the 1960s. In the Kirby-Bauer test, a bacterial culture is spread evenly ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Kligler’s Iron Agar Test - Principle, Procedure, Result
Kligler’s Iron Agar (KIA) is a special solid culture medium which is used in microbiology to grow and differentiate bacteria. It is prepared in a test tube and it is allowed to solidify in slant position, so two region is formed. The upper part is called slant and it is oxygen rich. The lower deep ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
KOH Test (Potassium hydroxide test) Principle, Procedure, Results, Uses
A KOH pre-test is a quick, non-invasive procedure to diagnose fungal infections that affect the nails or skin.
The cells are collected from the affected region and put on a slide using an acid composed of potassium hydroxide. They are looked at under a microscope in order to determine if there are evidence of the presence of a mold.
Kranz Anatomy - Definition, Characteristics, Advantages
What is Kranz Anatomy? Kranz Anatomy in C4 Plants Kranz anatomy represents a unique structural adaptation in the leaves of C4 plants, specifically designed to enhance the efficiency of photosynthesis in challenging environmental conditions, such as high temperatures and aridity. This specialized arrangement allows these plants to concentrate carbon dioxide (CO₂) around the enzyme ribulose ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Krebs Cycle - Definition, Steps, Products, Regulation
Ever wondered how your cells turn the food you eat into usable energy? Let’s break down the Krebs cycle—a cornerstone of cellular respiration—and answer the questions you’ve been searching for. Also known as the citric acid cycle, this process is a series of chemical reactions that extract energy from nutrients. But where does this critical ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
L-form bacteria - Definition, Size and shape, Culturing , Applications
L-form bacteria Definition “L-form” bacteria are also referred to as L-phase bacteria or L-phase variants, and cell wall deficient (CWD) bacteria are bacteria with no cell walls. They were first identified around 1935, by the scientist Emmy Klieneberger Nobel who identified them as “L-forms” after the Lister Institute in London which she was working at. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
L-Glutamic Acid Production
Dr. K. Ikeda, a Japanese scientist, extracted glutamic acid from kelp, a marine alga, by means of acid hydrolysis and separation in 1908. In addition, he observed that when glutamic acid was neutralised with caustic soda, it acquired a totally new, exquisite flavour. This marked the beginning of using monosodium glutamate (MSG) as a flavour ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Laboratory Diagnosis of Viral Infections
Diagnosis of viral infections Importance of Viral Diagnosis The Viral diagnosis will be particularly helpful in different clinical situations such as; Diagnosis Methods 1. The Direct Examination of Specimen The direct method is accomplished by these following processes; 2. Indirect Method or cell cultures (Virus Isolation) The Cytopathic Effect (CPE) is present in both HSV ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Laboratory Flask - Types, Procedure, Limitations, Uses
Laboratory flask is a specialized vessel or container commonly used as glassware in scientific laboratory. It is generally made up of temperature and chemical resistant borosilicate glass. Sometimes it is also made from different plastics depending on the experimental need. Laboratory flasks are found in different shapes and sizes. Their volume is usually measured in ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Laboratory Hot Plate - Definition, Principle, Parts, Uses
Definition of Hot Plate A hot plate is a portable heating device with a flat surface used to heat samples or materials in a controlled manner without the need for an open flame. Principle of Hot Plate The functional principle of a laboratory hot plate is that an electric current is passed through a heating ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Laboratory Refrigerators and Freezers - Principle, Parts, Applications
What is Laboratory Refrigerators and Freezers? Definition of Laboratory Refrigerators and Freezers Laboratory refrigerators and freezers are specialized equipment used in scientific and medical settings to store and preserve samples, specimens, vaccines, pharmaceuticals, and biological materials at specific temperatures. They ensure hygienic conditions, precise temperature control, and reliable performance to maintain the integrity and viability ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Laboratory Rules - Basic Rules Of A Microbiology Laboratory
A well-established microbiology laboratory is necessary for the work of microorganisms. The students/researchers/scientists must follow the basic rules while working with microorganisms.
Laboratory Test Tube - Types, Limitations, Advantages, Uses
Test tube is a simple laboratory glassware which is used in different laboratory works. It is a cylindrical tube like container, open at one end and closed at the other end. It is also called culture tube or sample tube. It is generally long and narrow in shape. The lower end may be rounded, flat ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Lac Operon (lactose operon) - Definition, Structure, Mechanisms
What is lac Operon? Jacques Monod (1910–1976) began studying bacterial growth and regulation in the late 1930s. He selected E. coli as a model bacteria and eventually concentrated on genes involved in E. coli’s growth on lactose. Francois Jacob joined him in his studies roughly 15 years later (1920–2013). As a result of their research, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Lactic Acid Production
Lactic acid is manufactured commercially by both synthetic and fermentation processes. It is made synthetically in Japan and the United States. European manufacturers, on the other hand, make lactic acid by fermentation. European producers account for between 28,000 and 30,000 tonnes per year of the world’s estimated lactic acid production capacity. Pharmaceutical industries (e.g. iron ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Lactic Acid Starter Culture
Lactic acid bacteria Genera Leuconostocs Genera Streptococcus Genera Lactobacillus Genera Lactococcus Metabolic activity of lactic acid bacteria
Lactobacilli MRS Broth and Agar - Composition, Preparation, Principle
MRS Broth was developed by deMan, and co. in order to facilitate the most abundant growth of lactobacilli derived from feces, oral and other samples. Lactobacilli MRS Broth is a better media for lactobacilli. It allows for healthy growth and is especially suitable for several very discerning strains that grow poorly in other media.
Lactobacillus acidophilus - Definition, Morphology, Classification, Habitat
What is Lactobacillus acidophilus? Classification of Lactobacillus acidophilu Habitat of Lactobacillus acidophilus Morphology of Lactobacillus acidophilus Metabolism of Lactobacillus acidophilus Genomics of Lactobacillus acidophilus Cultural Characteristics of Lactobacillus acidophilus Biochemical Characteristics of Lactobacillus acidophilus The biochemical characteristics of Lactobacillus acidophilus can provide valuable information about its metabolic capabilities. Here are some of the key biochemical characteristics: Fermentation of Various Substrates: Enzymatic Reactions: These ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Lactophenol Cotton Blue (LPCB) Staining - Principle, Procedure, Result.
Lactophenol Cotton Blue (LPCB) staining is the simple wet-mount method used for microscopic examination of fungi, and it is considered one of the common procedure in mycology. It is the process where fixation, staining, and preservation of fungal structures is achieved within a single reagent. The solution is prepared by phenol, lactic acid, glycerol and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Lamarck’s Theory of Evolution - Postulates, Examples, Drawbacks
What is Lamarck’s Theory? Postulates of Lamarckism’s Theory Lamarckism, formulated by Jean-Baptiste de Monet Lamarck, is based on four fundamental postulates that form the core of his evolutionary theory: Lamarck’s theory can be summarized by four main propositions: While Lamarckism has been largely superseded by modern evolutionary theory, it played a significant role in shaping ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Lamina Propria - Definition, Structure, Functions
What is Lamina Propria? Definition of Lamina Propria The lamina propria is a layer of loose connective tissue found beneath the epithelium in mucous membranes, providing structural support, facilitating nutrient passage, and serving as a protective barrier against foreign substances and organisms. Lamina Propria Structure Lamina Propria Functions The lamina propria, an integral component of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Laminar flow hood/cabinet - Parts, Principle, Application
Laminar flow hood or cabinet is a specialized enclosed laboratory workstation which is used to create a sterile and contamination free working area. It is also known as clean bench. It protects the sample and product from dust, bacteria, fungal spores and other airborne particles. It works by drawing the room air inside the cabinet ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Land - Utilization, Soil degradation and management.
What is Land? “Land” generally refers to the solid surface of the Earth that is not covered by water. It encompasses various aspects, including: Overall, land is a multifaceted concept that plays a vital role in various fields, including geography, law, economics, and environmental science. Utilization of Land Land Land utilization refers to the various ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Landscaping and Garden Design
What is Landscape Gardening? Landscape gardening is a specialized field that integrates art and science to enhance the aesthetic and functional aspects of outdoor spaces. It involves the systematic planning and design of gardens while considering various environmental factors, plant selections, and local conditions. The goal is to create a harmonious landscape that reflects the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Lane-Eynon Method - Principle, Procedure, Result, Uses
The Lane–Eynon method is a volumetric titration technique used for the quantitative estimation of reducing sugars in food and dairy products. It is commonly used for the determination of sugars such as dextrose, maltose, and lactose. This method is based on the reduction of Fehling’s solution by reducing sugars under boiling conditions. It is simple, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Larval Forms of Echinodermata
The development of echinoderms is characterized by a unique and intricate process of metamorphosis, which is unlike any other group of animals. Echinoderms exhibit two primary modes of development: direct and indirect. In direct development, there are no distinct larval stages, and the organism proceeds directly from egg to adult. In contrast, indirect development involves ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Lassa Virus - An Overview
Lassa virus is an RNA virus that is spread to humans through contact with the urine or feces of an infected Mastomys rat. It is a type of virus known as an arenavirus, and it is endemic in West Africa. The virus is named after the town of Lassa, in Borno State, Nigeria, where it ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Latest CSIR NET Syllabus Life Science PDF – CSIR NET UNIT Wise Syllabus
CSIR NET, or the Council of Scientific and Industrial Research National Eligibility Test, is a national-level exam conducted in India to determine eligibility for lecturership and for awarding Junior Research Fellowship (JRF) to Indian nationals in the field of science. The exam is conducted in five subjects, including Life Sciences, Physical Sciences, Chemical Sciences, Mathematical ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Latex agglutination test - Definition, Procedure, Principle, Advantages, Limitation, Uses
Latex agglutination test is a simple serological test where antigen and antibody reaction is made visible on the surface of latex particles. It is the process in which latex beads are coated either with antigen or with antibody and when a sample containing the corresponding component is added, the beads is clumped together forming visible ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Leaf Structure Under the Microscope
Leaf Structure The leaf is a vital plant organ responsible for photosynthesis, transpiration, and gas exchange. It is typically thin and flat to maximize its surface area, which enhances the absorption of light and carbon dioxide while allowing efficient release of oxygen and water vapor. The structure of a typical leaf consists of several key ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Learning Behaviour - Definition, Types, Examples
What is Learning Behaviour? Learning by Animals Learning in animals is a fascinating subject that has captivated the attention of animal behaviorists. Understanding how animals learn and the mechanisms involved has been a topic of extensive research. Heyes (1994) has identified three commonly recognized types of experiences that can result in learning. The first type ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Lectin Pathway of the Complement System
An Overview of Complement System What is Lectin Pathway of Complement Activation? Components of Lectin Pathway 1. Mannose-binding lectin Structural subunits of mannan-binding lectin (MBL) and ficolins 2. MBL serum levels and MBL2 gene polymorphisms 3. Ficolins Ficolin-1 Ficolin-2 Ficolin-3 4. MBL-associated serine proteases Steps, Mechanism, Process of Lectin Pathway The lectin pathway, also known ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Leifson Technique for Bacterial Flagella Staining
In 1930, Leifson introduced a simple flagella stain, using this stain he observed that mutations leading to nonflagellated from flagellated bacteria were common, as well as mutation leading to loss of motility without loss of the flagellum itself.
Leishmania donovani - Life cycle, Treatment, Symptoms, Diagnosis, Prevention
What is Leishmania donovani? Classification of Leishmania Domain: Eukaryota Phylum: Euglenozoa Class: Kinetoplastid Order: Trypanosomatida Genus: Leishmania History and Distribution of Leishmania Donovani The history and distribution of Leishmania donovani, the causative agent of visceral leishmaniasis or kala-azar, trace back over a century and reflect its significant public health impact globally. Understanding this history provides ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Lentiviral Transfection Protocol
Lentiviral transfection is a method for introducing genetic material into cells. It involves the use of lentiviruses, a type of retrovirus, to deliver the desired DNA into the target cells. Lentiviral transfection has a unique advantage over other transfection methods, in that it can infect both dividing and non-dividing cells, making it useful for a ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Leptospira interrogans - Habitat, Morphology, Pathogenesis, treatment
What is Leptospira interrogans Complex? Classification of Leptospiraceae The family Leptospiraceae, part of the order Spirochaetales, includes three primary genera: Leptospira, Leptonema, and Turneriella. Only the genus Leptospira includes species that are pathogenic to both animals and humans. Scientific classification of Leptospira interrogans Domain: Bacteria Phylum: Spirochaetota Class: Spirochaetia Order: Leptospirales Family: Leptospiraceae Genus: Leptospira ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Lethal Allele - Definition, Types, Causes, Examples
What is Lethal Allele? Definition of Lethal Allele A lethal allele is a gene variant that causes the death of an organism carrying it, either during embryonic development or later in life. Types of Lethal Allele Lethal alleles are genetic variations that result in the death of an organism carrying them. They can be categorized ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Leucine aminopeptidase (LAP) Test - Principle, Procedure, Results
Leucine aminopeptidase (LAP) is an enzyme used to distinguish catalase-negative, gram-positive cocci of Aerococcus and Leuconostoc (LAP test negative) from other organisms in the group, such as Streptococcus, Enterococcus, Lactococcus, and Pediococcus (almost always positive).
Levels of Ecological Organization - Definition, Examples
Ecological levels of organization Organism → Population → Community → Ecosystem → Biome → Biosphere Ecological Level 1 – Organisms Ecological Level 2 – Population Ecological Level 3 – Biological Community Types of Community Depending on how big they are and how independent they are, communities can be put into two groups: Major Community Minor ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Levinthal’s Medium - Composition, Principle, Preparation, Results, Uses
For the cultivation of Haemophilus, Levinthal's Medium can be used. Although there are many species in the genus Haemophilus that can cause infections, they all share a common morphology. They also require blood-derived factors for growth. This is what gave the genus its name. The Haemophilus Genus is a large grouping of gram-negative rods, which can grow on agar-containing human blood. Two factors are required for Haemophilus species to grow: factor-X, and factor-V.
Life cycle of Algae - Haplontic, Diplontic, Diplohaplontic, and Triphasic.
Life cycle of Algae Sequential changes of the different pages through which an organism completes the life process, starting from zygote to the zygote of the next generation is called the life cycle. There are four types of life cycle in algae such as; 1. Haplontic Life Cycle 2. Diplontic Life Cycle 3. Diplohaplontic Life ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Life Cycle of Fasciola Hepatica
Fasciola Hepatica Life Cycle of Fasciola Hepatica Fasciola hepatica completes its life cycle in two hosts. The definitive or primary host is a sheep or cow, while the intermediate or secondary host is a small of the genus Limnaea. Its life cycle consists of a number of larval stages that reproduce asexually (polyembryony). Copulation, Fertilization ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Life Cycle of Plasmodium vivax in Man and in Mosquito
What is Plasmodium vivax? The life cycle of Plasmodium vivax The life cycle of Plasmodium vivax is divided into two phage; 1. Asexual cycle or Life Cycle of Plasmodium vivax in Man or Schizogony in man Below is a detailed explanation of the asexual cycle of Plasmodium vivax in Man; 2. Sexual Cycle or Life cycle Plasmodium ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Light Microscope - Labeled Diagram, Definition, Principle, Types, Parts, Applications
This reflects the seemingly marvelous developments that have occurred from the history of microbiology to the present day. Advances in technology and subsequent research in the field over the years have meant that once we learned how to study these tiny creatures, we only grew in appreciation for these vital little agents. But in 1590, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Light Microscope vs Electron Microscope - Definition, Parts, Principle
Difference Between Light Microscope and Electron Microscope
Lineweaver–Burk Plot - Double Reciprocal Plot
What is Lineweaver–Burk plot? The Lineweaver–Burk plot, commonly referred to as the double reciprocal plot, stands as a foundational concept within the domain of biochemistry. Stemming from the renowned Michaelis–Menten equation, which pertains to enzyme kinetics, this plot was innovatively introduced by Hans Lineweaver and Dean Burk in the year 1934. Delving into its essence, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Linkage - Definition, Characteristic, Types, Example, Importance
What is Linkage? Definition of Genetic Linkage Genetic linkage is the tendency for genes located on the same chromosome to be inherited together due to their physical proximity. Exploring Terms Related to Genetic Linkage Characteristic of Linked Genes Linked genes are genes that are located close together on the same chromosome and tend to be ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Linkage isomerism - Definition, Examples
What is Linkage isomerism? – Linkage isomerism Definition Ligands Ligands That Can Form Linkage Isomers ligand Lewis structure name donor atoms CN– cyanide ion C or N SCN– thiocyanate ion S or N NO2– nitrite ion N or O Ambidentate Ligand An ambidentate ligand is a type of ligand that possesses two different potential sites ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Lipase Test - Principle, Procedure, Results, Uses
A lipase test is a laboratory diagnostic test which is done to measure the level of lipase enzyme in the blood. Lipase is a digestive enzyme which is mainly produced by pancreas and it helps in digestion of fats. It is the process in which dietary triglycerides are broken down into fatty acids and glycerol ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Lipid Hydrolysis Test - Principle, Procedure, Result
It is a biochemical test that is used to determine the ability of microorganism to produce and secrete the enzyme lipase. It is also referred to as lipase test. The complex lipids such as triglycerides are large molecules and these cannot pass through the bacterial cell membrane. Due to this reason some bacteria releases the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Lipids - Definition, Structure, Properties, Types, Functions, Examples
What are Lipids? Definition of Lipids Lipids are a group of organic compounds, insoluble in water but soluble in non-polar organic solvents, that serve as energy storage molecules, cell membrane components, and play roles in signaling and insulation. Properties of Lipids Physical Properties of Lipids Chemical Properties of Lipids Physical Properties Chemical Properties Soluble in ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Lipopolysaccharide (LPS) - Structure, Functions
Structure and Composition of Lipopolysaccharide (LPS) It is composed of three components like; O-antigen Core Structure of Core or Core oligosaccharide (or Core-OS) The core domain always contains an oligosaccharide component which attaches directly to lipid A and commonly contains sugars such as heptose and 3-deoxy-D-mannooctulosonic acid (also known as KDO or keto-deoxyoctulosonate). It is ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Liposome - Definition, Structure, Composition, Applications
What is Liposome? Liposomes, derived from the Greek words “lipo” (fat) and “soma” (body), are spherical vesicles characterized by at least one lipid bilayer. These structures are primarily composed of phospholipids, notably phosphatidylcholine, and often incorporate cholesterol. Other lipids, such as those present in eggs and phosphatidylethanolamine, can also be integrated, provided they are congruent ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Liquid Chromatography - Definition, Types, Principle, Protocol, Applications
What is Liquid Chromatography? Types of Liquid Chromatography 1. Normal Phase Liquid Chromatography– This type was characterized by polar stationary phase and non-polar mobile phase, separation was achieved mainly by adsorption and polarity differences. Silica gel and alumina are often used as stationary matrix, while solvents like hexane, chloroform are used as mobile phase (sometimes ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Liquid Waste Management
Fluid wastes consisting of sewage and residential wastewater, or treated water or other liquids, generated by industrial operations, particularly in the pulp and paper industry, the food processing industry, and the chemical manufacturing industry. What is Liquid Waste Management? Characteristics of Sewage/Liquid Waste In sewage, the death of oxygen-dependent organisms such as aerobic microbes, plants, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
List of Top 10 Mini Centrifuge
What is a Mini Centrifuge? A mini centrifuge is a small, portable device that is used to separate substances in a liquid mixture by spinning the mixture at high speeds. Mini centrifuges typically have a capacity of 1.5 to 2.0 mL and are used to quickly and efficiently separate small amounts of liquid samples, such ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
List of Top Biotechnology Techniques
Principles Of Biotechnology Biotechnology has grown and changed a lot over the years. The old way of doing it was to use microbes to make products that people could use. Now, the new way is to use genes to make vaccines. So, the European Federation of Biotechnology (EFB) has come up with a new definition ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Litmus Milk Test - Principle, Procedure, Result
What is the Litmus Milk Test? Litmus milk test is a differential biochemical procedure used in microbiology to evaluate metabolic capability of different bacteria. It is done by using a liquid medium containing skim milk and litmus. Skim milk provides lactose(milk sugar) and casein(milk protein) and litmus dye acts as pH indicator and oxidation–reduction indicator. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Liverworts - Characteristics, Morphology, Reproduction, Classification
What are Liverworts? Habitat of Liverworts Liverworts, being bryophytes, exhibit a preference for moist environments due to their susceptibility to desiccation. Their plant bodies lack complete protection against drying out, necessitating habitats that provide abundant moisture. Consequently, liverworts thrive in shady, humid areas where the soil remains consistently damp. Common habitats for liverworts include: Types ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Loa loa Life cycle, Morphology, Pathogenesis, Diagnosis, Transmission, Treatment
What is Loa loa? Epidemiology of Loiasis Morphology of Loa loa Loa loa Life Cycle The life cycle of Loa loa is a complex process involving two hosts: humans as the definitive host and Chrysops flies as the intermediate host. The cycle begins with the transmission of the parasite through the bite of an infected ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Locomotion In Protista - Definition, Organs, Locomotion Types
What is Protista? – Protista Definition Different Locomotion organs of Protista Protists are a heterogeneous group of unicellular eukaryotic creatures with a vast array of movement techniques. Certain protists utilise flagella, cilia, or pseudopodia for locomotion. 1. Flagella Some protists have long, whip-like appendages called flagella that protrude from their surface. They are utilised for ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Locomotion of Fish - Types, Mechanism, Examples
Fish locomotion is referred to as the movement of fish in water with the help of body muscles and fins. It is the process by which fish generate force against water to move from one place to another. This movement is carried out mainly for feeding, escaping from predators and migration. It is controlled by ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Loeffler Medium - Composition, Principle, Preparation, Results, Uses
Loeffler Medium, a modified version of the 1887 Loeffler formula, is now called Loeffler Medium. Loeffler medium is a modified formula that Loeffler developed in 1887. It enhances primary and secondary isolation, and cultivates fastidious pathogenic microorganisms. After prolonged subculturing or prolonged incubation, Loeffler medium restores virulence as well as other identifying properties (microscopic/colonial). High serum levels are useful in determining organisms' proteolytic activity. It can also be used to demonstrate pigmentation and ascospores.
Lotka Volterra equation for competition and Predation
The history of the Lotka-Volterra predator-prey model can be traced back to the early 20th century. Alfred J. Lotka, an American mathematician and biophysicist, first proposed the model in 1910 in the context of autocatalytic chemical reactions. The model was essentially a logistic equation, initially derived by Pierre François Verhulst. In 1920, Lotka extended the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Lowenstein Jensen (LJ) Media - Composition, Preparation, Uses
Lowenstein Jensen Medium (LJ Medium) is a highly selective medium.
Solid media that are used to isolate as well as cultivation of Mycobacteria can be egg-based or Agar-based.
Lung - Structure, Location, Functions, Diseases
What is Lung? Location of Lungs The lungs are essential respiratory organs located symmetrically on either side of the thoracic cavity. Their specific positioning and anatomical features enable efficient gas exchange within the body. Structure of Lung The lungs are vital organs characterized by their roughly cone-shaped structure. They exhibit a unique anatomy that facilitates ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Lymph Nodes - Definition, Location, Structure and Functions
What is Lymph Nodes? Definition of Lymph Nodes Lymph nodes are small organs in the lymphatic system that filter lymph and play a critical role in the body’s immune response. Location of Lymph Nodes Size of Lymph Nodes The size of lymph nodes can vary depending on their location within the body. Here are some general guidelines ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Lymphocytes - Definition, Development, Types and Functions
What are Lymphocytes? Lymphocytes are a specialized type of white blood cell that plays a crucial role in the immune system’s adaptive response. They are the key mediators of both humoral and cellular immunity. Here are some important points about lymphocytes: Definition of Lymphocytes Lymphocytes are specialized white blood cells that are crucial for the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Lysine decarboxylase test - Principle, Procedure, Result, Uses
Lysine decarboxylase test relies on the capability of certain bacteria to degrade L-lysine into caverine after the release of carbon dioxide.
Lysine Iron Agar (LIA) - Composition, Principle, Preparation, Results, Uses
Lysine iron Agar (LIA), a differential medium, is used to test organisms' ability to deaminate or decarboxylate Lysine. Lysine deamination, an aerobic process, occurs in the media. Lysine decarboxylation, an anaerobic process occurring in the media's butt, is also known as Lysine decarboxylation. Edwards and Fife created LIA in 1961 in order to presumptively determine Salmonella species. This includes Salmonella arizonae that is lactose fermenting, which has been linked to foodborne gastroenteritis outbreaks.
Lysine Iron Agar (LIA) Test Principle, Procedure, Result
What is the Lysine Iron Agar (LIA) Test? The solid medium Lysine Iron Agar (LIA) is indicated for use in qualitative techniques for the differentiation of microorganisms based on the generation of lysine decarboxylase and hydrogen sulphide. Purpose of Lysine Iron Agar (LIA) Test Principle of Lysine Iron Agar (LIA) Test Lysine Iron Agar Composition ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Lysogenic Cycle - Definition, Steps, Importance
What is Lysogenic Cycle? Definition of Lysogenic Cycle The lysogenic cycle is a viral replication process in which a virus integrates its genetic material into the host cell’s genome, allowing it to remain dormant and propagate without immediately destroying the host. This dormant viral DNA, known as a prophage, can later be activated to initiate ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Lysogeny broth (LB) Preparation
LB is the most widely used bacterial culture medium but its roots lie in the area of genetics of bacteriophage. Guiseppi Bertani developed the LB recipe when he was trying to increase the amount of plaque that formed on an indicator strain of Shigella (Bertani 1952). As per Bertani, LB has been often misinterpreted to mean "Luria Broth", "Luria-Bertani" medium, or "Lennox Broth"; however the original acronym stood as "Lysogeny Broth" (Bertani, 2004). The agar version of the medium is identified as LA however, it is frequently called LB. While initially developed to study bacteriophage in addition to Shigella growth, LB subsequently became the most preferred medium to grow Escherichia bacteria and other species of the enteric.
Lysosome - Definition, Structure, Functions, Types
Lysosomes are membranous, spherical sacs that are made up of enzymes. They are acidic hydrolase enzymes that are capable of digesting cellular macromolecules. The membrane of the lysosome helps keep its internal compartments acidic, and also separates the digestion enzymes and the cells' other components. Lysosome enzymes are created by the proteins of the endoplasmic reticulum , which is then enclosed in vesicles created by the Golgi system. Lysosomes are created by budding out of in the Golgi complex.
Lysosomes - Definition, Structure, Formation, Functions, Types and Diagram
Lysosomes are membrane-boundand dense granular structures that contain hydrolytic enzymes that are responsible for digestion in extracellular and intracellular cells. The term "lysosome" is composed of two words "lysis" which means breakdown, and "soma" which means body. It is a crucial cell organelle, responsible for inter- and extracellular breakdown of various substances.
Lytic Cycle - Definition, Steps, Importance, Examples
What is Lytic Cycle? Definition of Lytic Cycle The lytic cycle is a phase of viral reproduction wherein a virus infects a host cell, utilizes the cell’s machinery to replicate, and subsequently causes the cell to burst (lyse), releasing new virions to infect other cells. Bacteriophage(virus) Life cycle of bacteriophage Steps of the Lytic Cycle ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
MacConkey Agar - Composition, Uses, Colony Characteristics
MacConkey Agar is a selective and differentiated culture medium widely used to isolate of Gram-negative enteric bacteria.
It is selective since it allows for the growth of gram-negative bacteria , and differentiating the bacteria that are gram-negative based on their metabolic process of lactose.
Macroevolution - Definition, Principle, Process, Features, Examples
What is Macroevolution? Definition of Macroevolution Macroevolution refers to the large-scale evolutionary changes that occur above the level of species, involving the emergence of new taxa (genera, families, orders, etc.) and the diversification of life forms over long periods of time. It encompasses the study of patterns and processes that shape the biodiversity and relationships ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Macronutrients - Definition, Importance, Examples
What are Macronutrients? The human organism is a complex system that relies on specific nutritional elements to ensure its proper functioning, growth, and maintenance. Within the realm of nutrition, there are two primary categories of nutrients that the body necessitates: macronutrients and micronutrients. This discourse will focus on the former, elucidating its significance, types, and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Macrophage - Definition, Structure, Mechanism, Functions
What are Macrophages? Definition of Macrophage A macrophage is a type of white blood cell found in the immune system, known for its ability to engulf and digest cellular debris, foreign substances, and pathogens. It plays a crucial role in both innate and adaptive immunity, aiding in defense against infections and in tissue repair. Structure ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Magnetic Stirrer - Principle, Types, Parts, Uses
Magnetic Stirrer is a laboratory device used to mix liquid solutions automatically without direct manual contact. It is also known as magnetic mixer. It works by producing a rotating magnetic field below the top plate of the instrument. The rotating magnetic field is produced either by a motorized spinning magnet or by stationary electromagnets. A ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Major Histocompatibility Complex I - Definition, Structure, Mechanism, Functions
What is Class I MHC (Major Histocompatibility Complex) molecules? Cellular Distribution of Major Histocompatibility Complex I (MHC I) Major Histocompatibility Complex I (MHC I) Structure The majority of nucleated cells have an assortment of MHC class I proteins. The peptides bound by these MHC class I molecules are typically endogenous, or derived from the breakdown ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Major Histocompatibility Complex II (MHC II molecules) - Structure, Mechanism and Functions
What is Major Histocompatibility Complex II (MHC II molecules)? Cellular Distribution of Major Histocompatibility Complex II (MHC II molecules) Structure of Major Histocompatibility Complex II (MHC II molecules) As stated previously, MHC class II molecules are nearly exclusively located on APCs. The peptides bound by MHC class II are produced from the breakdown of proteins ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Malaria - Parasite, Life Cycle, Pathogenesis, Diagnosis, Treatment, Prophylaxis
What is Malaria? Classification of Malaria parasite Malaria, a significant global health challenge, is caused by parasitic organisms that belong to the genus Plasmodium. These parasites are classified under the Phylum Apicomplexa, which encompasses various protozoans known for their complex life cycles. A comprehensive understanding of the classification of malaria parasites is essential for educators ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Malonate Test - Principle, Procedure, Results, Uses
The purpose of the malonate test is to see if the organism can get all of its energy from malonate.
Mammals (Mammalia) - General characters and Classification up to Order
Mammals (Mammalia) Mammals Scientific Classification Characteristics Of Mammals Mammals possess several distinct characteristics that set them apart from other classes of animals: These characteristics collectively define mammals and contribute to their unique position within the animal kingdom. Classification Of Mammals Mammalia is further classified into many taxonomic ranks. Mammalia is divided into three broad categories, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Mannitol Salt Agar (MSA) - Composition, Principle, Preparation, Results, Uses
Mannitol Salt Agar (MSA) is utilized as a differential and selective medium to isolate and detect Staphylococcus aureus in clinical and non-clinical samples. It is recommended for identification and enumeration of coagulase positive Staphylococci that are present in milk, food as well as other specimens. MSA also promotes an increase in the number of particular group of specific bacteria, while limiting the growth of other bacteria.
Mantoux Test - Procedure, Normal Range and Result Interpretation
What is Mantoux Test? Principle of Mantoux Test The Mantoux test operates on the principle of delayed-type hypersensitivity, specifically Type IV hypersensitivity. This test is designed to assess a person’s cell-mediated immunity against the bacterium Mycobacterium tuberculosis. To conduct this test, a substance known as Purified Protein Derivative (PPD) is used, which is essentially a ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Marchantia - Characteristics, Structure, Reproduction, Classification
Marchantia Marchantia is a genus of liverworts belonging to the family Marchantiaceae and the order Marchantiales. These liverworts are non-vascular plants that thrive in damp, shady environments. The thallus of Marchantia is differentiated into two distinct layers. The upper layer is photosynthetic and features a well-defined epidermis with pores. These pores facilitate gas exchange, crucial ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Martin Lewis Agar - Composition, Preparation, Principle, Uses
What is Thayer Martin Medium? Composition of Martin Lewis Agar Ingredients Gms/L Casein Peptone 7.5 Meat Peptone 7.5 Corn Starch 1.0 Potassium Phosphate, dibasic 4.0 Potassium Phosphate, monobasic 1.0 Sodium Chloride 5.0 Agar 10.0 Hemoglobin 10.0 Dextrose 1.5 Enrichment Bio-X 10 ml Antibiotics V.C.A.T 10 ml pH 7.2 +/- 0.2 at 25º C Enrichment Bio-X ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Mass Selection Method - Procedure, Applications, Merits, Demerits
What is Mass Selection Method? Definition of Mass Selection Method Mass selection is a plant breeding method where a large number of plants with desirable traits are selected based on observable characteristics, and their seeds are pooled together to create a new variety. This method aims to improve the population’s uniformity for these traits while ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Mass Spectrometry (MS) - Principle, Parts, Working, Steps, Uses
What is Mass Spectrometry (MS)? Definition of Mass Spectrometry (MS) Mass Spectrometry (MS) is an analytical technique used to identify the chemical composition of a sample by measuring the mass-to-charge ratio of its ions, resulting in a mass spectrum that reveals the molecular and structural information of the sample. Principle of Mass Spectrometry (MS) Working of Mass ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Masson’s Trichrome Staining - Principle, Procedure, Result, Uses
Masson’s Trichrome Staining (MTS) is a special histological staining method used to differentiate the connective tissue elements of a section. Principle of the Masson’s Trichrome Staining The principle of Masson’s Trichrome Staining is based on the differential penetration of dyes into tissue components of different density, and it is the process where electrostatic attraction and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Mast cell - Definition, Structure, Functions
What are mast cells? Definition of mast cells Mast cells are a type of immune cell found in connective tissue that are involved in allergic reactions, immune responses, inflammation, and wound healing. They contain granules rich in histamine and play a crucial role in the body’s defense against pathogens. Structure of Mast cell Types of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Mayer's Hemalum Solution Preparation and Application
This “Mayer’s hemalum solution - for microscopy” is used for human-medical cell diagnosis and serves the histological and clinico-cytological investigation of sample material of human origin.
McIntosh and Fildes’ Anaerobic Jar - Principle, Parts, Procedure
McIntosh and Fildes’ Anaerobic Jar is a laboratory apparatus used for cultivation of strict anaerobic microorganisms. These microorganisms cannot grow in presence of oxygen. So, this jar is used to provide oxygen free condition for their growth. It was introduced in 1916 by James McIntosh, Paul Fildes and William Bulloch. The jar is usually a ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Measles Virus - Structure, Genome, Replication, Pathogenesis
Structure of Measles Virus Genome Structure of Measles Virus Epidemiology of Measles Virus Transmission of Measles Virus Replication of Measles Virus Pathogenesis of Measles Virus Clinical manifestations of Measles Virus Complications If not properly treated, measles can result in chronic complications such as pneumonia, encephalitis, etc. Other possible complications include: Laboratory diagnosis Methods of Measles ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Measurement of Bacterial Growth
Measurement of Bacterial Growth Why Should We Measure Bacterial Growth? The following are reasons we measure bacterial growth: Methods used for Measurement of Bacterial Growth There are many methods available to measure bacterial growth. Each one is discussed below. Cell Number count The cell number counting is done by two following methods; A. Direct Method ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Measurement Of Microorganisms - Micrometry
A microscope comes with an objective of 10X (low power) 45X (high power) and 100X (oil immersion). and the ocular lens with 5X, 10X and 15X. In general, an 10-X ocular lens is used in most cases. If an animal can be clearly seen with 10X ocular lens and 45X objective, this means that the size is 10x45, which is 450 times larger than the standard one. We don't know the exact measurement is ? It could be determined using an calibrated scale. Thus the calibration of all lenses (eyepieces) is performed.
Measuring of Calcium In Milk - Principle, Procedure, Result
Calcium in milk is measured by first releasing the calcium from milk matrix and then it is quantified by titration or instrumental method. In milk calcium are present in soluble form and also it is bound with casein complex so direct estimation without treatment is not accurate. The sample is prepared by mineralization in which ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Mechanical and chemical digestion of food - Absorptions of Differenet Molecules
Digestion is a complex process that allows our bodies to break down the food we consume into smaller, more manageable components. This crucial process enables the absorption of nutrients and energy necessary for our overall health and well-being. Digestion occurs through a combination of mechanical and chemical processes, working together harmoniously to ensure the efficient ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Mechanism of Action of Antiviral Drugs
What are Antiviral Drugs? Antiviral drugs represent a category of therapeutic agents specifically designed to counteract viral infections. Viruses, which are obligate intracellular parasites, are a predominant cause of morbidity and mortality in humans, animals, and plants. Their pathogenicity ranges from self-limiting conditions to severe, life-threatening diseases. Unlike other microorganisms, viruses are devoid of the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Mechanism of Hormone Action by Extracellular and Intracellular receptors
Hormones are biochemical messengers produced by glands in the endocrine system and secreted into the bloodstream to regulate various physiological processes in the body. They play a crucial role in maintaining homeostasis and influencing a wide range of functions, including: Hormones exert their effects by binding to specific receptors on target cells, initiating a cascade ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Mechanisms of Animal Behaviour
What is Animal Behaviour? Animal behaviour is the study of the activities and responses shown by animals in relation to their environment and other organisms. It includes all the actions that animals perform during their life such as searching for food, finding shelter, avoiding enemies, communication and reproduction. These activities help the animal to survive ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Mechanisms of Protein Synthesis Regulation in Eukaryotes Cells
What is Protein Synthesis Regulation? Protein synthesis regulation refers to the various mechanisms by which cells control the production of proteins. Protein synthesis is the process by which cells generate proteins, which are essential molecules for the structure, function, and regulation of various cellular processes. The regulation of protein synthesis allows cells to adjust protein ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Mechanisms of Protein Synthesis Regulation in Prokaryotic Cells
Protein synthesis regulation is the intricate process by which cells control the production of proteins, which are essential for nearly all biological functions. This process involves the precise regulation of gene expression to ensure the synthesis of specific proteins at the right time and in the right amounts. Protein synthesis regulation plays a vital role ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Medical Significance of Gram-Negative Cocci and Coccobacilli
The most commonly used gram-negative cocci of medical significance fall under the category of Neisseriaceae which comprises the genera Neisseria, Moraxella, Kingella, Acinetobacter etc. Medical Significance of Gram Negative Cocci Neisseria species The genus Neisseria contains 12 species, two of which, N.meningitidis and N. gonorrhoeae, are commonly pathogenic in humans. Both may cause infections in ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Meiosis - Definition, Types, Steps, Importance, Examples
What is Meiosis? Definition of Meiosis Meiosis is a specialized form of cell division in sexually reproducing organisms that results in four non-identical haploid cells (gametes) from a single diploid parent cell, ensuring genetic diversity and maintaining consistent chromosome numbers across generations. Types of Meiosis Meiosis occurs in the germ cells of organisms that reproduce ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Meloidogyne (Root knot nematode) -Structure, Life cycle, Diagnosis, Management, and Importance
What is Root knot nematode? Life cycle of Meloidogyne incognita The life cycle of Meloidogyne incognita, a root-knot nematode, follows a highly specialized sequence of stages that allows it to effectively parasitize plant roots. The process begins with the egg and progresses through four juvenile stages (J1, J2, J3, J4) before reaching adulthood. Understanding these ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Membrane Bioreactor (MBR) - Principle, Types, Process, Uses
Membrane Bioreactor (MBR) is a wastewater treatment system. In this system, biological treatment and membrane filtration are present together. Microorganisms remain suspended in the aeration tank or bioreactor. These microorganisms break down the organic pollutants of wastewater. In MBR, clarifier is not used for separation of treated water and sludge. The separation is done by ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Membrane Carbohydrate - Types, Structure, and Function
Membranes are made up composed of proteins, carbohydrates, and lipids that are held together with the help of binding forces.
Membrane Filtration Method - Types, Advantages, Disadvantages, Applications
Membrane Filter Technique can define as a physical separation process, which based mainly on size / molecular weight of particles in a liquid or gas stream. In this method a thin semi-permeable membrane (often made from cellulose nitrate/acetate) is used, and pressure is applied to push the feed solution by it. The smaller components pass ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Membrane Filtration Method for Water Quality Analysis
Membrane filtration method is a laboratory method which is used for estimation of microbial load (bioburden) in liquid sample like drinking water environmental water and pharmaceutical solution. It is a quantitative method and the bacteria are concentrated on a membrane filter and then counted as colony forming unit (CFU). Principle of this method is based ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Membrane Lipids - Definition, Structure, Formation, Functions
What are Lipids? What is Membrane Lipid? Characteristics of Membrane Lipids Membrane lipids have several key characteristics, including: Overall, the characteristics of membrane lipids are important for the structure, function, and regulation of cell membranes, and can have significant impacts on cellular processes and signaling pathways. Composition of Membrane Lipid 1. Glycerol‐based lipids Glycerol-based lipids ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Membrane Permeability - Definition, Factors Affects, Examples
What is Membrane Permeability? Cell Membrane Structure The cell membrane, often referred to as the plasma membrane or biological membrane, plays a crucial role in maintaining the integrity of the cell by separating its interior from the external environment. Its structure is vital for selective permeability and fluidity, allowing the cell to regulate its internal ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Membrane Proteins - Definition, Types, Functions
What is Membrane Protein? Membrane proteins are proteins that are embedded within or attached to the lipid bilayer of a cell membrane. These proteins play crucial roles in various cellular functions, including cell signaling, transport of molecules, and structural support. Location of Membrane Proteins Membrane proteins are connected with the cell membrane, the lipid bilayer ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Mendel’s 3 Laws of Inheritance - Segregation, Independent Assortment, Dominance
In the 1860s, Gregor Mendel, an Austrian monk, revolutionized the field of genetics with his foundational work on inheritance patterns. His experiments with pea plants led to the development of Mendelian inheritance, which is based on the concept that heredity operates through discrete units called genes. These genes, according to Mendel, act independently within an ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Mendel’s Law of Dominance - Definition, Characteristics, Limitations, Examples
What is Mendel’s Law of Dominance? Mendel’s Law of Dominance is one of the foundational principles of genetics, formulated by Gregor Mendel through his experiments with pea plants. It asserts that when two homozygous organisms, each possessing contrasting traits for a specific character, are crossed, only one of the traits will appear in the first ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Mendel’s Law of Independent Assortment - Definition, Examples, Limitations
What is Mendel’s Law of Independent Assortment? Definition of Mendel’s Law of Independent Assortment Mendel’s Law of Independent Assortment states that genes for different traits are distributed to gametes independently of one another, meaning the inheritance of one trait does not affect the inheritance of another. Characteristics of Mendel’s Law of Independent Assortment Examples of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Mendel’s Law of Segregation - Definition, Principle, Examples, Limitations
What is Mendel’s Law of Segregation? Mendel’s Law of Segregation Definition Mendel’s Law of Segregation states that alleles for a trait separate during gamete formation, ensuring each gamete carries only one allele, randomly inherited from the parent. What is segregation? Principle of Segregation and its Importance Characteristics of Mendel’s Law of Segregation Examples of Mendel’s ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Mendel’s Laws of Inheritance - Mendelian Inheritance
What is Mendelian Inheritance/Mendel’s Laws of Inheritance? Genetics Terminology of Mendelian inheritance These terms clarify how genes operate, how traits are inherited, and the relationship between genetic information and observable characteristics. Download the Cheat sheet pdf Mendel’s Experiment Gregor Mendel’s experiments between 1856 and 1863 laid the foundation for our understanding of genetic inheritance. Using ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Menstrual Cycle - Definition, Stages, Significance
What is Menstrual Cycle? Definition of Menstrual Cycle The menstrual cycle is a monthly series of physiological changes in the female reproductive system, characterized by the maturation and release of an ovum from the ovaries and the preparation of the uterine lining for potential implantation of a fertilized egg. If fertilization does not occur, the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Meristematic Tissue – Definition, Types, Characteristics
What is Meristematic Tissue? Definition of Meristematic Tissue Meristematic tissue is a type of plant tissue made up of actively dividing, undifferentiated cells that are responsible for the growth and development of new tissues and organs in plants. Characteristics of a meristematic tissue Structure of Meristematic Tissue Below is a detailed exploration of the structural ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Mesenchymal Stromal Cells - Definition, Structure, Location, and Function
Mesenchymal stem cell (MSCs) are also referred to as mesenchymal stromal cell (also known as medicinal signaling cells) are stromal cells with multi-potency which can transform into a variety of cells, including osteoblasts (bone cells) as well as the chondrocytes (cartilage cells) and myocytes (muscle cells) and Adipocytes (fat cells that contribute to the adipose tissue of the marrow).
Mesophiles - Habitat, Adaptations, Roles, Examples
What are Mesophiles? Habitat of Mesophiles Mesophiles are microorganisms that prefer moderate temperatures, typically thriving in environments ranging from 20°C to 45°C (68°F to 113°F). Their habitats are diverse and include a variety of natural and human-made settings. Adaptations of Mesophiles Mesophiles, organisms that thrive in moderate temperature environments, have developed specific adaptations that allow ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Mesophyll Cells - Definition, Location, Structure, Function, Microscopy
Definition of Mesophyll Cells The mesophyll cell is a group of highly differentiated cells which make up the mesophyll layer in plant leaves. The mesophyll layer in the leaves of dicotyledonous plant species is made up two types of cells: the spongy, and the palisade. This makes the mesophyll a site of photosynthesis. These are ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Mesosomes - Definition, Functions
Mesosomes and chondrioids are foldable into invaginations of the plasma membranes of bacteria. They are made through chemical fixation techniques that are used to prepare samples for electron microscopy.
Metamorphosis - Definition, Types, Mechanism, Importance, Examples
What is Metamorphosis? Metamorphosis is a biological process characterized by a profound transformation in the form, structure, or physiology of an organism as it progresses through distinct stages of its life cycle. It involves significant changes that are often irreversible and result in the emergence of a new developmental stage or life form. Stages of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Metaphase - Definition, Stages, Applications
Metaphase is a stage of the cell cycle that occurs in both mitosis and meiosis cell division. During this stage, individual chromosomes cannot be observed in the cell nucleus.
Metazoa - Characteristics, Symmetry, Metamerism, Origin and Evolution
What is Metazoa? Characteristics of metazoa Metazoa, or multicellular animals, exhibit a range of distinctive characteristics that differentiate them from other life forms. Understanding these features provides insight into their complex biological organization and functional diversity. The following points outline the key characteristics of metazoans: Levels of body Organisation The levels of body organization in ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Method for Balancing in Laboratory - Weight or Mass Measurement
The most frequent tasks in the microbiology area is the determination of the weight or mass of desired substances, chemicals. Another important aspect to be considered is the preservation of substances. Thus, the powders, as well as other granular or paste-like substances should Chamber not be placed directly on the platform for weighing of the balance. It is recommended that glazed paper or a small weigh boats is the best choice to weigh. It is recommended to use glazed papers if the material is 15 grams or less needs to be weighed. A the weigh boat pan or small beaker must be utilized if you are weighing a larger amount. Because of the the light weight of glazed papers its weight is subject to a minimal. If the weight is less of 1 gram an electronic balance is recommended. The larger amount (above 1 grams) is not to be considered using electronic balances.
Methods For Maintenance and Preservation of Pure Cultures
Discover essential techniques for the Maintenance and Preservation of Pure Cultures, focusing on bacterial and fungal preservation methods. This comprehensive guide covers best practices to ensure the longevity and purity of microbial cultures, making it an invaluable resource for researchers and laboratory professionals. The following points highlight the top 7 methods used for maintenance and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Methods of food preservation - Physical and Chemical Methods
Food preservation methods have resulted in increasing the duration or shelf time of food items through using a variety of preservation methods.
Methods of Research In Ethnobotany
Ethnobotany is a specialized field of biology dedicated to understanding the intricate relationships between human societies and plants. This discipline focuses on the knowledge and practices of indigenous and rural communities concerning plant use, encompassing their medicinal, nutritional, and cultural significance. By delving into these interactions, ethnobotany aims to uncover valuable plant-based resources that can ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Methyl Red (MR) Test - Principle, Procedure, Results, Uses
What is Methyl Red (MR) Test? The Methyl Red (MR) test is a biochemical test used in microbiology to identify and differentiate bacteria mainly among Enterobacteriaceae family. It is done to check the glucose fermentation pathway. It is used for detecting mixed-acid fermentation which produces stable acidic end products. In this test the organism is ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Methylene Blue Reduction Test (MBRT) - Principle, Procedure, Result
It is a rapid and simple test used for the determination of microbiological quality of milk. It is commonly employed in dairy laboratories to estimate the bacterial load present in milk samples. The test is based on the principle that actively growing bacteria utilize dissolved oxygen during their metabolic activities. Due to this oxygen consumption ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
MHC Genes - H-2 Complex and HLA Complex
What is HLA Complex? What is H-2 Complex? Detailed Organization Of The H-2 Complex 1. Murine MHC Class I Genes 2. Murine 2-Microglobulin Gene 3. Murine MHC Class Ib Genes 4. Murine MHC Class II Genes 5. Murine MHC Class IIb Genes 6. Murine Non-MHC Genes in the MHC 7. Murine MHC Class III Genes ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
MHC Molecules (Major Histocompatibility Complex) - Definition, Properties, Class, Types, Pathways
What is Major Histocompatibility Complex (MHC Molecules)? Definition of Major Histocompatibility Complex (MHC Molecules) The major histocompatibility complex (MHC) molecules are a set of cell surface proteins encoded by a cluster of genes that play a crucial role in intercellular recognition and immune responses. They present antigens derived from self-proteins or pathogens on the cell ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
MIC Test Strip - Quantitative assay for determining the Minimum Inhibitory Concentration
The Minimum Inhibitory Concentration (M.I.C.) of antimicrobial drugs against bacteria and the detection of resistance mechanisms can be found with the help of a MIC Test Strip, a quantitative assay.
Microbe-Microbe Interactions
Various sorts of positive and negative interactions between microorganisms and plants/animals have been described previously. Similar to humans, microorganisms communicate with one another and result in both beneficial and detrimental connections. In this context, the following interactions and interrelationships have been discussed: 1. Symbiosis between Alga and Fungus (Lichens) Classification Based on the nature of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Microbe-Plant interaction - Types, Examples
Microbe-Plant interaction Plants are immobile, but they are continuously subjected to both biotic and abiotic stress. Constant warfare exists between harmful microorganisms and the host plant, with the outcome determining resistance or disease. Plants exude a variety of organic substances, resulting in a nutrient-rich environment that is conducive to microbial growth. Therefore, plants are highly ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Microbial Control Methods
Microbial Control Methods Types of Microbial Control Methods There are present four distinct methods which are used to control the growth of microbes such as; Different terms used in Microbial Control Methods The following terms are used to describe the processes and chemical agents employed in controlling microorganisms. What is Sterilization? What is Disinfection? What ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Microbial degradation of cellulose - Enzymes, Steps, Mechanisms
What is cellulose? (C6H10O5)n Cellulose Molecular Weight/ Molar Mass 162.1406 g/mol Density 1.5 g/cm³ Appears White powder Melting Point 260–270 °C Properties of cellulose Structure of cellulose What are cellulases? Cellulases are a group of enzymes that catalyze the hydrolysis of cellulose, a complex polysaccharide present in plant cell walls. These enzymes are largely produced ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Microbial Degradation of Chitin - Microorganisms, Enzymes, Steps, Mechanisms
What is chitin? Structure of chitin What are Chitinases? Chitinases are enzymes that catalyze the hydrolysis of the β-1,4-glycosidic bonds in chitin They belong to the glycosyl hydrolase family with EC number 3.2.1.14 Two main types exist based on cleavage mode They are produced by bacteria, fungi, plants and some animals for nutrition, defense or ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Microbial degradation of hemicellulose - Definition, Enzymes, Steps, Mechanisms
Hemicellulose is a group of polysaccharides found in plant cell walls, associated with cellulose and lignin. Unlike cellulose which is a linear polymer of glucose, hemicellulose is a branched, amorphous polymer of various sugar monomers like xylose, mannose, galactose, rhamnose and arabinose. It acts as a matrix component that binds with cellulose fibrils and lignin, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Microbial Degradation of Lignin - Microorganisms, Enzymes, Steps, Mechanisms, Challenges
What is lignin? Lignin is a complex, high-molecular-weight polymer made mostly of phenolic compounds. It is found in the cell walls of vascular plants, especially in the secondary cell wall during the development of xylem, phloem fibres, and sclerenchyma cells, which give the plant strength, support, and waterproofing. It is made up of three main ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Microbial degradation of Pectin - Enzymes, Steps, Mechanisms
Pectin is a complicated polysaccharide that is mostly found in the cell walls of plants, notably fruits. It is a structural heteropolysaccharide made up mostly of units of galacturonic acid. Pectin is a glue that holds plant cells together, making the plant tissue strong and stable. In the culinary sector, it is often used as ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Microbial Food Spoilage - Causes, Classification, Process, Factors
Food spoilage is the result of a metabolic process which causes food products to become unpalatable or inedible for human consumption because of changes in the sensory attributes.
Microbial interaction - Definition, Types, Characteristics, Examples
Microbial interaction is a biological interaction in which the effect of microorganisms on other biotic components of an ecosystem can be investigated. Microbiology is the study of microorganisms, and microbial ecology is the study of microbial interactions within an ecosystem. Positive and negative microbial interactions are possible, and microbes can affect (positively or negatively) other ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Microbial spoilage of Beverages and their preservation
Microbial spoilage of beverages poses a significant challenge in the beverage industry, as it can lead to the degradation of taste, quality, and safety of the products. Beverages, apart from water, encompass a wide range of drinkable liquids, including hot drinks, milk drinks, soft drinks, and alcoholic beverages. These beverages can be further classified into ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Microbial Spoilage of Canned foods And Its Preservation Methods - Canning Steps
Canning is a highly regarded method for packaging food, ensuring its long-term storage and preservation. Typically, food is packed into metal containers and subjected to appropriate heat treatments, the specifics of which vary depending on the type of food being canned. While the incidence of food spoilage in cans is generally low, there is always ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Microbial spoilage of fish and fish products and its preservation
Contamination of Fish and Other Seafoods Contamination of fish and other seafood can occur through various factors throughout the harvesting, handling, and processing stages. Understanding these potential sources of contamination is crucial for ensuring the safety and quality of seafood products. Here are some key factors that contribute to the contamination of fish and other ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Microbial Spoilage of Milk and Milk Products - Cream, Butter, Cheese, Yoghurt, Ice-cream
What is Microbial Spoilage of Milk and Milk Products? Contamination Source for Spoilage of Milk and Milk Products Contamination sources for the spoilage of milk and milk products can originate from various points within the production and processing chain. Here are some key sources of contamination: Spoilage of milk Spoilage of milk refers to the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Microbodies - Peroxisomes and Glyoxysomes
What is Microbodies? Historical Microbodies: Structure And Types Peroxisomes Structure of Peroxisomes Functions of Peroxisomes Peroxisomes have been found to engage in two types of biochemical processes: 1. Hydrogen peroxide metabolism H2O2and aging 2. Glycolate cycle Photorespiration CH2OH. COOH + O2 → CHO – COOH + H2O2 CHO — COOH + H2O2 → HCOOH + ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Microdase Test - Principle, Procedure, Result, Uses
The oxidase enzyme is a key factor in distinguishing Staphylococcus from Micrococcus, and the Microdase Disk is a reagent-impregnated disc recommended for use in qualitative procedures.
Microevolution - Definition, Causes, Examples
What is Microevolution? Definition of Microevolution Microevolution refers to small-scale changes in allele frequencies within a population over a relatively short period of time, driven by mechanisms such as mutation, selection, gene flow, and genetic drift. Causes of Microevolution 1. Mutation 2. Selection 3. Genetic drift 4. Gene flow Difference between microevolution and macroevolution Microevolution ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Microfilaments - Definition, Structure, Function
What is Microfilaments? Definition of Microfilaments Microfilaments, or actin filaments, are slender protein fibers that form a vital part of a cell’s cytoskeleton, contributing to cell shape, movement, and structural support. Distribution of Microfilaments Chemical Composition of Microfilaments (Structure of Microfilaments) Associated Proteins with Microfilaments The proper formation and regulation of actin filaments, also known ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Microinjection - Definition, Types, Principle, Steps Applications
What is Microinjection? Definition of Microinjection Microinjection is a precise technique used to introduce DNA or other genetic materials directly into a cell using a micropipette or fine glass needle. It is widely employed in genetic engineering, genome editing, and various biomedical research areas. Principle of Microinjection Microinjection operates on the fundamental principle of directly ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Microorganism - Definition, Types, Importance, Examples
What is Microorganism? Definition of Microorganism A microorganism, or microbe, is a tiny living organism that is invisible to the naked eye and can exist as single-celled entities or colonies of cells. Discovery of Microorganisms Microorganisms, despite their minuscule size, have had a profound impact on our understanding of life and disease. The journey of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Microorganisms in food Spoilage - Microbes in food spoilage
Chemical reactions that produce sensual changes that are offensive in food are controlled by a wide range of microbes that utilize food as a source of carbon and energy source. The organisms that cause these changes comprise prokaryotes (bacteria) as well as single-celled organisms that lack defined nuclei and organelles, as well as eukaryotes unicellulated (yeasts) as well as multicellular (molds) organisms that possess organelles and nuclei.
Micropipettes – Parts, Types, Applications, Techniques
Micropipette is a laboratory instrument that is used to measure and transfer very small volume of liquid in microliter range. It is highly accurate instrument and commonly used in molecular biology, chemistry and clinical diagnostic laboratory. It works by a piston mechanism which creates suction and draws liquid into a disposable plastic tip. The volume ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Microprojectile Bombardment - Definition, Components, Steps, Applications
What is Microprojectile Bombardment? Definition of Microprojectile Bombardment Microprojectile bombardment, also known as biolistics or gene gun delivery, is a method used to introduce foreign genetic material into cells or tissues by accelerating microscopic particles coated with the desired DNA, RNA, or proteins at high velocities, facilitating direct gene transfer. This technique is commonly employed ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Micropropagation - Definition, Application, Advantages, Disadvantages
What is Micropropagation? Micropropagation is a technique used for rapid multiplication of plants by using very small pieces of plant tissue. It is also referred to as plant tissue culture. In this method a small part of plant such as cells, leaves or shoot tips are taken and used as explant. The explant is grown in ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Microscope Condenser - Types, Parts, Mechanism, Uses
Microscope condenser is an optical lens system placed below the stage of the microscope between the light source and the specimen. It is used to collect the divergent light rays and concentrate them as a cone of light on the specimen. It helps in giving uniform illumination so that the light can pass through the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Microscope Nosepiece - Explained
Ever peered through a microscope and marveled at the microscopic universe it unveils? It’s like being Alice in her Wonderland, but instead of falling down a rabbit hole, you’re diving into the magical world of cells, bacteria, and more. Yet, have you ever wondered about the parts of this wonder-making machine and their functions? Let’s focus (pun ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Microscope Slides Preparation Step By Step Guide
Objects are magnified under compound microscopes are mounted onto microscope slides. Made from plastic or glass Slides measure approximately 1x3 inches in size and range from 1mm-1.2 millimeters thick.
Microsporogenesis - Definition, Process, Structure, Importance
What is Microsporogenesis? Definition of microsporogenesis Microsporogenesis is the process in which diploid microspore mother cells undergo meiosis to form haploid microspores, which eventually develop into pollen grains in plants. Where does microsporogenesis occur? Structure of Stamen Structure of microsporangium Process of Microsporogenesis in Plants In flowering plants, microsporogenesis is the process by which precursors ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Microsporum spp. culture, infections, treatment, prevention.
Hey, if you’re a student of microbiology then you’re familiar with the term Microsporum spp. but if you’re from another field I don’t think you’re familiar with the term. If you are familiar then let me know in the comment section. Now, let me explain you in a brief; There are some skin infections in ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Microtome - Principle, Parts, Types, and Uses
What is Microtome? A microtome is a laboratory device that is used for cutting very thin sections of different materials for microscopic examination. It is the instrument by which uniform slices are produced, and it is the process that helps the light or the electron to pass through the specimen so that the internal structures ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Microtubules - Definition, Structure, Functions
Microtubules Definition (What are microtubules?) Occurrence of Microtubules Microtubules Structure Chemical Composition of Microtubules Intracellular Organization of Microtubules Microtubule-Associated Proteins (MAPs) Microtubule Organizing Centres (MTOCs) Assembly and Disassembly of Microtubules Function of Microtubules Microtubules serve multiple purposes in eukaryotic cells, including the following: 1. Mechanical function 2. Morphogenesis 3. Cellular polarity and motility 4. Contraction ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Microvilli - Definition, Structure, Functions and Diagram
Microvilli are tiny, finger-like projections found on the surface of epithelial cells throughout the body, particularly in the small intestine. These structures significantly increase the surface area of the cells, enhancing their ability to absorb nutrients and other substances. The primary functions of microvilli include facilitating nutrient absorption, aiding in the process of fertilization, supporting ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Middlebrook Agar - Composition, Principle, Preparation, Results, Uses
Over the years, many media have been developed for mycobacteria cultivation. Early ones included egg-based formulations such as Lowenstein-Jensen Medium or Petragnani Medium. Later, Dubos, Middlebrook and Middlebrook created a variety of formulations that contained oleic and albumin as key components. These ingredients protect Mycobacterium against toxic agents and allow for the growth and development of tubercle bacteriailli. Cohn and Middlebrook improved the formulations of oleic acids-albumin agar to achieve a faster and more luxurious growth of Mycobacterium strains.
Migration in birds - Definition, Types, Reasons, Disadvantages
What is Bird’s Migration? Why do Birds Migrate? – Reason for migration in birds Factors Influencing Migration Stimulus: What are Migratory Species? Migratory species are defined as wild animals, including birds and mammals, whose populations or specific geographic portions of their populations regularly and predictably cross national jurisdictional lines. Here are some key points about ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Migration in Fishes - Causes, Types, Methods, Significance
What is Fish migration? Fish migration is the active, regular movement of fish populations from one place to another, often over long distances and various environments. This behavior is critical to the survival of fish and is a function of varied ecological, environmental, and biological factors. Fish migration is specific to different fish species, ranging ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Milk Pasteurization - Definition, Procedure, Types, Purpose
Pasteurisation was developed by an French Scientist known as Louis Pasteur during the nineteenth century. Pasteur realized that warming milk up to a high temperature , then cooling it quickly prior to packaging or bottling could preserve it for a longer time.
Millon’s Test - Principle, Procedure, Result, Uses
illon's test can be described as an analytical test for the identification that the amino acid tyrosine which is the sole amino acid with the phenolic group.
Mineral Nutrition in Plants - Types, Absorption, Functions
What is Mineral Nutrition? Criteria for Essential Minerals in Plants The following points outline the criteria used to determine the essentiality of an element: Criteria for Determining Essential Elements Types of Essential Nutrients Below are the primary types of essential nutrients: Essential Mineral Elements in Plants Below is a detailed explanation of these categories and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
miRNA (microRNA) Structure, Functions, Application
Micro-RNAs (miRNAs) are a family of non-coding RNAs (ncRNAs) that regulate gene expression post-transcriptionally. Since their discovery in 1993, they have been the topic of extensive research due to their role in numerous crucial biological processes. Unlike other noncoding RNAs, microRNAs are created from transcriptional units that are processed by a particular group of endonucleases. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Missense Mutation - Definition, Types, Causes, Examples
What is Missense Mutation? Definition of Missense Mutation A missense mutation is a type of point mutation in which a single nucleotide change results in the substitution of one amino acid for another in the protein sequence, potentially altering the protein’s function. Types of Missense Mutation There are two Types of Missense Mutation; Causes of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Mites - Morphology, Types, Life cycle, Importance, Examples
What are Mites? Definition of Mites Mites are tiny arachnids, usually less than 1 mm in size, that belong to the Acariformes and Parasitiformes orders. They live in various environments, such as soil, water, plants, and animals, and can be decomposers, predators, or parasites. While most mites are harmless, some can cause allergies or transmit ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Mitochondria - Definition, Origin, Structure, Functions
What are Mitochondria? Definition of Mitochondria Mitochondria are membrane-bound organelles in eukaryotic cells responsible for producing adenosine triphosphate (ATP), the primary energy currency of the cell. Organization and Distribution Mitochondria, often termed the cellular powerhouses, are intricate organelles that play a pivotal role in energy production. Their organization and distribution within cells are both diverse ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Mitochondrial DNA (mtDNA) - Structure, Replication Mechanism, Factors
HSP heavy strand promoter LSP light strand promoter MGME1 mitochondrial genome maintenance exonuclease 1 mtSSB mitochondrial single-stranded DNA-binding protein NCR noncoding region TAS termination-associated sequence What is Mitochondrial DNA (mtDNA)? Structure of Mitochondrial DNA (mtDNA) General Features of the Mitochondrial Genome Factors for mtDNA replication Mitochondrial DNA (mtDNA) replication is a critical process distinct from ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Mitochondrial Shuttles and Transporter Proteins.
Mitochondrial transporter The mitochondria contain different types of transporter proteins within the intermembrane. These transporters transfers ADP, Pi, and H atom(Substrate) from Inter membrane space to matrix and ATP (Product) from matrix to inner membrane space. There are presently three transporter protein in the inner mitochondrial membrane such as; Adenine Nucleotide Translocase It is an ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Mitosis - Definition, Phases, Significance, Functions
What is Mitosis? Definition of Mitosis Mitosis is a cellular process in which a single eukaryotic cell divides to produce two genetically identical daughter cells, each maintaining the same number of chromosomes as the parent cell. Features of Mitosis In essence, mitosis is a meticulously regulated process that ensures genetic consistency, facilitates growth, and aids ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Mode of action of antibiotics and classification.
Mode of action of antibiotics Antibiotics are used in medicine and agriculture to prevent bacterial infection. The mode of action of antibiotics is varied based on the types of antibiotics. Some of them act by limiting the growth of bacteria and some of them act by killing the bacterial cell by inhibiting cell wall synthesis. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Mode of Transmission of Diseases
Transmission of diseases is defined as the process by which an infectious agent is transferred from its natural habitat (reservoir) to a new susceptible host. It is the movement of pathogens from one individual to another or from environment to human. This process is an essential part of the chain of infection. Without transmission the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Mode of Transport Across Plasma Membrane
Types of Membrane Transport Membrane transport refers to the movement of molecules across cell membranes. This process is essential for maintaining cellular homeostasis and involves multiple mechanisms, which can be classified based on energy requirements. The types of membrane transport are broadly categorized into passive and active transport. Passive transport It is a sort of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Models of Energy Flow in a Ecosystem - Linear and Y-shaped food chains
Energy flow in an ecosystem is the process by which energy is transferred from one trophic level to the next, and it is always unidirectional. It is the sun that acts as the major source of energy for most ecosystems and this solar energy is captured by the producers through photosynthesis. It is converted into ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Modern Contraceptive Technologies
What is contraceptive? Definition of contraceptive A contraceptive is a method or device used to prevent pregnancy by intentionally interfering with the natural process of reproduction. Modern Contraceptive Technologies There are various modern contraceptive technologies available to individuals and couples for effective family planning. Here is a list of commonly used modern contraceptive technologies: Disadvanatages ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Modes of Nutrition in Protists - Types, Processes, Example
Protists are a varied category of eukaryotic creatures that are unicellular or multicellular, and can be free-living or parasitic. They have a simple cellular structure, with a nucleus and other membrane-bound organelles, and are capable of a wide variety of metabolic operations, including as photosynthesis, digesting, and locomotion. Protists are found in nearly all habitats ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Modes of Reproduction and Pollination in Crop Plants
In this article we will learn about different Modes of Reproduction and Pollination in Crop Plants. Modes of Reproduction in Crop Plants Crop plants exhibit two primary modes of reproduction: asexual and sexual. Each mode has distinct mechanisms and implications for plant breeding and agriculture. A. Asexual Reproduction Asexual reproduction does not involve the fusion ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Modified Kirby-Bauer Disc Diffusion Method
Modified Kirby-Bauer disc diffusion test is a standard method that can be used as a regular method to assess the susceptibility test to a bacterial isolate in the clinical laboratory.
Modified Thayer Martin Agar - Composition, Preparation, and Principle
Thayer and Martin have reported improvement of the Chocolate Agar formulation that contained antimicrobics vancomycin and colistin, Nystatin. These ingredients were added to limit the growth of contaminants, inhibit the development of the saprophytic Neisseria sp. and to enhance the development of the pathogenic Neisseria. Martin and Lester have added an antibiotic, trimethoprim, which made them more selective. They also demonstrated to be effective in the fight against Proteus spp. Trimethoprim lactate refrains Proteus swarming. The resultant medium is known as Modified Thayer Martin. It's a suitable and rich medium to isolate as well as cultivation of the Neisseria species. from mixed flora and suppression of other Gram-negative diplococci and gram-negative bacilli yeast and other gram-positive organisms.
Mohr Pipette - Parts, Types, Procedure, Uses
Mohr pipette (graduated pipette) is a type of graduated laboratory pipette used to measure and transfer variable volumes of liquid accurately. It is a glass (or sometimes plastic) straight tube with graduation marks along the length. It is different from volumetric pipette because it can deliver different volumes as per the required marking. It is ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Moist Heat Sterilization - Principle, Advantages, Disadvantages
Of all the options to sterilize (killing or eliminating all microorganisms, which includes the spores of bacterial growth) moist heat that is saturated steam with pressure has been the most frequently utilized and most reliable method. Moisture has more penetrating power than dry heat, and at a certain temperature, causes a greater reduction in the quantity of live microorganisms. Steam sterilization is safe cheap, low-cost, quickly microbicidal, as well as sporicidal. It quickly heats and penetrates into fabrics.
Molecular Basis of Diagnosis of Genetic Diseases - Cystic Fibrosis, Huntington’s, Sickle Cell Anaemia
The early detection of diseases is crucial for effective treatment, and molecular diagnostics serves as a pivotal tool in this regard. This term encompasses a range of diagnostic techniques that assess an individual’s health at a molecular level. Specifically, molecular diagnostics focuses on the identification and quantification of genetic sequences—often referred to as biomarkers—found in ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Molecular Biology Crossword Puzzle
Molecular biology is a branch of biology that focuses on understanding biological processes at the molecular level, particularly the interactions between various cellular systems involving DNA, RNA, and proteins. It combines principles from genetics, biochemistry, and cell biology to explore the mechanisms that govern the function and regulation of genes and how they translate into ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Molecule - Definition, Types, Characteristics, Examples
What is Molecule? A molecule is a fundamental unit in the realm of chemistry, representing a group of two or more atoms bound together by chemical bonds. These bonds arise due to interactions between the electrons of the participating atoms. Delving deeper into the nature and significance of molecules: In essence, molecules are the building ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Molisch Test - Principle, Procedure, Result, Uses
Molisch’s test is a classic chemical test used for detection of carbohydrate in a given sample. It is a highly sensitive test and it is considered as a general screening test for almost all types of carbohydrates. It is named after the Austrian botanist Hans Molisch. This test can detect monosaccharides, disaccharides and polysaccharides. It ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Monkeypox Virus - Pictures, Structure, Classification, Prevention, Treatment, Spread
What is monkeypox virus? Classification of Monkeypox Virus Morphology of Monkeypox Virus/Structure of Monkeypox Virus Genome Structure of Monkeypox Virus Genome Structure Replication Cycle of Monkeypox Virus The cycle of replication for poxviruses is different from that of other DNA viruses, is carried out in the cytoplasm within the cell that hosts them. Poxviruses infiltrate ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Monoclonal Antibodies - Definition, Types, Production, Side Effect, Applications
What are Monoclonal Antibodies? Definition of Monoclonal Antibodies Monoclonal antibodies are artificial antibodies produced in a laboratory by fusing immune cells with cancer cells. They are highly specific in targeting and binding to specific antigens on cells, making them valuable tools in medical research and treatment of diseases, including cancer. Types of monoclonal antibodies based ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Monocot and Dicot Flower - Characteristics, Structure, Functions, Examples
What is Monocot Flower? Characteristics of Monocot Flower Monocot flowers, belonging to the group of flowering plants known as monocotyledons, exhibit several distinctive characteristics that set them apart from dicot flowers. Here are the key features of monocot flowers: What is Dicot Flower? Characteristics of Dicot Flower Dicot flowers, found in the group of flowering ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Monocot and Dicot Leaves - Definition, Structure, Functions, and Examples
What are Monocot Leaves? Characteristics of Monocot Leaf Monocot leaves exhibit a range of distinct characteristics that contribute to their unique structural and functional attributes. Understanding these features is essential for students and educators who seek to grasp the differences between monocots and other plant types, such as dicots. What are Dicot Leaves? Characteristics of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Monocot and Dicot Roots - Structure, Characteristics, Functions, Examples
What is Monocot Root? What is Dicot Root? Characteristics of Monocot and Dicot Roots Monocot and dicot roots exhibit distinct structural and functional characteristics that differentiate them from each other. Here’s a comparison based on key features: Characteristics of Monocot Roots: Characteristics of Dicot Roots: Structure of Monocot and Dicot Root The structure of both ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Monocot and Dicot Seed - Characteristics, Structure, Functions, Examples
What is Monocot Seed? What is Dicot Seed? Characteristics of Monocot and Dicot Seeds Below is a detailed comparison based on key traits: Structure of Monocot and Dicot Seed The structure of monocot and dicot seeds can be understood by examining their major components. These components serve distinct roles in the development and protection of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Monocot Seed - Definition, Structure, Example, Characteristics
The essential component of sexual reproduction in plants is the seed. It is the end product of sexual reproduction and is only found in angiosperms or gymnosperms. Gymnosperms do not produce fruits or flowers, so their seeds are “naked”. Angiosperms on the other hand, have mature ovules which develop within the fruit after fertilization. Angiosperms ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Monocytes - Definition, Structure, Types, Functions
What are Monocytes? Definition of Monocytes Monocytes are a type of white blood cell that serves as an immune effector cell. They are part of the innate immune system and play a critical role in phagocytosis, antigen presentation, and cytokine secretion. Monocytes differentiate into macrophages and dendritic cells, contributing to immune defense against pathogens and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Monohybrid Cross - Definition, Steps, Examples, Practice
What is a Monohybrid Cross? A monohybrid cross is a genetic cross between individuals who differ in only one trait or allele set. It is the study of inheritance patterns for a single trait, typically with a focus on a single gene with two opposing alleles. In a monohybrid cross, two heterozygous (having two distinct ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Monosaccharides - Definition, Structure, Types, Examples
What are Monosaccharides? Definition of Monosaccharides Monosaccharides are single sugar molecules that are the basic units of carbohydrates. They are simple sugars with a variety of structures and functions in biological systems. Vant Hoff’s Rule of ‘n’ The number of imaginable isomers of any delivered compound relies upon the digit of the molecule’s asymmetric carbon ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Morphology of Bacteria - Sizes, Shapes, Arrangements, Examples With Images
What are bacteria? Characteristics Features of bacteria Bacteria, as microscopic entities, exhibit a unique assemblage of features that distinguish them from eukaryotic organisms, fundamentally setting them apart within the vast expanse of biological taxa. These features are emblematic of their evolutionary lineage and functional adaptability, encapsulating their cellular architecture, metabolic pathways, and ecological roles. Size ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Moss - Definition, Types, Life Cycle, Importance, Examples
What is Moss? Definition of Moss Mosses are small, non-vascular plants belonging to the division Bryophyta that typically form dense green mats or clumps in damp or shaded environments, lacking seeds and reproducing through spores. Habitat of Mosses Mosses, representing a diverse group within the plant kingdom, exhibit a wide range of habitat preferences. Their ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Mosses (Bryopsida) - Morphology, Characteristics, Reproduction, Uses, Examples
What is Mosses (Bryopsida)? Definition of Mosses (Bryopsida) Mosses (Bryopsida): Bryopsida, or mosses, are a class of non-vascular plants comprising around 15,000 species. Characterized by jointed teeth in their spore capsules, they reproduce through spores and thrive in damp, shady environments. Mosses play crucial roles in soil formation, moisture retention, and ecological habitats. Habit and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Most Infectious and Deadliest Diseases Caused By Bacteria
Bacterial Diseases The worldwide issue of deadly and infectious infections due to bacteria are fast becoming one of the biggest medical and scientific concerns at this moment.
Most Probable Number (MPN) Test - Principle, Procedure, Results
What is Most Probable Number (MPN) Test? Definition of Most Probable Number (MPN) Test The Most Probable Number (MPN) test is a statistical method used to estimate the concentration of microorganisms, particularly indicator organisms, in a sample by analyzing positive and negative reactions in a series of tests. It is commonly employed in water quality ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Motility - Definition, Types, Importance, Examples
What is Motility? Definition of Motility Motility refers to the ability of an organism or cell to move autonomously by utilizing metabolic energy. Types of Motility Motility, a fundamental biological phenomenon, is exhibited through various mechanisms across different organisms. The mechanisms underlying motility are intricate, reflecting the evolutionary adaptations of organisms to their environments. Here, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Mouth Pipette - Parts, Procedure, Uses, Drawbacks
Mouth pipette is a laboratory method of pipetting in which the suction is created by mouth to draw liquid into a glass pipette tube like drinking with a straw. It was used for taking and transferring small amount of liquids from one container to another container. The volume taken is controlled by the user by ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Movements in Plants - Definition, Classification, Mechanism, Examples
What is plant Movement? Classification of plants Movements Most of movements exhibited by plant can be classified as – A. Movement of locomotion The concept of locomotion encompasses the various ways in which organisms, including plants, move from one location to another. In plants, locomotion can occur at different levels—ranging from the movement of the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
mRNA - Structure, Definition, Functions, Types
What is mRNA? This sort of RNA acts by transferring genetic material into ribosomes and transmitting instructions regarding the types of proteins that body cells require. Based on their roles, these RNA types are known as messenger RNA. Therefore, mRNA plays an essential function in the transcription process or during protein synthesis. History of mRNA ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
mRNA Degradation in Prokaryotic Cells
mRNA Degradation in Prokaryotic Cells Bacterial Ribonucleases Bacteria use a vast arsenal of ribonucleolytic enzymes to degrade messenger RNA (mRNA), many of which are exclusive to certain bacterial clades. Endoribonucleases RNase E, RNase Y, and RNase III are the most prominent endonucleases implicated thus far in bacterial mRNA turnover. Exoribonucleases In order to supplement the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
MRS Broth Test - Principle, Procedure, Results,Uses
The MRS formulation was made by de Man, Rogosa, and Sharpe to replace a variable product (tomato juice) and give lactobacilli in general a good place to grow.
Mucic acid test - Principle, Procedure, Result, Uses
Mucic acid test is a biochemical test used to detect galactose and galactose containing carbohydrates such as lactose. It is also known as galactaric acid test. In this test, carbohydrate sample is heated with concentrated nitric acid which act as a strong oxidizing agent. The nitric acid oxidizes both aldehyde group and primary alcohol group ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Mucosa Associated Lymphoid Tissues (MALT) - Definition, Features, Structure, Functions and Examples
What is Mucosa Associated Lymphoid Tissues (MALT)? Features of Mucosa Associated Lymphoid Tissues (MALT) Mucosa-associated lymphoid tissue (MALT) exhibits several distinctive features: MALT’s unique features highlight its role in mucosal immunity, allowing it to mount specific immune responses at the mucosal surfaces of different tissues. By generating and secreting IgA antibodies and facilitating various immune ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Mueller Hinton Agar (MHA) Composition, Principle, Preparation
What is Mueller Hinton Agar (MHA)? Why MHA is used for antibiotic susceptibility testing (AST)? Mueller Hinton Agar (MHA) is commonly used for antibiotic susceptibility testing due to several key reasons: Mueller Hinton Agar (MHA) Principle The principle of Mueller Hinton Agar (MHA) revolves around its composition and the controlled levels of various components to ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
MUG Test – Principle, Procedure, Result, Uses
MUG test is a rapid biochemical assay used in microbiology. It is used to detect Escherichia coli (E. coli) mainly in food, water and environmental samples. It uses 4-methylumbelliferyl-β-D-glucuronide (MUG) as the substrate. The test is used to detect β-glucuronidase enzyme activity. About 96% to 97% of E. coli strains produce this enzyme. When MUG ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Multichannel Pipette - Parts, Types, Procedure, Applications
Multichannel pipette is a laboratory pipette used to measure and transfer multiple liquid volumes at the same time. It has more than one channel arranged in a straight row and each channel holds its own disposable tip. It is used when same volume is needed to be delivered into many tubes or wells in one ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Multiphoton Microscopy - Principle, Parts, Steps, Applications
Multiphoton microscopy is a cutting-edge imaging technique widely used in biology and medicine to study living tissues with minimal harm. Instead of relying on single high-energy photons like conventional microscopes, this method harnesses multiple low-energy photons that act together to produce a fluorescent signal. The trick lies in timing—when these photons strike a molecule simultaneously, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Multiple Alleles - Definition, Characteristics, Examples, Importance
What is Multiple Alleles? Definition of Multiple Alleles Multiple alleles are different forms of the same gene that exist at a specific locus on homologous chromosomes, resulting in more than two possible variations of that gene within a population. While an individual organism can have only two alleles for a gene, multiple alleles contribute to ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Mumps Virus - Definition, Replication, Structure, Genome, Pathogenesis
Mumps virus (MuV) is the causative agent of the acute infectious disease known as mumps. It is scientifically classified as Orthorubulavirus parotitidis and belongs to the family Paramyxoviridae. It is an enveloped virus having single-stranded negative sense RNA genome and the viral particle is pleomorphic in nature with size ranging from about 100–600 nm. Humans ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Muscle - Definition, Types, Structure, Functions
What is Muscle? Definition of Muscle A muscle is a specialized tissue in animals that contracts to produce force and movement, composed of fibers containing proteins that enable contraction. Structure of Muscle Types of Muscle Muscles, integral to the vertebrate anatomy, are categorized into three primary types based on their structural and functional attributes: skeletal, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Muscle Cell - Definition, Structure, Functions, Examples
What is Muscle Cell? Definition of Muscle Cell A muscle cell, or myocyte, is a specialized animal cell designed for contraction, facilitated by organized motor proteins, primarily actin and myosin. These cells can be found in various forms, including skeletal, cardiac, and smooth muscle tissues, each serving distinct functions within the body. Structure of Muscle ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Muscular Tissue - Definition, Characteristics, Structure, Types, Functions
What is Muscular Tissue? Definition of Muscular Tissue Muscular tissue is a specialized type of tissue found in animals that consists of muscle fibers capable of contracting and generating force, allowing for movement and control of body functions. Properties/Characteristics of Muscular Tissue Muscular tissue possesses several distinct properties that enable its functions and contribute to ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Mutarotation - Definition, Mechanism, Measurement, Example
What is Mutarotation? Properties of Carbohydrates Carbohydrates exhibit various properties influenced by their structural arrangements. Understanding these properties is essential to grasp concepts like mutarotation and distinguish between different isomers. Anomers, optical rotation, polarized light, optical activity When a compound is optically active, it means it has the capability to rotate the plane of linearly ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Mutation - Types, Causes, Mechanisms, Agents, Importance
What is Mutation? Definition of Mutation Mutation is a permanent change in the DNA sequence of a gene or chromosome, which can result from errors in replication or environmental factors and can affect an organism’s traits. Terminology of Mutation Characteristics of Mutation Classification and types of Mutation Causes and Mechanisms of Mutation Understanding the causes ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Mutation Breeding - Mutations in Crop Improvement
Mutations play a significant role in crop improvement by introducing genetic variability, which can be harnessed to develop new and improved crop varieties. A mutation is defined as a sudden and heritable change in an organism’s characteristics. This definition implies that the change must be inheritable, though it does not specify the genetic mechanisms underlying ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Mutualism - Definition, Types, Examples
What is Mutualism? Mutualism is simply a partnership between two animals that benefits both. This link may exist either inside the species or between species. The organisms involved in this connection are known as symbionts. All living species, including humans, animals, birds, plants, and microbes such as bacteria, viruses, and fungi, exhibit interdependence. Mutualism resembles ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Mycobacterium leprae - Habitat, Morphology, Pathogenesis, Treatment
What is Mycobacterium leprae? Scientific classification of Mycobacterium leprae Domain: Bacteria Phylum: Actinomycetota Class: Actinomycetia Order: Mycobacteriales Family: Mycobacteriaceae Genus: Mycobacterium Species: M. leprae Geographical Distribution and Habitat of Leprosy Leprosy is a disease with a varied global presence. It is most commonly found in specific regions, with a significant concentration in Southeast Asia, Africa, and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Mycobacterium tuberculosis - Pathogenesis, Virulence, Treatment
Classification of Mycobacterium tuberculosis The genus Mycobacterium comprises over 70 species, several of which are pathogenic to humans. The most notable among these is Mycobacterium tuberculosis, the bacterium responsible for tuberculosis (TB). Understanding the classification of M. tuberculosis and its related species is crucial for medical research and public health. Culture of Mycobacterium tuberculosis The ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Mycology - Defintion, History, Career, Importance
What is Mycology? Definition of Mycology Mycology is the scientific study of fungi, encompassing their genetic, biochemical, and ecological attributes, as well as their classification, benefits, and potential threats to other organisms. History of Mycology Careers Options in Mycology Mycology, the study of fungi, offers a plethora of career opportunities due to the diverse roles ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Mycoplasma pneumoniae - Habitat, Morphology, Pathogenesis, Treatment
What is Mycoplasma pneumoniae? Domain: Bacteria Phylum: Mycoplasmatota Class: Mollicutes Order: Mycoplasmatales Family: Mycoplasmataceae Genus: Mycoplasma Species: M. pneumoniae Geographical Distribution and Habitat of Mycoplasma pneumoniae Infections M. pneumoniae infections are found worldwide, with varying rates of occurrence depending on the region. This bacterium is a leading cause of community-acquired pneumonia, contributing to up to 20% ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Mycorrhiza - Definition, Types, Examples, Importance
What is Mycorrhiza? Definition of Mycorrhiza Mycorrhiza refers to the symbiotic association between specific fungi and plant roots, where the fungus aids in nutrient and water uptake for the plant, and in return, the plant provides the fungus with essential nutrients produced through photosynthesis. Types of Mycorrhizae Mycorrhizae represent diverse symbiotic associations between fungi and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Myeloperoxidase (MPO) Stain - Principle, Procedure, Result
Myeloperoxidase is a lysosomal enzyme that can be found in the azurophil granules of neutrophils and monocytes.
Myocardium - Definition, Structure, Functions
What is Myocardium? Definition of Myocardium The myocardium is the thick, muscular middle layer of the heart wall, located between the epicardium and endocardium. It is primarily composed of cardiac muscle cells (cardiomyocytes) that enable the heart to contract and pump blood throughout the body. Layers in the Walls of the Heart The heart, a ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Nagler Reaction - Lecithinase Test
Nagler's Reaction or Lecithinase test is a test in biochemistry used to detect organisms that produce the phospholipases (lecithinases) e.g. Clostridium perfringens. Its alpha (a) toxin from C. perfringens exhibits the phospholipase enzyme activity, which aids in the distinction between C. perfringens and the other Clostridium species that generate the enzyme lecithinase (C.baratti, C.absonum, C.bifermantans, C.sordelli, and C.novyi) through neutralization of lecithin C activity with an antitoxin.
Naked DNA - Definition, Applications, Advantages, Disadvantages
DNA has long been regarded as a critical component in gene therapy. A recent discovery, however, has thrown light on a strange type of DNA that persists in its surrounding environment without any protein or lipid bonds. Because of its possible applications in gene therapy trials, this phenomenon, known as “naked DNA,” has piqued the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Nanoparticle-Assisted PCR (nanoPCR) - Definition, Principle, Steps, Applications
Nanoparticle-Assisted PCR (nanoPCR) is an advanced modification of Polymerase Chain Reaction (PCR) in which small nanoparticles are added into the PCR reaction mixture. These nanoparticles are usually 1-100 nm in size and they help in better amplification of DNA. It is used to increase the efficiency, sensitivity, specificity and speed of the PCR reaction. Gold ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Native Polyacrylamide Gel Electrophoresis (PAGE)
Native PAGE is the method where proteins are separated in their original folded condition without any use of denaturing reagents. It is the process in which the movement of proteins in a polyacrylamide gel is controlled by the natural charge, size and the native conformation of the molecules. The proteins migrate through the gel matrix ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Natural killer (NK) cells - Definition, Structure, Function, Mechanism
What are Natural Killer (NK) Cells? Definition of NK Cells NK cells, short for Natural Killer cells, are a type of lymphocyte that is part of the innate immune system. They have cytotoxic activity against virus-infected cells and stressed cells like tumor cells. NK cells can recognize and eliminate abnormal cells without the need for ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Natural Resources - Meaning, Types and Characteristics
What are Natural Resources? Definition of Natural Resources Natural resources are materials and elements found in the environment, such as air, water, soil, plants, and minerals, that exist independently of human activity and are essential for sustaining life and supporting economic production. Types of Natural Resources Natural resources are categorized based on various criteria, such ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Natural Selection - Definition, Theory, Types, Examples
What is Natural Selection? Definition of Natural Selection Natural selection is the process by which organisms with traits better suited to their environment tend to survive, reproduce, and pass those beneficial traits to future generations, leading to gradual evolutionary changes in a population. History of Natural Selection Natural selection, the central concept of Darwin’s theory ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
NCBI Database and Tools - National Center for Biotechnology Information (NCBI)
The National Center for Biotechnology Information (NCBI) is a part of the U.S. National Library of Medicine, which is itself a branch of the National Institutes of Health (NIH). It provides access to a wealth of information in the fields of biotechnology and biomedicine. Some key resources offered by NCBI include: NCBI’s resources are widely ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Necrosis - Definition, Types, Mechanism, Causes
Necrosis refers to irreversible cell damage and subsequent cell death resulting from pathogenic processes. It is an uncontrolled cell death that leads to enlargement of the cell organelles, plasma membrane rupture and final lysis of the cell, and intracellular contents leaking into the surrounding tissue, resulting in tissue injury. Unlike programmed cell death known as ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
NEET Biology Syllabus
The NEET exam, or National Eligibility cum Entrance Test, is an entrance examination in India for students aspiring to pursue undergraduate medical and dental courses such as MBBS (Bachelor of Medicine and Bachelor of Surgery), BDS (Bachelor of Dental Surgery), and BAMS, BSMS, BUMS, and BHMS (Ayurvedic, Siddha, Unani, and Homeopathic Medicine courses). It is ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Negative Feedback - Definition, Mechanism, Importance, Examples
What is Negative Feedback? Definition of Negative Feedback Negative feedback is a regulatory mechanism in biological systems where the final product of a process inhibits its own production, ensuring stability and homeostasis. Negative Feedback Mechanism Importance of Negative Feedback In summary, negative feedback is a cornerstone mechanism in both biological and man-made systems. Its importance ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Negative Staining - Principle, Procedure, Result, Uses
In negative staining method, an acidic dye is used known as India Ink or Nigrosin. When the bacterial cells are exposed to this stain, due to the presence of acidic nature it readily gives up a hydrogen ion (proton) and the chromophore. As a result, the dye becomes negatively charged, now the bacterial cell surface deflects the stain.
Negative staining of Viruses - Principle, Procedure, Uses
Negative staining of viruses is the process in which the viral particles is visualized by embedding them in an electron-dense stain rather than staining the virus itself. It is the method where the background gets heavily stained while the virus remains unstained, so the particles appear as light structures against a dark surrounding. It is ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Neisseria gonorrhoeae - Pathogenesis, Diagnosis, Treatment
What is Neisseria gonorrhoeae? Morphology of Neisseria gonorrhoeae Neisseria gonorrhoeae is a Gram-negative bacterium that presents a distinctive morphology. It exhibits unique structural features that help in its identification and understanding of its pathogenic mechanisms. These structural features give N. gonorrhoeae the tools it needs to infect and persist in the human body, leading to ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Neisseria meningitidis - Pathogenesis, Diagnosis, Treatment, Prevention
What is Neisseria meningitidis? Geographical Distribution of Neisseria meningitidis Neisseria meningitidis, the bacteria responsible for meningococcal disease, is a global threat. However, its impact varies across different regions, with certain serogroups causing more significant outbreaks and epidemics than others. The distribution of this pathogen is not uniform, and the occurrence of cases is often influenced ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Nelson-Somogyi method - Principle, Procedure, Result, Uses
Nelson-Somogyi method is a classical colorimetric method used for quantitative estimation of reducing sugars like glucose in biological and industrial samples. It is a two step redox based assay where reducing sugars act as reducing agent and reaction is carried out in alkaline condition. In first step, sample containing reducing sugar is heated with alkaline ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Nematodes - Morphology, Classification, Examples
What are Nematodes? Definition of Nematodes Nematodes are elongated, unsegmented, thread-like worms, found in various environments such as soil and water. They can be free-living or parasitic, affecting plants, animals, and humans. General Characteristics of Nematodes Nematodes, often referred to as roundworms, exhibit distinct morphological and physiological features that set them apart from other organisms. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Neo-Darwinism Theory
What is Neo-Darwinism Theory? Neo-Darwinism is an integration of Charles Darwin’s theory of evolution by natural selection with Gregor Mendel’s theory of genetics. It arose from the recognition that Darwin had not adequately explained the existence of variations within species. In 1901, the Dutch botanist Hugo de Vries proposed the mutation theory of evolution, which ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Nephron - Definition, Structure, Physiology, Functions
What is Nephron? Definition of Nephron A nephron is the basic functional unit of the kidney responsible for filtering blood and producing urine. It consists of a glomerulus (a cluster of capillaries) and a tubule, which processes the filtrate by reabsorbing water and essential substances while excreting waste products. Types of Nephron Nephrons, the functional units ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Nervous System - Definition, Parts, Functions
What is Nervous System? Definition of Nervous System The nervous system is a complex network of cells and tissues that coordinates and regulates the activities of an organism by transmitting electrical signals between different parts of the body. Cells of the Nervous System Neurones Glial Cells Astrocytes Oligodendrocytes Microglia Ependymal cells Nervous System Structure and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Nervous System of Earthworm
The earthworm, a common annelid found in gardens and soil worldwide, possesses a simple yet effective nervous system that serves as a model for understanding basic neural functions in more complex organisms. Unlike vertebrates with centralized brains, the earthworm’s nervous system is segmented and decentralized, reflecting its elongated, cylindrical body structure. At the anterior end, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Nervous System of Frog
The nervous system of a frog is a complex structure that controls and coordinates the various functions and activities of the frog’s body. It can be broadly divided into two main parts: the central nervous system (CNS) and the peripheral nervous system (PNS). The nervous system of the frog is adapted for its amphibious lifestyle. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Nervous tissue - Definition, Structure, Location, Characteristics, Types, Functions
What is Nervous tissue? Definition of Nervous tissue Nervous tissue is the specialized tissue that makes up the nervous system. It is composed of neurons and glial cells, and its main function is to transmit and process electrical signals, allowing for communication and coordination within the body. Location of Nervous Tissue Characteristics Of Nervous Tissue ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Neuroglia - Definition, Classification, Development, Functions
What is Neuroglia? Definition of Neuroglia Neuroglia, or glial cells, are non-neuronal cells in the nervous system that provide support, insulation, and protection for neurons. They play crucial roles in maintaining homeostasis, facilitating communication, and responding to injury or disease within the central and peripheral nervous systems. Classification of Neuroglia Neuroglia, or glial cells, are ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Neuromuscular Junction - Definition, Structure, Steps, Significance
What is Neuromuscular junction? Definition of Neuromuscular junction A neuromuscular junction is a specialized connection between a motor neuron and a muscle fiber, where signals from the nervous system are transmitted to the muscle, resulting in muscle contraction. Structure of a Neuromuscular Junction The structure of Neuromuscular junction can be broadly divided into three parts: ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Neuron - Definition, Structure, Types, Functions
What is Neuron? Definition of Neuron A neuron is a specialized cell in the nervous system that receives, processes, and transmits information through electrical and chemical signals. How Do Neurons Work? Neurons communicate through a combination of electrical impulses and chemical signals, ensuring efficient information transfer throughout the body. By facilitating the rapid transmission of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Neuronal Membrane - Components, Movement of ions, The Resting Potential
What is Neuronal Membrane? Components of Neuronal Membrane Cytosol and Extracellular Fluid The cytosol and extracellular fluid are essential environments for neuronal function, as they provide the medium for the movement of ions, which generate the electrical signals vital to neuron activity. The presence of water, along with ions dissolved in it, plays a critical ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Neuroscience - Definition, Origin, History, Branches, Importance
What is Neuroscience? Neuroscience is the scientific study of the nervous system, with a central focus on the brain. It explores how the brain and the network of nerves function at both the cellular and system-wide levels. Neuroscience is a multidisciplinary field, integrating approaches from molecular biology, physiology, cognitive psychology, engineering, and artificial intelligence. The ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Neurotransmitters - Definition, Types, Mechanism, Functions
What are Neurotransmitters? Definition of Neurotransmitters Neurotransmitters are chemical messengers that transmit signals between neurons or from neurons to other target cells, such as muscle or gland cells, across synapses, helping regulate various functions in the nervous system. Properties of Neurotransmitter Below are key properties that define neurotransmitters and their role in neural communication. Types ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Neutralization Test - Definition, Principle, Types, Procedure, Results, Applications
What is Neutralization Test? Principle of Neutralization The neutralization principle is based on the understanding that certain antibodies or antitoxins can reduce or neutralize the various biological effects caused by enzymes, toxins, and viruses. There are two main types of neutralization tests: In both types of neutralization tests, the goal is to assess the ability ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Neutrophil - Definition, Structure, Functions
What are Neutrophils? Neutrophils Definition Neutrophils are a type of white blood cell that plays a crucial role in the immune system’s defense against infections. They are highly mobile and act as phagocytes, engulfing and destroying bacteria and other harmful substances. Neutrophils are characterized by their multi-lobed nuclei and stainable cytoplasmic granules. They are part ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
New York City Agar - Composition, Preparation, Result, Uses
NYC Agar Base medium was initially created by Fauer, Weisburd and Wilson at the New York City Department of Health to isolate the pathogenic Neisseria strains from human samples. NYC medium, designed primarily to isolate pathogenic Neisseria is also able to support the growth of mycoplasmas with large colonies or mycoplasmas T (Ureaplasma). It is a translucent medium, highly selective, allowing direct microscopic observations and presumed identification of mycoplasmas and Neisseria gonorrhoeae.
Next Generation Sequencing - Principle, Steps Involved, and Applications
Next-Generation Sequencing (NGS) is a technology for high-throughput DNA and RNA sequencing. It allows for the rapid and simultaneous analysis of millions of DNA fragments, enabling comprehensive genomic studies such as genome sequencing, transcriptome analysis, and epigenetic profiling. NGS has revolutionized the field of genomics, providing a faster and more cost-effective way to study the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Next-Generation Sequencing (NGS)- Definition, Types, Applications, Limitations
What is Next-Generation Sequencing (NGS)? Next-Generation Sequencing (NGS), also known as high-throughput sequencing, has revolutionized the field of genomics and molecular biology by allowing the sequencing of thousands to millions of DNA molecules simultaneously. It encompasses a range of different sequencing technologies, all aimed at producing large amounts of sequence data at a lower cost ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Ninhydrin Test - Principle, Procedure, Result, Uses
Ninhydrin Test is a chemical test used to detect ammonia, primary amines, secondary amines and α-amino acids in a given sample. It is done by treating the sample with ninhydrin (2,2-dihydroxyindane-1,3-dione). The reagent acts as a strong oxidizing agent and the reaction is seen after heating. During this test, amino acids undergo oxidative deamination and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Nipah Virus (NiV) - Definition, Structure, Genome, Replication, Transmission
Nipah virus (NiV) is a zoonotic virus, which means it can be transmitted between animals and humans. Fruit bats, often known as flying foxes, serve as the natural reservoir for NiV. The Nipah virus is also known to infect humans and pigs. NiV infection is related with encephalitis (brain swelling) and can result in mild ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Nitrate Reduction Test - Procedure, Principle, Result
What is Nitrate Reduction Test? Nitrate reduction test is a biochemical test used to determine the ability of bacteria to reduce nitrate (NO₃⁻) into nitrite (NO₂⁻) or into other nitrogenous compounds such as ammonia or nitrogen gas. It is the process in which nitrate acts as a terminal electron acceptor during anaerobic respiration. This test ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Nitrite Reduction Test - Principle, Procedure, Result
Nitrite Reduction Test is a biochemical test, which is used to determine that bacteria can reduce nitrite (NO2−) into other nitrogenous compounds. The nitrite is further reduced to nitric oxide (NO), nitrous oxide (N2O), nitrogen gas (N2) or ammonia (NH3). This test mainly indicates the ability of organism to remove nitrite from medium. In this ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Nitrocefin Test (Beta-Lactamase Test) - Principle, Procedure, Uses
The nitrocefin biochemical test is a sensitive technique for detecting beta-lactamase-producing strains of N. gonorrhoeae, H. influenzae, Staphylococcus spp, Enterococcus spp, and Moraxella (Branhamella) catarrhalis. Nitrocefin is the only reliable test for detecting beta-lactamase-producing Enterococcus spp.
Nitrogen Cycle - Definition, Steps, Importance, Examples
What is Nitrogen Cycle? Nitrogen Cycle Definition The nitrogen cycle is a biogeochemical process that transforms atmospheric nitrogen into usable forms for living organisms and then returns it to the atmosphere through a series of biological and chemical reactions. Stages of Nitrogen Cycle Nitrogen fixation, nitrification, assimilation, ammonification, and denitrification are the steps in the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Nitrogen Fixation - Definition, Importance, Processes
What is Nitrogen Fixation? Nitrogen fixation is the fundamental biological process and the first step in the nitrogen cycle. Certain bacterial species, such as Rhizobium, Azotobacter, etc., and other natural phenomena convert atmospheric nitrogen into ammonia (another type of nitrogen) throughout this process. Why is Nitrogen Fixation Necessary? It serves the following functions in nature: ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
NMR Spectroscopy - Definition, Principle, Steps, Parts, Uses
Nuclear Magnetic Resonance (NMR) spectroscopy is a non-destructive analytical method used for knowing the structure and composition of molecules. It is mainly used for organic compounds, biological molecules and chemical samples. It is based on magnetic nature of some atomic nuclei. Mostly hydrogen (¹H) and carbon (¹³C) nuclei are studied in this method. When sample ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Nodulation - Steps, Structure, Functions
What is Nodule? Root Nodule Types In legumes, two major forms of nodules have been identified: determinate and indeterminate. Determinate nodules Indeterminate nodules Symbiosis Leguminous family Non-leguminous Root Nodule Formation Steps – Nodulation Briefly Describe When the soil contains a low concentration of nitrogen, root nodule development begins. The two symbiotic partners rely on cell ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Non-communicable diseases - Types, Control, Examples
What is Non-communicable disease? Types of Non-Communicable Diseases Non-communicable diseases (NCDs) are chronic health conditions that do not spread from person to person. These diseases are typically long-lasting and progress slowly. They can severely impact an individual’s quality of life and contribute to high mortality rates. NCDs are divided into several categories, each affecting different ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Non-Specific Immune Response - Definition, Mechanism
What is Non-Specific Immune Response? Protection Mechanisms that Anticipate Infection 1. Anatomical Barriers 2. Physiological Barriers 3. Cellular Barriers 4. Complements Infection-Induced Defensive Mechanisms 1. Fever 2. Inflammation Response 3. Interferons FAQ References
Nondisjunction - Types, Causes, Consequences, Examples
What is Nondisjunction? Types of Nondisjunction Causes of Nondisjunction Molecular Biology of Nondisjunction Consequences of Nondisjunction The nondisjunction is the failure when chromosomes don’t separate properly during cell division (like meiosis/mitosis), causing abnormal number of chromosomes in daughter cells. Such imbalance is termed as aneuploidy, sometimes loss of one (monosomy 2n–1) or gain of one ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Nonsense Mutation - Definition, Causes, Mechanism, Examples
What is Nonsense Mutation? Definition of Nonsense Mutation A nonsense mutation is a genetic alteration that introduces a premature stop codon into the coding sequence of a gene, leading to the production of a truncated and often nonfunctional protein. Causes of nonsense mutation Nonsense mutations are a specific type of genetic mutation where a change ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Nonsporing anaerobes - Definition, Classification, Examples, Diagnosis
What are Nonsporing anaerobes? Classification of Non-Sporing Anaerobes Non-sporing anaerobes are microorganisms that thrive without the need for oxygen and do not produce spores. Based on their morphology and staining properties, these bacteria are classified into several categories. Here’s a breakdown of how they are classified according to their Gram reaction and structure: Gram-Negative Bacilli: ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Normal Flora of Mouth and Gastrointestinal Tract
The normal flora, or microbiota, in the mouth and gut refers to the community of tiny organisms—like bacteria, fungi, and viruses—that naturally live in these areas without causing harm. In the mouth, hundreds of species thrive, especially in warm, moist spots like the tongue, teeth, and gums. Common bacteria include Streptococcus, which helps break down food ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Northern Blot vs Southern Blot - Differences Between Northern and Southern blotting
What is Northern blotting? Northern blotting is a technique in molecular biology that allows for the detection of specific RNA sequences in a complex mixture, offering valuable insights into gene expression patterns. In 1977, James Alwine, David Kemp, and George Stark at Stanford University introduced a method that was cleverly named “Northern blot,” referencing ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Northern Blotting - Steps, Principle, Application, Result
Northern blotting or Northern hybridization is a widely used technique in molecular biology to determine the molecular weight of mRNA and to measure relative amounts of mRNA present in different samples and for identifying alternatively spliced transcripts and multigene family members.
Norwalk Virus (Norovirus) Symptoms, Transmission, Prevention, Treatment
Norovirus, an RNA-based virus belonging to the family Caliciviridae is an enteric pathogen that can cause significant morbidity and mortality in health medical and communities.
Nosocomial Infection - Prevention, Source, Transmission
A nosocomial infection, also known as a hospital-acquired infection, is an infection that a patient contracts during the course of receiving treatment for another condition in a healthcare setting such as a hospital, nursing home, or clinic. Nosocomial infections have been a significant problem throughout history, with reports of healthcare-associated infections dating back to the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Nostoc - Morphology, Life Cycle, Classification, Examples
What are Nostoc? Classification of Nostoc Nostoc belongs to the group of cyanobacteria, which are known for their ability to photosynthesize and fix nitrogen. The classification of Nostoc follows a systematic hierarchy that categorizes it at different taxonomic levels. Domain: Bacteria Phylum: Cyanobacteria Class: Cyanophyceae Order: Nostocales Family: Nostocaceae Genus: Nostoc Definition of Nostoc Nostoc ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Novobiocin Susceptibility Test - Principle, Procedure, Results
The novobiocin (antibiotic) differentiation disc can be used in the Novobiocin Susceptibility Test to help make a preliminary distinction between Staphylococcus saprophyticus and other coagulase-negative staphylococci (CoNS) in clinical (urinary) specimens.
Nuclear Fast Red Solution Preparation and Application
This dye has been used as a counterstain in saturated aqueous potassium alum and in a counterstain solution of 0.1% (w/v) with 5% aluminum sulfate for a Prussian Blue Stain for ferric iron. It has been used as a reagent for calcium in tissue where it forms a scarlet lake.
Nuclear Staining- Principle, Procedure, Uses
Nuclear staining is the process in which the nucleus of a cell is given artificial colour so that it becomes visible under microscope. It is the main method used in histology and cytology because the nucleus is naturally transparent and it needs specific dyes for proper contrast. The nucleus contains DNA and chromatin materials which ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Nucleoid - Definition, Functions, Characteristics
The Nucleoid (meaning it's like a nucleus) is an irregularly-shaped part of the prokaryotic cell which is home to all or most part of the gene material. The chromosome of a protokaryote is circular and its length is big in comparison to cell dimensions, which is why it has to be compressed to be able to fit. Contrary to the nucleus in a prokaryotic cell, it's not protected by the nuclear membrane.
Nucleolus - Definition, Structure, Functions
The nucleolus is a structure within a cell’s nucleus that plays a critical role in the life of a cell. This small but mighty organelle is responsible for several important functions, including the synthesis and assembly of ribosomes. In this article, we will explore the nucleolus, its structure and function, and its role in maintaining ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Nucleoside - Definition, Types, Structure, Functions
What is Nucleoside? A nucleoside is a molecule composed of a pentose sugar linked to a nitrogenous base or glycosylamine. It can be considered as a nucleotide without a phosphate group. Nucleosides are essential components of DNA and RNA, playing a vital role in the storage and transmission of genetic information. In DNA, the nucleosides ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Nucleotide Biosynthesis Pathways - Salvage pathway and De novo synthesis
What is a Nucleotide? A nucleotide is a fundamental component of nucleic acids, such as DNA and RNA. It is composed of three main parts: a pentose sugar, a nitrogenous base, and a phosphate group. Nucleotides are often referred to as the building blocks of DNA due to their crucial role in forming the DNA ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Nucleotide Databases - Definition, Types, Examples, Uses
Welcome to the fascinating world of nucleotide databases, where the intricacies of genetic information come to life! Nucleotide databases are invaluable resources that house a vast collection of nucleotide sequences from various organisms, providing a wealth of information about DNA and RNA molecules. These databases serve as essential tools for scientists, researchers, and students delving ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Nucleotides and Nucleosides - Definition, Structure, Function, Types
What is Nucleotide? Nucleotide Structure The structure of a nucleotide is simple, but the structure they can make when they come together is complicated. This molecule is made up of two strands that wrap around each other. Hydrogen bonds hold the structure together in the middle. Each nucleotide has a specific shape that makes this ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Nucleus - Definition, Structure, Diagram, and Functions
Cell biology describes the nucleus is the big organelle, with a membrane-bounded structure that holds the genetic material form of numerous linear DNA molecules arranged into chromosomes, which are the structures that make up the nucleus. In the field of cell biology, the nucleus's function is to serve as the central point of control for the cells. This is due to the fact that it holds the genetic material that code for the essential functions of cells.
Nutrient Agar - Principle, Composition, Preparation, Results, Uses
Nutrient agar is an essential culture medium that is commonly used for the cultivation of non-fastidious microorganisms. It can also be used to ensure quality control and quality prior to serological or biochemical tests.
Nutrient Transport Mechanism in Plants
Nutrient transport in plants is a crucial process that ensures the distribution of essential minerals and organic compounds necessary for growth, development, and metabolic functions. This transport occurs through various tissues, primarily the xylem and phloem, each serving distinct roles in the movement of nutrients. The following points outline the key mechanisms and pathways involved ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Nutritional types of bacteria - Classification of bacteria based on Nutritional Requirement
Nutritional Requirement All forms of life, from microorganisms to human beings, share certain nutritional requirements for growth and normal functioning. The following observations substantiate this statement and also illustrate the great diversity of nutritional types found among bacteria. Energy Electron Carbon Nitrogen Oxygen Sulfur Phosphorus Metal Ions Vitamins and vitamin-like compounds Water Classification of bacteria ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Nylander’s Test for Carbohydrates - Principle, Procedure, Result
Nylander’s Test is a chemical test. It is used for qualitative detection of reducing sugar mainly glucose in biological fluids like urine. It was developed in 1880s by Emil Nylander. It was used earlier as screening test for diabetes mellitus and other metabolic disorder. It is based on oxidation reduction reaction. In this test carbohydrate ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Obelia - Definition, Structure, Metagenesis, Reproduction
Sea fur is an alternative term for Obelia. Obelia has a delicate, semitransparent, pale to light-brown hydroid colony. It consists of stems with vertical branches called hydrocauli and root-like branches called hydrorhiza. In order to complete its life cycle, Obelia’s asexual and sexual generations alternate. The life cycle of Obelia regularly alternates between hydroid and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Objective Lenses - Principle, Types, Specification, Uses
Objective lens is the most important lens of an optical microscope, which is kept closest to the specimen. It is the first lens that collects the light coming from the specimen (emitted or reflected). It bends the light rays and forms a real, magnified image at an intermediate image plane. This primary image is then ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Obligate Anaerobes - Definition, Identification, Mechanism, Uses, Examples
What is Obligate Anaerobes? Definition of Obligate Anaerobes Obligate anaerobes are microorganisms that exclusively thrive in oxygen-deprived environments and are adversely affected or killed by the presence of oxygen. Oxygen sensitivity of Obligate Anaerobes How Obligate Anaerobes are identified? The identification of obligate anaerobes is achieved through a systematic approach involving the use of thioglycollate ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Ocular Micrometer - Definition, Principle, Parts, Applications
What is Ocular Micrometer? The ocular micrometer, which many student’s usually call as the eyepiece micrometer, is basically a small circular glass disk that stay fitted inside the microscope eyepiece, and it carry a tiny ruled scale engraved on it. In general terms, this scale look like a simple series of line’s, but it is ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
OF (Oxidation-Fermentation)Test - Principle, Purpose, Procedure
OF (Oxidation-Fermentation) test is a biochemical test used to find out how a bacterium utilize carbohydrate (mainly glucose). It was developed by Hugh and Leifson (1953). It differentiates organisms into fermentative type and oxidative type based on acid production in anaerobic and aerobic condition. It is done in a semi-solid OF medium having high carbohydrate ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Oil Immersion Technique - Objectives, Procedure, Types
Oil immersion technique is a light microscopic technique used for increasing the resolving power of microscope at high magnification. In this technique, a special transparent oil is used between the cover glass and the objective lens. This oil is called immersion oil. It is mostly used with oil immersion objective lens. Normally, when light passes ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Okazaki Fragments - Formation, Enzymes, Importance
Okazaki fragment is the short segment of DNA that is synthesized on the lagging strand during DNA replication. It is formed because the DNA polymerase can extend the new strand only in the 5’–3’ direction, so the strand that is oriented in the 3’–5’ direction is produced in a discontinuous manner. It is initiated by ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Omega-3 Fatty Acids - Types, Structure, Sources, Functions
What is Omega-3 Fatty Acid? Definition of Omega-3 Fatty Acid Omega-3 fatty acids are essential polyunsaturated fatty acids (PUFAs) characterized by a double bond three atoms away from the terminal methyl group in their chemical structure, crucial for human health, found in plants (as α-linolenic acid, ALA) and marine sources like algae and fish (as ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
One Step Growth Curve of Virus -Phases, Significance
The One Step Growth Curve was first described by Max Delbriick and Emory Ellis in 1939 and started modern bacteriophage research.
Onion Cells Under a Microscope
Onion cells under a microscope offer a classic and revealing glimpse into plant anatomy, showing clear rectangular cells with defined walls and central nuclei, and that somewhat large central vacuole, as students often note. Since the onion bulb isn’t meant for photosynthesis its epidermal cells lack chloroplasts, making its cell membrane, cytoplasm, nucleus positioned at ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
ONPG Test - Principle, Procedure, Result, Uses
ONPG test is a rapid biochemical test used in microbiology to detect the presence of β-galactosidase enzyme in bacteria. It is used to identify organisms which can produce β-galactosidase but may not ferment lactose in routine lactose tests. Normally lactose fermentation needs two enzymes. One is lactose permease which transports lactose inside the cell. Another ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Operon - Structure, Definition, Types, Functions
What is Operon? Definition of Operon An operon is a functional unit of DNA in prokaryotes that contains a cluster of genes under the control of a single promoter, allowing for coordinated expression of related genes. General structure of Operon The operon is a fundamental genetic regulatory system found in prokaryotes, consisting of several key ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Opsonization - Definition, Mechanism, Types, Examples
What is Opsonization? Opsonization Definition Opsonization is the process of coating antigens with molecules called opsonins, which mark them for recognition and engulfment by immune cells, enhancing the efficiency of the immune response. Mechanism of Opsonization The mechanism was usually divided into two main pathways, antibody-mediated opsonization and complement-mediated opsonization. Both systems worked separately but ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Optochin Susceptibility Test - Principle, Objective, Procedure And Results
Streptococcus pneumoniae can be distinguished from other viridans streptococci by showing that it is sensitive to optochin, dissolves in bile, reacts with a specific DNA probe, or has species-specific capsular polysaccharides.
Organic Waste Recycling - Definition, Characteristics, Methods, Steps, Significance
Organic waste adds to greenhouse gas emissions, soil and water contamination, and other environmental problems. Composting, anaerobic digestion, and vermicomposting are among the methods that can be used to manage organic waste. What is Organic waste? Organic waste refers to any waste material that originates from living organisms or their byproducts. This waste can be ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Organisation of Shoot Apex and Different Theories
What is Shoot Apex? Structure and Organisation of Shoot Apex The shoot apex, located at the tip of the stem, serves as a critical region for growth and development in plants. This structure is composed of meristematic cells, which are responsible for the formation of lateral branches, leaves, flowers, and other vital components. The organization ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Organism - Definition, Types, Structure, Examples
What is Organism? Definition of Organism An organism is a living entity composed of one or more cells, capable of growth, reproduction, and response to stimuli, functioning as an individual life form. Structure of an Organism Every organism, whether unicellular or multicellular, is fundamentally composed of cells, the basic structural and functional units of life. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Organization of Root Apex - Apical cell theory, Histogen theory, Korper-Kappe theory
What is root apex? Root Apical Meristem (RAM) The root apical meristem (RAM) represents a vital component in the growth and development of plant roots. Situated at the sub-apical region of the root’s apex, this area is responsible for generating the internal tissues of roots, which are crucial for their function. The RAM is characterized ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Organs of Immune System – Lymphoid Organs
Overview of Immune System Innate Immune System Adaptive (Acquired) Immune System a. Active Immunity b. Passive Immunity Organs of the Immune System Organs that function as barriers The skin and mucous membranes are the first line of protection against pathogens entering the body from the outside. They serve as a physical barrier with the assistance ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Oriental Fermented Foods
Molds are used in the manufacture of the majority of the Oriental fermented dishes listed here. In the starter, known as koji in Japan and chou in China, moulds serve as suppliers of hydrolytic enzymes, including amylases to hydrolyze the starch in the grains, proteinases, lipases, and several more. For the most part, starters are ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Orientation Patterns of Behaviour
What is Orientation? In animal behavior, orientation refers to the ability of an animal to determine and maintain a specific direction or position in relation to its environment. It involves the animal’s ability to perceive and respond to various stimuli, such as light, gravity, magnetic fields, landmarks, and chemical cues, in order to navigate and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Origin and Evolution of Man
Origin and Evolution of Man Features of Man The evolution of humans has brought about several distinctive features that set them apart from other primates. These progressive features have contributed to the unique characteristics and capabilities of human beings. Let’s explore these features in more detail: One of the most remarkable features distinguishing humans from ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Origin of Chordates - Dipleurula concept, Echinoderm theory
It is considered that the origin of chordates is deeply associated with the deuterostome lineage, where the early ancestors are sharing characters with hemichordates and echinoderms. In this group, the basic features such as a notochord, dorsal hollow nerve cord (DHNC), pharyngeal gill slits, post-anal tail and endostyle are present at some stage of development. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Origin of Tetrapods (Amphibia)
Tetrapoda: Evolution from Fish to Land-Dwelling Vertebrates Tetrapods are a group of vertebrates that includes amphibians, reptiles, birds, and mammals. The first tetrapods evolved during the Devonian period from crossopterygian fishes, which were adapted to shallow, marshy environments. These fishes already possessed some features that made their transition to land possible. The transition from aquatic ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Ornamental Plants - Definition, Characteristics, Types, Examples
What are Ornamental plants? Characteristics features of Ornamental Plants Below are the key characteristics and features that define ornamental plants: Classification / Types of Ornamental plants Ornamental plants are classified into several categories based on various criteria, such as growth habit and structure. This classification aids in understanding their features and cultivation requirements, ultimately enhancing ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Ornithine Decarboxylase Test - Principle, Procedure, Result
What is the ornithine decarboxylase test? Ornithine decarboxylase test is a biochemical test used for identification and differentiation of Gram-negative bacteria mainly Enterobacteriaceae family. It is used for differentiating closely related organisms like Klebsiella and Enterobacter species and also for identifying Proteus. It is the test in which microorganism ability is measured to produce enzyme ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Osazone Test - Principle, Procedure, Result, Uses
What is Osazone Test? Osazone test is a chemical test which is used for detection and differentiation of reducing sugars. Reducing sugar contains free carbonyl group (or potentially free carbonyl group) and it gives positive reaction. This test was developed by Emil Fischer. It is based on formation of osazone crystals and these crystals are ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Osmoregulation - Definition, Types, Mechanism, Importance
What is Osmoregulation? Definition of Osmoregulation Osmoregulation is the process by which organisms regulate the balance of water and electrolytes in their body to maintain homeostasis, ensuring that their fluids are neither too diluted nor too concentrated. This process is essential for proper cellular function and overall stability in various environmental conditions. How Osmoregulation Works? ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Osmosis - Definition, Types, Mechanism, Significance, Examples
What is Osmosis? Definition of Osmosis Osmosis is the spontaneous movement of solvent molecules, typically water, through a selectively permeable membrane from a region of lower solute concentration to a region of higher solute concentration, aiming to equalize solute concentrations on both sides. How Does Osmosis Work? Osmosis is a fundamental process that facilitates the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Osmotic Pressure - Definition, Equations, Types, Importance, Examples
What is Osmotic Pressure? Definition of Osmotic Pressure Osmotic pressure is the force required to prevent the flow of solvent molecules through a semi-permeable membrane due to differences in solute concentrations between two solutions. Osmotic Pressure Equation Osmotic pressure, a fundamental concept in the study of solutions, can be quantitatively described using a specific equation. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Ossification (Bone Growth and Development) - Definition, Steps, Importance
What is Ossification? Definition of Ossification Ossification, also known as osteogenesis, is the process of bone formation, where mesenchymal cells differentiate into osteoblasts that lay down new bone tissue. There are two types of ossification: intramembranous, which directly converts mesenchymal tissue into bone, and endochondral, which involves the transformation of mesenchymal tissue into a cartilage ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Osteichthyes - Characteristics, Classification and Examples
Kingdom Animalia Phylum Chordata Subphylum Vertebrata Division Gnathostomata Superclass Pisces Class Osteichthyes General Characteristics of Osteichthyes Osteichthyes, or bony fishes, exhibit a range of general characteristics that define this diverse class of vertebrates: These general characteristics contribute to the diversity and adaptability of bony fishes, allowing them to thrive in various aquatic habitats and play ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Ouchterlony Double Immunodiffusion Method
Ouchterlony Double Immunodiffusion Method is a qualitative immunological technique that is used to study antigen–antibody reaction in vitro. It is the process in which both antigen and antibody are allowed to diffuse freely in a semi-solid medium usually agar or agarose gel. This method was developed by Örjan Ouchterlony and it is commonly used for ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Ovaries - Definition, Structure, Hormones, Functions
What is Ovary? Definition of Ovary The ovary is a reproductive organ in females that produces eggs and secretes hormones like estrogen and progesterone, essential for regulating the menstrual cycle and fertility. Anatomy of the Ovary The ovary is a crucial organ in the female reproductive system, responsible for producing eggs and secreting hormones essential ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Overview of Bacillus anthracis
Bacillus anthracis the most well-known pathogen in the Genus Bacillus is the cause of a severe zoonotic illness known as anthrax. Anthrax is a primary disease that affects domestic and wild herbivores. It is among the most frequently encountered bioterrorism agents that has been implicated before in the Sverdlovsk the anthrax outbreak of 1979 as ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Ovule - Definition, Structure, Types, Diagram, Functions
What is Ovule? Definition of Ovule An ovule is a small structure within the ovary of a plant that contains the female gamete (egg cell) and develops into a seed after fertilization. Location of Ovule The location of ovules in flowering plants is intricately tied to their role in reproduction and is defined by various ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Ovule Culture - Principle, Protocol, Importance and Applications
What is Ovule Culture? Principle of Ovule Culture Protocol of Ovule Culture The following detailed steps provide a comprehensive guide for executing ovule culture effectively. Importance of Ovule Culture Below are specific aspects detailing the importance and applications of ovule culture.
Oxidase Test - Principle, Procedure, Result, Application
The oxidase test is a biochemical reaction that assays for the presence of cytochrome oxidase, an enzyme sometimes called indophenol oxidase. In the presence of an organism that contains the cytochrome oxidase enzyme, the reduced colorless reagent becomes an oxidized colored product .
Oxidation Pond - Definition, Mechanisms
What is Oxidation Pond? Mechanism of Waste Treatment Understanding the following processes will facilitate comprehension of the oxidation pond’s mechanism or operation. Based on the two mechanisms described above, it is evident that algae and bacteria fulfil one other’s needs. The bacteria oxidise the biodegradable organics with the oxygen generated by the algae. The bacterial ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Oxidative Phosphorylation - Definition, Steps, Enzymes, Factors
What is Oxidative Phosphorylation? Definition of Oxidative Phosphorylation Oxidative phosphorylation is a metabolic process that occurs in the mitochondria, where energy derived from the electron transport chain is used to produce adenosine triphosphate (ATP) from adenosine diphosphate (ADP) and inorganic phosphate, with oxygen acting as the final electron acceptor. Sites of oxidative phosphorylation in ETC ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Oxidizing Agent - Definition, Factors, Applications, Examples
What is Oxidizing Agent? An oxidizing agent, scientifically termed as an oxidant or oxidizer, is a pivotal component in redox (reduction-oxidation) chemical reactions. It functions by accepting or gaining electrons from another substance, known as the reducing agent or reductant. This electron transfer results in the oxidizing agent undergoing a reduction, which is characterized by ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Oxygen Toxicity - Mechanism, Damages, Protective Mechanism
Oxygen Toxicity Formation of reactive oxygen species (ROS) Various cellular enzymes catalyze chemical reactions involving molecular oxygen; some of these reactions can result in addition of a single electron to an oxygen molecule, thereby forming superoxide radical. Superoxide radicals can inactivate vital cell components. However, recent studies suggest that their greatest detrimental action is through ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Ozone Treatment as a Food Preservation Technique
What is Ozone Treatment? Properties of ozone Ozone, with the chemical formula O3, is a molecule consisting of three oxygen atoms bonded together. It possesses several unique properties that contribute to its wide range of applications and effects: These properties make ozone a valuable tool in various industries, including water treatment, air purification, food preservation, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Pyramid of Numbers - Definition, Types, Importance, Examples
What is Pyramid of Number? The Pyramid of Numbers is a graphical representation used in ecology to illustrate the distribution of various species in different trophic levels of a food chain. This pyramid provides a quantitative analysis, showing the number of individual organisms present at each trophic level. Unlike other ecological pyramids which might consider ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
P-value - definition, significance, formula, table, finding p-value
Definition of p-value The p-value, or estimated probability represents the most reliable probability of providing the lowest amount of significance, that the null hypothesis isn’t the case. Formula of p-value How to find p-value? P-values can be determined through comparing test results against the table of p-values for various scores. The scores calculated by the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
PAM Sequence (Protospacer adjacent motif) - Definition, Functions, Properties
What is PAM Sequence (Protospacer adjacent motif)? Protospacer Adjacent Motif, or PAM, is a type of two-factor authentication that tells Cas to only cut the foreign DNA that is invading. Properties of PAM sequence Spacers/protospacers PAM sequences Functions of PAM Sequence 1. Role of PAM in spacer acquisition 2. Role of PAM in interference 3. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Pancreas - Diagram, Structure, Hormones, Functions, Disorders
What is Pancreas? Definition of Pancreas The pancreas is a vital organ in the human body that serves dual functions: it acts as an endocrine gland by producing hormones such as insulin and glucagon to regulate blood sugar levels, and as an exocrine gland by secreting digestive enzymes and bicarbonate into the small intestine to ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Papanicolaou Staining (Pap stain) - Principle, Procedure, Results, Applications
Papanicolaou stain can also be referred to as the pap stain, and the process that causes the stain is referred to as a pap smear.
Paper Chromatography - Principle, Types, Instrumentation, Steps
Paper Chromatography is a simple analytical technique used to separate and identify the components present in a chemical mixture. It is based on the principle of partition, where the substances are distributed between stationary phase and mobile phase. In this method, the stationary phase is usually a cellulose filter paper containing moisture within its fibers, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Papovaviruses - Overview
Human Papillomaviruses Classification On the basis of DNA homology, tissue tropism, and relationship with oncogenesis, the HPVs have been categorised into 16 groups (A–P), encompassing at least 70 kinds, containing a total of at least 100 types. Human infections caused by papovaviruses Papillomavirus Polyomavirus Morphology of Human papillomaviruses Human papillomaviruses have the following characteristics: Viral ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Paramecium Cell Definition, Characteristics, Classification, Movement, Diagram.
What is Paramecium? Definition of Paramecium Paramecium is a microscopic, single-celled organism with hair-like structures called cilia, found in various aquatic environments, often studied for its role as a model organism in biological research. Paramecium Scientific classification Paramecium is divided into this following phylum and subphylum; Domain: Eukaryota Clade: SAR Infrakingdom: Alveolata Phylum: Ciliophora Class: ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Paramecium Under Microscope
What is Paramecium? Requirement for Observation of Paramecium Under Microscope The observation and study of Paramecium, a type of microscopic organism, require specific tools and materials to ensure accurate and detailed examination. These components play a crucial role in microscopy, allowing scientists and researchers to gain insights into the biology and behavior of Paramecium. Here ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Parasexual cycle in Fungi
The Parasexual Cycle is defined as a cycle in which plasmogamy, karyogamy and meiosis (haploidisation) take place but not at a specified time or at specified points in the life-cycle of an organism.
Parasitic adaptations in helminthes - Morphology, Physiological, Life cycle, Immunological adaptations
Helminthes are large multicellular invertebrate organisms which are commonly referred to as worms. The term “helminth” simply means worm. These organisms are eukaryotic in nature and possess well developed organ systems. In adult stage they are usually visible to the naked eye and their size may range from few millimeters to more than one meter ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Parasitic Vertebrates - Cookiecutter shark, Candiru, Hood Mockingbird and Vampire bat
What are Parasitic Vertebrates? Cookiecutter shark (Isistius brasiliensis) Domain: Eukaryota Kingdom: Animalia Phylum: Chordata Class: Chondrichthyes Subclass: Elasmobranchii Subdivision: Selachimorpha Order: Squaliformes Family: Dalatiidae Genus: Isistius Species: I. brasiliensis The cookiecutter shark (Isistius brasiliensis) is a distinctive species of deep-sea shark known for its unique feeding behavior and wide geographic range. Primarily found in tropical and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Parasitism - Definition, Types, Examples
What is Parasitism? Definition of Parasitism Parasitism is a symbiotic relationship between two species in which one organism, the parasite, derives benefits at the expense of the other organism, the host, often causing it harm. Mechanisms of Dispersal Types of Parasitism Parasitism, a multifaceted biological interaction, can be classified based on various criteria, ranging from ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Parasporal Crystal Stain - Principle, Procedure, Result
Production of parasporal crystals is a unique ability (among Bacillus species) of Bacillus thuringiensis. This stain is a means of rapid identification of the species.
Parathyroid Gland - Structure, Hormones, Functions, Disorders
What is Parathyroid Gland? Definition of Parathyroid Gland The parathyroid glands are small endocrine glands located behind the thyroid gland that regulate calcium levels in the blood by secreting parathyroid hormone (PTH). This hormone helps maintain calcium balance by influencing the bones, kidneys, and intestines. Anatomical Location of Parathyroid Gland The parathyroid glands are small, flattened, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Parenchyma Tissue - Characteristics, Structure, Types, Functions
What is Parenchyma Tissue? Characteristics of Parenchyma Parenchyma tissue is a crucial component in plant biology, characterized by its living cells that play significant roles in various physiological processes. The following points outline the main characteristics of parenchyma tissue, highlighting its functions and structural attributes. Structure of Parenchyma Cells Parenchyma cells represent a fundamental component ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Parental Care in Amphibia - Protection by Nests and Direct Carrying by Parents
Parental Care in Amphibia 1. Protection by Nests, Nurseries, or Shelters in Amphibians Amphibians have evolved a variety of innovative strategies to protect their vulnerable eggs and larvae from predation. These methods often involve creating safe microhabitats that shield offspring until they are capable of defending themselves. The protection by nests, nurseries, or shelters can ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Parental Care in Fishes - Different Methods with Examples
Different Types Of Parental Care In Fishes Include 1. Deposition of Eggs Into Self-Made Nest Certain fish species exhibit the behavior of preparing nests to ensure the safe deposition and protection of their eggs, as well as the development of their young ones. The construction of these nests involves the participation of either males or ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Parthenogenesis - Definition, Types
What is parthenogenesis? – Parthenogenesis Definition Natural Parthenogenesis The regular, continuous, and natural occurrence of parthenogenesis in the life cycles of certain animals is known as natural parthenogenesis. There are two types of natural pathogenesis: complete and incomplete. (i) Complete parthenogenesis (ii) Incomplete parthenogensis Complete and incomplete type of natural parthenogenesis The two forms of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Parts of a Microscope and Their Functions
What are Microscopes? A microscope can define as an optical or electronic Instrument that is used for observing objects’ that are too small for the naked eye, and it gives a look into structures in biology/physics etc. In general terms, the device is characterized by lenses, illumination sources, and also by Magnification system’s that allow ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Parvovirus - Definition, Classification, Morphology, Diagnosis
What is Parvovirus? Classification of Parvovirus Parvovirus B19 Parvovirus B19, or B19 virus, is the causal agent of erythema infectiosum (“fifth disease”; it was fifth of the six identified exanthematous disorders of childhood), a minor viral sickness of children, as well as polyarthralgia–arthritis syndrome in immunocompetent adults. Morphology of Parvovirus B19 B19 viruses manifest the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Passive Immunity - Definition, Types, Characteristics, Examples
What is Passive Immunity? Definition of Passive Immunity Passive immunity is the temporary protection against infectious diseases provided by the introduction of pre-formed antibodies from an external source, rather than the body’s own immune response. Characteristics of Passive Immunity Passive immunity possesses several distinct characteristics that differentiate it from active immunity: Types of Passive Immunity ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Passive Immunization - Definition, Advantages, Disadvantages, Examples
What is Passive Immunization? Definition of Passive Immunization Passive immunization refers to the direct administration of pre-formed antibodies or immune cells from another individual to provide immediate protection against infectious agents or toxins. Process of Passive Immunization Passive immunization involves the direct transfer of pre-formed antibodies or immune cells from a donor to an individual ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Passive Transport - Definition, Types, Examples
Passive Transport Definition What is Diffusion? Factors affects the rate of Diffusion Characteristics of Passive Transport Overall, passive transport allows for the movement of molecules or ions across the cell membrane without requiring the cell to expend energy. Types Of Passive Transport There are four types of passive transport: 1. Simple Diffusion Factors affecting on ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Pasteurization - Definition, Types, Process, Uses
What is Pasteurization? Definition of Pasteurization Pasteurization is a process of treating food and beverages with mild heat to eliminate pathogens and extend shelf life while minimizing changes to nutritional quality and sensory characteristics. History of Pasteurization Purpose of Pasteurization The purpose of pasteurization is to achieve several important objectives in food preservation and safety. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Patents - Definition, Objectives, Rights, Process, Examples
What is Patent? Definition of Patent A patent is a government-granted right that allows an inventor to exclude others from making, using, or selling an invention for a specified period, typically 20 years, in exchange for publicly disclosing the details of the invention. Historical Background of Patents The concept of patents has evolved significantly over ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Pathogen Virulence Factors Definition and Pathogenicity
Virulence Definition Virulence define the intensity of a pathogen to cause disease. The Virulence varies among different microbial species. Virulence enables the microorganism to carry a specific character which can damage the tissue of the host cell. Virulence helps the microorganism to better survive its residency in the host. The virulence property of an organism varies ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Pauly’s Test - Definition, Principle, Procedure, Uses
What is Pauly’s Test? Pauly’s test is a biochemical colour test which is used for detection of tyrosine and histidine amino acid in proteins. It is a specific colourimetric assay. It was given by Hermann Pauly (German chemist) in 1904. It is based on azo-coupling reaction. In this process sulfanilic acid is diazotized in cold ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
PCR Machine - Principle, Parts, Types Steps, Applications
PCR Machine is an automated laboratory instrument that is used to amplify small segment of DNA or RNA into millions or billions of copies. It is also known as thermal cycler or DNA amplifier. It contains a thermal block where reaction tubes containing sample, primers, nucleotides and polymerase enzyme are placed. The machine changes the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Pearl formation in bivalves
Pearls are organic gemstones produced by certain bivalve mollusks, such as oysters and mussels. These remarkable structures form in response to irritants that enter the mollusk’s shell. When an irritant, such as a parasite or grain of sand, enters the mollusk, it triggers a defensive mechanism. The mollusk secretes layers of aragonite and conchiolin, substances ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Pediculus Humanus (Lice) - Morphology, Types, Life cycle, Management
What is Pediculus Humanus (Lice)? Lice are small, parasitic insects that belong to the order Phthiraptera and are known for their obligatory ectoparasitic lifestyle. Over 550 species of lice have been identified worldwide, and they typically infest humans, cattle, and other animals. These insects are dorsoventrally flattened and wingless, making them well-adapted to their parasitic ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Pedigree Analysis - Types, Chart, Symbols, Methods, Examples
What is Pedigree? What is Pedigree Analysis? Pedigree Analysis Definition Pedigree analysis is a genetic tool used to trace the inheritance patterns of traits or disorders through generations of a family, helping to predict the likelihood of their occurrence in offspring based on familial history. Basic Steps of Pedigree Analysis Pedigree analysis involves several systematic ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Pedigree Method – Procedure, Applications, Advantages, Disadvantages
What is Pedigree Method? Definition of Pedigree Method The pedigree method is a plant breeding technique where individual plants from segregating generations are selected and documented through detailed pedigree records. This method aims to develop genetically uniform pureline varieties by maintaining and selecting plants until progenies exhibit no further genetic variation. Procedure for the Pedigree ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Penicillin Production
In 1929, Alexander Flemming found that the mould Penicillium notatum secreted penicillin. However, the lytic agent appeared to be too unstable to be useful. In 1939, however, when Chain refined the active ingredient, termed penicillin, it proved to be extraordinarily powerful against some illnesses. Penicillin is not a single chemical entity, but rather a series ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Penicillin Under a Microscope
What is Penicillium? Requirements for Penicillium Microscopy Procedure of Penicillium Microscopy General Tips When embarking on the fascinating journey of Penicillium microscopy, there are some essential tips to ensure a successful and rewarding experience. By following these guidelines, researchers and enthusiasts can unlock the hidden world of mold and delve into the intricate details of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Penicillium chrysogenum - Morphology, Habitat, Characteristics
Kingdom: Fungi Division: Ascomycota Class: Eurotiomycetes Order: Eurotiales Family: Trichocomaceae Genus: Penicillium Species: P. chrysogenum Characteristics and significance Habitat of Penicillium chrysogenum Morphology of Penicillium chrysogenum Genome structure Cultural characteristics of Penicillium chrysogenum Penicillium chrysogenum has distinct cultural characteristics that can help identify it in a laboratory setting. Here are some of its cultural characteristics: Life Cycle of Penicillium chrysogenum ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Pentose Phosphate Pathway - Definition, Steps, Regulation, Importance
What is Pentose Phosphate Pathway? Pentose Phosphate Pathway Definition The Pentose Phosphate Pathway (PPP) is a metabolic pathway parallel to glycolysis that produces NADPH, pentoses (5-carbon sugars), and ribose 5-phosphate, a precursor for nucleotide synthesis. It plays a crucial role in both cellular biosynthesis and the defense against oxidative stress. Location of Pentose Phosphate Pathway ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Peptide Bond - Definition, Structure, Formation, Hydrolysis, Examples
What Is a Peptide Bond? Definition of Peptide Bond A peptide bond is a covalent bond formed between the α-carboxyl group of one amino acid and the α-amino group of another, resulting in the release of a water molecule. This bond links amino acids together in a peptide or protein chain and is characterized by ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Peptone Water - Principle, Composition, Preparation, Uses
Peptone Water is a type of broth medium. This media is mainly used to grow the organism and is also used as a base for determining carbohydrate fermentation patterns of non-fastidious organisms. It is also used to detect indole production by the organism.
Peptone Yeast Dextrose Broth (Cantino) - Composition, Principle, Preparation, Uses
Peptone Yeast Extract Broth Based Media are enriched nonselective media which include hemin and vitamin K to aid in the recovery of aggressive organisms like Prevotella Spp., Porphyromonas species, as well as the Bacteroides fragileis group.
Periderm - Structure, Development and Function
What is Periderm? Structure of Periderm The periderm is a secondary tissue that replaces the epidermis during secondary growth in plants, providing a protective barrier. It consists of three main components: the phellogen (cork cambium), phellem (cork), and phelloderm. These three layers arise through a sequential process and perform distinct functions in the plant’s protective ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Periodic Acid-Schiff (PAS) Staining - Principle, Procedure, result, Uses
Periodic Acid-Schiff (PAS) staining is a histochemical method used to demonstrate carbohydrate and carbohydrate-rich compounds in tissue sections. It is the process where periodic acid is used to oxidize the 1,2-glycol groups of polysaccharides, mucin, glycogen and fungal cell wall components into aldehyde groups. These aldehydes then react with Schiff’s reagent to produce a characteristic ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Peripheral Nervous System - Structure, Functions, Types
What is Peripheral Nervous System? The peripheral nervous system acts as a bridge between the brain, spinal cord, and the rest of the body. Think of it as a network of pathways that carry messages back and forth. While the brain and spinal cord form the central command center, the peripheral system handles communication with ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Peripheral Protein - Structure, Examples, Functions
What is Peripheral Protein? Structure of Peripheral Proteins Several peripheral proteins are marked in the picture below. A peripheral protein doesn’t have a clear structure, but it does have a few important features that make it what it is. Example of Peripheral Proteins Alternative Oxidase Cytochrome c Type-II NADH Dehydrogenase Dihydroorotate Dehydrogenase Functions of Peripheral ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Permanent Tissue - Definition, Types, Characteristics, Functions, Examples
What is Permanent Tissue? Definition of Permanent Tissue Permanent tissue is a type of plant tissue composed of mature, differentiated cells that have lost the ability to divide and have specific functions, such as support, storage, or transport. Characteristics of Permanent Tissue Types of Permanet Tissue A. Simple Permanent Tissue Simple permanent tissues are a ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Peroxide Value Test - Principle, Procedure, Result
Peroxide Value (PV) Test is a chemical titration used to find the peroxides and hydroperoxides present in fats and oils. It is taken as an early index of oxidation and shows the freshness, quality, and keeping life of the sample. A high value means the oil is turning rancid. Objectives of Peroxide Value Test Principle ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Peroxisomes -Definition, Structure, Enzymes, and Functions
What are Peroxisomes? Peroxisomes are small, single‑membrane organelles present in nearly all eukaryotic cells, they consist of a lipid bilayer that encloses enzymes specialized for oxidation reactions, especially those that break down fatty acids, amino acids and other toxic molecules, this process generates hydrogen peroxide which is then immediately converted into water and oxygen by ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Pest - Definition, Types, Resurgence, Importance
What is Pest? Definition of Pest A pest is an organism that is harmful to humans, crops, livestock, or the environment and causes damage or nuisance. Types of pests There are various types of pests that can cause damage and nuisance in different settings. Here are some common types of pests: These are just a ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Petri dish - Structure, Types, Uses
Petri dish is a shallow, flat-bottomed, circular laboratory container with a loose fitting lid. It is used to cultivate, isolate and study microorganisms like bacteria, fungi and cells under controlled sterile conditions. It is designed to hold nutrient rich growth media, such as agar. Agar gives a supportive base for microbial and cellular growth. It ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
PH Meter - Principle, Parts, Types, Procedure, Calibration, Application
pH meter is an instrument used to measure pH of a solution. It measures the hydrogen ion activity in water based solution. It is used to know whether solution is acidic or alkaline. It works on potentiometry principle. It measures the difference in electrical potential between a measuring electrode and a reference electrode. The measuring ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Phaeophyta (Brown Algae) - Characteristics, Occurrence, Thallus Organization, Cell Structure and Reproduction
What is Phaeophyta (Brown Algae)? General Characteristics of Brown Algae (Phaeophyta) Brown algae, or Phaeophyta, exhibit a variety of unique structural, cellular, and reproductive features that make them an important group within the marine ecosystem. The following points detail the essential characteristics of this group: Classification of Phaeophyta Phaeophyta, or brown algae, are classified based ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Phagocytosis - Definition, Steps, and Example
Phagocytosis refers to the process in which cells consume large particles (>0.5 micrometers) and vesicle-bound membrane vesicles known as phagosomes. These vesicles are then directed to the lysosomes where they will be subjected to enzymatic degrading. Optonization of bacteria can greatly enhance phagocytosis. Although phagocytosis may occur without the attachment of an IgG or complement fragment (C3), it can be greatly enhanced by attaching a specific IgG.
Phase Contrast Microscopy- Principle, Parts, Uses
Phase contrast microscope is an optical microscope that is used to observe transparent and unstained living cells. It converts small phase changes of light into visible contrast. These phase changes are produced when light passes through the different parts of the specimen. It was developed by Frits Zernike in 1930s. This microscope is very useful ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Phenol-Sulfuric Acid Method - Principle, Procedure, Result
What is Phenol-Sulfuric Acid Method for Total Carbohydrates? Phenol-sulfuric acid method is a colorimetric method which is used for quantitative estimation of total carbohydrates. It was formalized by DuBois in 1956. It is simple rapid and reliable method. It can detect almost all type of carbohydrates like monosaccharides disaccharides oligosaccharides and polysaccharides. In this method ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Phenotype - Definition, Importance, Examples
What is Phenotype? Definition of Phenotype The phenotype is the observable set of characteristics or traits of an organism, resulting from the interaction of its genetic makeup (genotype) with the environment. What is Extreme Phenotype? In the intricate domain of genetics, the concept of an “extreme phenotype” is pivotal in understanding the variations that can ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Phenylalanine Deaminase Test - Principle, Procedure, Result
Phenylalanine Deaminase Test (PDA test) is a biochemical test used to detect the enzyme phenylalanine deaminase produced by some bacteria. It is used to identify and differentiate gram-negative enteric bacteria, mainly the Proteeae group from other Enterobacteriaceae. In this test, the organism is grown on a medium containing phenylalanine. If the enzyme is present, phenylalanine ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Phenylethyl Alcohol Agar - Composition, Preparation, Uses, Limitation
A selective medium called phenylethyl alcohol (PEA), is used to cultivate Gram positive organisms, especially cocci, in a sample containing pathogens. Phenylethyl alcohol is the active ingredient that inhibits or significantly reduces growth of Gram-negative organisms.
Phosphorus Cycle - Definition, Steps, Examples, Significance, and Human Impacts
Do you think phosphorus is important? This depends on whether you want DNADNAtexttextend text"D,N, End cell membranes, text or bones within your body? It's a good bet that the likelihood is that yes!
Photo bioreactor - Definition, Types, Application, Advantages
Photo bioreactor is an innovative type of reactor that has the advantages of biofilm reactors and photobioreactors that can be utilized to cultivate microalgae in wastewater treatment facilities (WWTPs). The major benefit of this type of system is its capacity to use sunlight as a source of energy for photosynthesis, which reduces the requirement for carbon from external sources.
Photoautotroph - Definition, Importance, Examples
What is Photoautotroph? Definition of Photoautotroph A photoautotroph is an organism that synthesizes its own organic compounds using light energy and inorganic carbon, primarily through the process of photosynthesis. Examples include plants, algae, and certain bacteria. How does Photoautotrophs Get Their Nutrition? Photoautotrophs obtain their nutrition through a process called photosynthesis. Here’s a detailed explanation ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Photomorphogenesis - Definition, Types, Mechanism, Importance
What is Photomorphogenesis? Definition of Photomorphogenesis Photomorphogenesis is the process by which plants use light as a signal to regulate growth and development, influencing stages such as seed germination, seedling growth, and flowering. Photoreceptors and Photomorphogenesis Photomorphogenesis in plants is regulated by specialized light-sensitive molecules known as photoreceptors. These photoreceptors are crucial for interpreting light signals ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Photoperiodism - Definition, Types, Importance
What is Photoperiodism? Classification of plants based on Photoperiodism Plants are classified into several categories based on their response to the length of light and dark periods. These categories reflect how different species time their flowering and growth in accordance with seasonal day-length variations. The primary classifications include: Photoperiodic Induction Photoperiodic induction refers to the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Photosynthesis - Definition, Steps, Equation, Process, Diagram, Examples
What is Photosynthesis? Definition of Photosynthesis Photosynthesis is the biological process by which plants, algae, and certain bacteria convert light energy into chemical energy, producing oxygen and organic compounds, primarily glucose, from carbon dioxide and water. Experimental History The intricate process of photosynthesis, which underpins life on Earth, has been the subject of extensive scientific ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Photosynthetic Bacteria - Examples, Definition, Vs Chemosynthetic Bacteria
Photosynthetic bacteria Definition Photosynthetic bacteria Examples There are many types of bacteria that can photosynthesize, as we have already mentioned. They can be divided into five main groups, which include: Cyanobacteria Cyanobacteria, also known as “blue green algae”, are Gram-negative bacteria that are commonly found in aquatic ecosystems. While there have been more than 2000 ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Photosystem I (PS1) - Structure, Functions
What is Photosystem I (PS1)? Definition of Photosystem I (PS1) Photosystem I (PSI) is a crucial protein complex in oxygenic photosynthesis, primarily found in algae, plants, and cyanobacteria. It functions by capturing light energy to drive the transfer of electrons across the thylakoid membrane, from plastocyanin to ferredoxin. This process contributes to the synthesis of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Phototropism - Definition, Types, Mechanism, Importance, Examples
What is Phototropism? Definition of Phototropism Phototropism is the directional growth of an organism, especially plants, in response to a light stimulus. Phototropism Lecture Video Phototropism Discovery – Early Experiments The phenomenon of phototropism, where plants grow directionally in response to light, has been a subject of scientific intrigue for centuries. Pioneering experiments by eminent ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Phyllosphere Microorganisms - Examples, Factors, Effects
The phyllosphere refers to the entirety of a plant’s above-ground surface, which provides a habitat for microorganisms, particularly in the aerial components such as leaves, stems, flowers, and fruits. Phyllosphere Microorganisms – These are microbiological entities that inhabit the aerial surfaces of plants, particularly the leaf surface (phylloplane). What is Phyllosphere? Phyllosphere – the aerial ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Phylogenetic Tree - Definition, Types, Steps, Methods, Uses
A phylogenetic tree (also phylogeny or evolutionary tree) is a branching diagram or a tree that illustrates the evolutionary relationships between various biological species or other entities based on similarities and differences in their physical or genetic characteristics. All life on Earth belongs to a singular phylogenetic tree, indicating a shared ancestry. In a rooted ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Phylogeny - Definition, Importance, Limitations, Examples
What is Phylogeny? Definition of Phylogeny Phylogeny is the study of the evolutionary history and relationships among species or groups of organisms, represented visually by a phylogenetic tree. What is Molecular Phylogeny? Molecular phylogeny, a specialized subset of phylogeny, harnesses the power of molecular sequencing to decipher evolutionary relationships and histories among various organisms. Traditional ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Phylum - Definition, Importance, Examples
What is Phylum? Definition of Phylum A phylum is a high-level taxonomic rank in biology, ranking below kingdom and above class, used to categorize and group organisms with shared fundamental characteristics and evolutionary relationships. Examples of Phylum 1. Phyla in Kingdom Monera Within the taxonomic realm of Kingdom Monera, encompassing both Eubacteria and Archaea, the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Phylum Annelida - Definition, Characteristics, Classification, Examples
Kingdom: Animalia Clade: Bilateria Clade: Nephrozoa (unranked): Protostomia (unranked): Spiralia Superphylum: Lophotrochozoa Phylum: AnnelidaLamarck, 1809 Morphology of Annelida Below is a detailed description of the key morphological traits of annelids: Anatomy of Annelida General Characters of Phylum Annelida Organ System of Phylum Annelida Below is an overview of the major organ systems found in annelids, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Phylum Arthropoda - Definition, Classification, Characteristics, Examples
Kingdom: Animalia Subkingdom: Eumetazoa Clade: ParaHoxozoa Clade: Bilateria Clade: Nephrozoa (unranked): Protostomia Superphylum: Ecdysozoa (unranked): Panarthropoda (unranked): Tactopoda Phylum: Arthropoda What is Phylum Arthropoda? Definition of Arthropoda (Arthropods) The Arthropods belong to the bilaterally symmetrical, metamerically separated, triploblastic creatures with a coelom that is diminished and altered. Their body is externally covered in an exoskeleton ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Phylum Aschelminthes - Definition, Examples, Characteristics
Phylum Aschelminthes Definition Aschelminthes are pseudocoelomate. They are bilaterally symmetrical, triploblastic, non-segmented, vermiform, organ-system grade construction that includes full digestive tubes. Characteristics of Phylum Aschelminthes Classification of phylum Aschelminthes The phylum is a heterogeneous collection of animals, which is why it is classified differently by various Zoologists. The classification here is based on and on ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Phylum Ascomycota Overview
The Ascomycota sac fungi is monophyletic and comprises about 75% of the described fungi. It comprises the majority of fungi that mix together with algae to create lichens as well as the vast majority of fungi do not have morphological evidence for sexual reproduction. Among the Ascomycota are some famous fungi: Saccharomyces cerevisiae, the yeast of commerce and foundation of the baking and brewing industries (not to mention molecular developmental biology), Penicillium chrysogenum, producer of penicillin, Morchella esculentum, the edible morel, and Neurospora crassa, the "one-gene-one-enzyme" organism.
Phylum Chordata - Characteristics and Classification
What is Chordata? Characteristics of Chordates Below are the main characteristics of chordates: In addition to the primary characteristics listed above, chordates share several other notable features: Anatomy of Chordates The anatomy of chordates encompasses a unique set of features that distinguishes them from other animal phyla. These anatomical characteristics manifest at various life stages ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Phylum Chordata - Definition, Characteristics, Classes
Phylum Chordata Definition “The chordates are a class of animals that have four anatomical characteristics, which are (1) nochord (2) dorsal cord of nerves, (3) post-anal tail and (4) Pharyngeal slits, at the very least, during a portion of their growth into maturity.” Or A phylum within the animal kingdom, which includes all animals that ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Phylum Cnidaria - General characteristics and classification
Cnidaria comes from the Greek word cnidos, which means stinging thread. The existence of cnidae characterises these creatures. Cnidaria is a phylum within the Kingdom Animalia that contains 10,000 known species, including corals, sea anemones, jellyfishes, and hydras. These organisms are found in both marine and freshwater environments. It is an additional ancient group with ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Phylum Coelenterata (Cnidaria) - Definition, Classification, Characteristics
Definition of Phylum Coelenterata (Cnidaria) The Coelenterata can be described as a diploblastic metazoa that has a the tissue grade having one nematocyst, and one gastrovascular cavity, or coelenteron. Characteristics of Phylum Coelenterata (Cnidaria) Classification of Phylum Coelenterata (Cnidaria) The phylum Coelenterata contains more than 11,000 species of which half are extinct. The classification used ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Phylum Ctenophora - Characteristics, Classification, Examples, Evolutionary significance
What is Phylum Ctenophora? Kingdom Animalia Subkingdom Eumetazoa Phylum Ctenophora Phylum Ctenophora, commonly referred to as comb jellies, encompasses a group of marine invertebrates known for their distinctive, jelly-like appearance and unique locomotive mechanisms. These creatures, often mistaken for jellyfish, play a significant role in marine ecosystems across the globe. Below is an exploration of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Phylum Echinodermata - Definition, Classification, Characteristics, Examples
What is Phylum Echinodermata? Phylum Echinodermata Definition Phylum Echinodermata encompasses marine organisms characterized by a calcareous endoskeleton, pentamerous radial symmetry in adulthood, and a specialized water vascular system, with notable members including starfish, sea urchins, and sea cucumbers. Characteristics of Phylum Echinodermata In essence, Phylum Echinodermata represents a diverse group of marine organisms, distinguished by ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Phylum Hemichordata - Definition, Classification, Characteristics, Examples
Definition of Phylum Hemichordata Phylum Hemichordata is a small marine phylum of worm-like animals known as Acorn Worms. They are distinct from chordates and serve as important connecting links between vertebrates and invertebrates. Characteristics of Phylum Hemichordata Phylum Hemichordata exhibits the following characteristics: Some examples of Hemichordata include Balanoglossus, Saccoglossus, Rhabdopleura, Atubaria, and Dendrograptus. In ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Phylum Mollusca - Classification, Definition, Characteristics, Examples
What are Phylum Mollusca? Definition of Mollusca (Mollusks) Mollusca, commonly known as mollusks, is a large phylum of invertebrate animals characterized by a soft body that is often protected by a hard shell. This diverse group includes species such as snails, slugs, clams, octopuses, and squids. Mollusks are known for their unsegmented bodies, bilateral symmetry, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Phylum Nemathelminthes - Anatomy, Morphology, Characteristics, Classification
Phylum Nemathelminthes is a group of worm-like animals which was earlier used in classification and also referred to as Aschelminthes. It includes unsegmented, bilaterally symmetrical and triploblastic animals. These organisms are elongated and cylindrical in shape and the body is tapering at both ends. Because of this shape they are commonly called roundworms or threadworms. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Phylum Nematoda - Classification, Definition, Characteristics, Examples
Definition of Phylum Nematoda Nematodes (Gr. nema thread+ form) are often referred to by various names, such as threadworm, non-segmented roundworm or pinworm. They are distinct from flatworms and higher segmented anelids. Characteristics of Phylum Nematoda Classification of Phylum Nematoda Nematoda is one of the most diverse phyla. At present, there are approximately 15,000 species. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Phylum Onychophora - Characteristics, Classification
Kingdom: Animalia Subkingdom: Eumetazoa Clade: ParaHoxozoa Clade: Bilateria Clade: Nephrozoa (unranked): Protostomia Superphylum: Ecdysozoa (unranked): Panarthropoda Phylum: OnychophoraGrube, 1853 Class: Udeonychophora General Characteristics of Phylum Onychophora Phylum Onychophora, commonly known as velvet worms, is a unique group of invertebrates that share characteristics of both arthropods and annelids. Here are some general characteristics of the phylum ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Phylum Platyhelminthes - Characteristics, Classification, Examples
What is Phylum Platyhelminthes? Definition of Phylum Platyhelminthes Phylum Platyhelminthes, also known as flatworms, comprises bilaterally symmetrical, triploblastic, dorsoventrally flattened invertebrates lacking circulatory, respiratory, and skeletal systems, characterized by a simple digestive system with a single opening and a protonephridial excretory system. Characteristics of Phylum Platyhelminthes Classification of Phylum Platyhelminthes Class 1- Turbellaria (L., turbella= a little ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Phylum Porifera - Definition, General Characteristics, Classification, Structure, Reproduction
What is Phylum Porifera? – Definition of Phylum Porifera Phylum Porifera refers to a group of simple, sessile aquatic animals commonly known as sponges. Sponges lack true tissues and organs and have a porous body structure with numerous channels and chambers that allow water to flow through them. They feed by filtering small particles from ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Physical Methods of Sterilization
What is Sterilization? Physical methods of sterilization Physical methods of sterilization involves the control of microbial growth by using Sunlight, Heat, Filtration, Radiation, etc. Physical methods of sterilization include the following: A. Heat Sterilization Heat sterilization is a fundamental technique in microbiology and medical sterilization, notable for its efficiency in destroying microorganisms through thermal means. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Physiological Buffer preparation
Tyrode’s Solution, Acidic Preparation To prepare 1L of Tyrode’s Solution, Acidic, the following components are required; Component Amount Concentration NaCl (mw: 58.44 g/mol) 8 g 0.1368 M KCl (mw: 74.55 g/mol) 200 mg 0.0027 M CaCl2•2H2O (mw: 147.01 g/mol) 240 mg 0.0016 M MgCl2•6H2O (mw: 203.3 g/mol) 100 mg 0.0005 M Glucose (mw: 180.16 g/mol) ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Physiological control of respiration - Components, Methods
Respiration is a vital physiological process that encompasses the cyclic movement of air into and out of the lungs. This mechanism is crucial for facilitating the exchange of gases, specifically oxygen and carbon dioxide, between the external environment and the bloodstream. The efficiency of respiration directly influences the partial pressures of oxygen (PaO2) and carbon ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Physiology of Digestion - Organs, Mechanism, Regulation, Functions
What is Digestion? Organ Systems Involved in gastrointestinal system The gastrointestinal (GI) system is a complex network of organs responsible for the digestion and absorption of nutrients, as well as the elimination of waste. It encompasses several key organs, each with specific functions that contribute to the overall digestive process. Digestion Process The digestion process ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Physiology of hearing - Ear Structure, Functions
What is Ear? Definition of Ear The ear is a sensory organ responsible for hearing and maintaining balance in the body. It consists of the outer ear, middle ear, and inner ear, and it converts sound waves into electrical signals that can be interpreted by the brain. Anatomy of Ear – Structure of Ear The ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Physiology of Respiration - Respiratory System, Breathing, Gas Exchange Mechanism, Regulation
What is Respiration? What is Respiration System? Respiratory organs The respiratory system consists of several critical organs that work together to facilitate breathing and gas exchange. These organs are structured to ensure the proper flow of oxygen into the body and the removal of carbon dioxide. Below is a detailed breakdown of the primary respiratory ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Physiology of Vision - Eye Structure, Function, Vision Mechanism
What is Eye? Definition of Eye The eye is an organ of the visual system that detects light and enables organisms to see by converting light into electrical signals that are sent to the brain for processing. Anatomy Of Eye – Structure of Eye The eye is typically round in shape, but it appears convex ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Phytochrome - Types, Structure, Functions
What is Phytochrome? Structure of Phytochrome Phytochrome is a complex protein pigment that plays a crucial role in plant photoreception and signaling. Here are the key aspects of its structure: Types of Phytochrome Phytochromes are classified into different types based on their genetic encoding and functional roles in plants. The main types of phytochrome include: ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Phytoplankton - Definition, Types, Importance, Example
What is Phytoplankton? Definition of Phytoplankton Phytoplankton are microscopic, photosynthetic organisms found in aquatic environments that serve as the foundation of marine and freshwater food chains and contribute significantly to global oxygen production and carbon cycling. Characteristics Features of Phytoplankton Phytoplankton are a diverse group of microscopic photosynthetic organisms that inhabit aquatic ecosystems, and they ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Phytoplankton - Definition, Types, Importance, Example
What is Phytoplankton? Definition of Phytoplankton Phytoplankton are microscopic, photosynthetic organisms found in aquatic environments that serve as the foundation of marine and freshwater food chains and contribute significantly to global oxygen production and carbon cycling. Characteristics Features of Phytoplankton Phytoplankton are a diverse group of microscopic photosynthetic organisms that inhabit aquatic ecosystems, and they ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Phytoremediation - Definition, Types, Mechanisms
What is Phytoremediation? Types of Phytoremediation There are three varieties of phytoremediation: 1. In situ phytoremediation Advantages of In situ phytoremediation Disadvantages of In situ phytoremediation 2. In-vivo phytoremediation with relocated contaminants 3. In vitro phytoremediation Processes Of Phytoremediation Phytoremediation is based on certain natural processes carried out by plants, such as: Mechanisms of phytoremediation ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Picric Acid Test for Glucose - Principle, Procedure, Result, Uses
Picric Acid Test is a chemical test. It is used for detection of reducing sugar in sample. These reducing sugar are glucose fructose and galactose. It is a highly sensitive assay. It is based on the reducing nature of sugar. The sugar contain free aldehyde or ketone group. This group act as reducing agent in ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Pineal Gland - Structure, Secretions, Hormones, Functions, Disorders
What is Pineal Gland? Definition of Pineal Gland The pineal gland is a small, pea-shaped endocrine gland located in the brain, responsible for producing the hormone melatonin, which regulates sleep-wake cycles and circadian rhythms. It responds to light exposure, influencing various biological processes in the body. Location of Pineal Gland Structure of Pineal Gland The structure ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Pinus - Characteristics, Classification, Morphology, Anatomy And Reproduction
Kingdom Plantae Division (Phylum) Pinophyta (Coniferophyta) Class Pinopsida Order Pinales Family Pinaceae Genus Pinus What is Pinus? Pinus Habitat and Distribution Pines, belonging to the genus Pinus, are among the most recognizable evergreen trees globally, found naturally across both hemispheres. Their adaptability to a wide range of climates and elevations makes them prominent in diverse ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Pipette - Definition, Principle, Parts, Procedure, Applications
A pipette is a fundamental laboratory instrument used across biology, chemistry and clinical labs to accurately measure and transfer small volumes of liquid. In this comprehensive guide we’ll explore what a pipette is, the working principle behind air-displacement vs positive-displacement pipettes, the key components of a pipette, the many types you’ll encounter (Pasteur, graduated, volumetric, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Pipette (Glass Pipettes) - Principle, Types, Handling, and Uses
Pipette (Glass Pipettes) is a laboratory instrument made up of a narrow glass tube that is used to measure and transfer a specific volume of liquid from one container to another. It works by creating a suction or partial vacuum above the liquid (using pipette bulb or mouth suction) so the liquid is drawn inside ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Pipette Dropper - Parts, Types, Procedure, Uses
Pipette dropper is a simple laboratory device used to measure and transfer small volume of liquid in the form of drops. It is also called as Pasteur pipette or eye dropper. It is used when controlled amount of liquid is required, without using a graduated pipette. It is made up of a narrow glass or ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Pipette Filler - Parts, Types, Procedure, Application
Pipette filler is a handheld laboratory device used to aspirate (draw up) and dispense a required volume of liquid using a glass or plastic pipette. It is also called pipette controller or pipette gun. It is used to handle liquids safely and accurately during routine lab work. It works by creating a controlled suction (vacuum) ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Pipetting - Technique, Definition, Types
Pipetting Definition Pipetting is the process of using a pipettor to measure and dispense small volumes of liquid. It is a fundamental technique used in many laboratory procedures, including preparing solutions, dispensing samples for analysis, and performing various types of assays. When pipetting, the user first sets the desired volume on the pipettor by adjusting ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Pits - Simple and Bordered Pits in plants
What are Pits? What are primary pit fields? Structure of Pits Pits are vital components of plant cell walls, playing a crucial role in intercellular communication and the transport of water and nutrients. Their structural complexity allows for efficient functioning, contributing to the overall physiological processes of plants. The following points outline the key structural ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Pituitary Gland - Structure, Hormones, Functions, Disorders
What is Pituitary Gland? Definition of Pituitary Gland The pituitary gland is a small, pea-sized endocrine gland located at the base of the brain, beneath the hypothalamus. It is often termed the “master gland” because it produces and secretes hormones that regulate various bodily functions, including growth, metabolism, and reproduction, and controls the activity of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Placenta - Definition, Structure, Types, Functions
What is Placenta? Definition of Placenta The placenta is a temporary organ that develops during pregnancy and connects the developing baby to the mother’s uterus. It provides oxygen, nutrients, and eliminates waste products from the baby’s blood. Types of Placenta There are several types of placenta, characterized by different factors and arrangements. Here are the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Plant - Water Relations
Life supporting characteristics and biological importance of water to plants The life-supporting characteristics of water stem from its unique physical and chemical properties, which play an essential role in biological systems, particularly in plants. The significance of water in plants can be attributed to its role in chemical reactions, germination, nutrient transport, temperature regulation, and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Plant Breeding - Introduction, History, Objective, Methods
In this article we will learn about Plant Breeding Introduction and objectives. Breeding systems: modes of reproduction in crop plants. Important achievements and undesirable consequences of plant breeding. What is Plant Breeding? History of plant breeding The history of plant breeding is deeply intertwined with the earliest human agricultural practices. As humans began to cultivate ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Plant cell - Structure, Definition, Diagram, Organelles
Animals, fungi and protists are composed of at least one eukaryotic cell. However archaea and bacteria are composed of only one prokaryotic cell. Plant cells differ from cells belonging to other organisms due to their cell walls, chloroplasts and the central vacuole.
Plant Cell vs. Animal Cell - Difference Between Plant and Animal Cell
The fact that they are both cells that are eukaryotic, meaning they have a real nucleus that is enclosed and separate from other organelles through a nuclear membrane is a key element which determines their ways of multiplication. They share the same reproduction process of meiosis and mitosis by using their DNA, which is stored in the cell's nucleus.
Plant communities - Characters, Ecotone and edge effect, Succession, Processes and types
What are Plant communities? Definition of Plant community A plant community is a group of plant species that coexist and interact within a specific geographical area, forming a distinct and relatively uniform vegetation patch. Examples of Plant community Characteristics of Plant Communities Plant communities exhibit various characteristics that can be broadly categorized into analytic and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Plant Diseases - Diagnose, Control and Treatment
Diagnosis of Plant Diseases The diagnosis of plant diseases is a systematic process that requires careful observation, analysis of symptoms, and consideration of various environmental factors. An accurate diagnosis is critical for effective management and control strategies, as it enables the identification of the underlying causes of plant distress. The following steps outline the essential ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Plant Growth Promoting Rhizobacteria (PGPR)
What is Plant Growth Promoting Rhizobacteria (PGPR)? Mechanism of action of Plant Growth Promoting Rhizobacteria (PGPR) The synthesis of different chemicals alters the entire microbial community in the rhizosphere niche to facilitate PGPR-mediated plant growth promotion. In general, PGPR stimulates plant growth either directly by enabling resource acquisition (nitrogen, phosphorus, and critical minerals) or indirectly ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Plant Growth Regulators - Types, Characteristics, Functions, Examples
What is Plant growth regulator? Types of Plant Growth There are several distinct types of plant growth, each characterized by specific processes and outcomes. These growth types define how plants develop in size, form, and function throughout their life cycle. Below is a detailed breakdown of the main types of plant growth: Factors Affecting Plant ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Plant Introduction - History, Purpose, Procedure, Merits, Demerits
What is Plant Introduction? Types of Plant Introduction Plant introduction, a crucial aspect of crop improvement and agricultural development, can be categorized into two main types: primary introduction and secondary introduction. Each type serves distinct purposes and involves different processes to enhance crop varieties. 1. Primary Introduction 2. Secondary Introduction History of Plant Introduction The ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Plant Metabolism - Introduction, anabolic and catabolic pathways, regulation of metabolism, role of regulatory enzymes
What is Plant Metabolism? What is Catabolism? Catabolism is a fundamental metabolic process that plays a crucial role in living organisms, including plants and animals. The primary aim of catabolism is to extract energy from biomolecules, converting it into adenosine triphosphate (ATP), which serves as an energy currency for cellular activities. Additionally, catabolism generates essential ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Plant Tissue Culture - Definition, techniques, Media composition, types, application.
What is Plant Tissue Culture? Plant tissue culture Definition Plant tissue culture is a biotechnology technique that involves growing plant cells, tissues, or organs in a controlled, sterile environment on a nutrient medium. This method exploits the totipotency of plant cells, allowing for the rapid propagation of plants, production of disease-free specimens, and conservation of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Plant Tissues - Definition Types, Functions
What are Plant Tissues? Plant tissues are organized cell groups within a plant that collectively enable essential life functions, like growth, protection, and nutrient transport. There are two main categories of plant tissues: meristematic and permanent. Meristematic tissues contain actively dividing cells that promote growth. Found in regions like root and shoot tips, these cells ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Plant Transformation via Pollen Tube-Mediated Gene Transfer
What is Plant Transformation? What is Pollen Tube-Mediated Gene Transfer? Requirement for Pollen Tube-Mediated Gene Transfer The pollen tube pathway method requires several key components and conditions to be effective in transforming cotton plants. Here are the main requirements: Steps for Pollen Tube-Mediated Gene Transfer Pollen tube-mediated gene transfer (PTT) is a cutting-edge technique that ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Plant Yielding Sugars, Starches, and Cellulose Product
What is Sugar? Sugars Yielding Plants Sugars Yielding Plants The study of plants that yield sugars highlights key species cultivated for their sugar content, spanning tropical and temperate regions. These plants, which vary in terms of geography and method of cultivation, form the foundation of sugar production across the globe. Here is a detailed look ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Plasmid Replication - Mechanism With Diagram
What are plasmids? Copy Number and Physical Nature of Plasmids Properties of Plasmids Plasmid Replication Mechanism 1. Rolling circle Mode of Replication Rolling-Circle Replication (RCR) is described as a method of DNA replication that is used by some viruses, plasmids and circular genetic elements. A single-strand nick is introduced at the origin and the 5′-end ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Plasmids - Definition, Structure, Functions, Examples
What are Plasmids? Definition of Plasmids Plasmids are small, circular, extrachromosomal DNA molecules found primarily in bacteria that can replicate independently of the main chromosomal DNA and often carry genes beneficial to the host organism, such as those conferring antibiotic resistance. Properties/Characteristics of Plasmids Bacterial plasmids are extrachromosomal DNA fragments that exist within bacterial cells. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Plasmodesmata - Definition, Structure, Functions and Diagram
What is Plasmodesmata? Definition of Plasmodesmata Plasmodesmata are microscopic channels that traverse the cell walls of plant and algal cells, allowing for direct transport and communication between adjacent cells. These structures enable the movement of water, proteins, small RNAs, and other metabolites, playing a crucial role in cellular connectivity and plant physiology. Structure of Plasmodesmata ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Plasmodium - Definition, Life Cycle, Characteristics, Morphology, Diagram
Plasmodium is also known as the malaria parasite and is the genus of intracellular parasitic protozoa. They are digenetic parasites because Plasmodium are obligate parasites of insects (such as mosquitoes) and vertebrates.
Plasmodium vivax - Morphology, Life Cycle, Epidemiology, Pathogenicity, Diagnosis, Prophylaxis and Treatment
What is Plasmodium Vivax? Epidemiology of Plasmodium Vivax The epidemiology of Plasmodium vivax, a significant human malaria parasite, reveals crucial insights into its global distribution, risk factors, and unique characteristics. Understanding these aspects is essential for developing effective control strategies and mitigating the burden of this disease. In the United States, malaria remains a public ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Plasmolysis - Definition, Stages, Functions, Examples,
What is Plasmolysis? Definition of Plasmolysis Plasmolysis is the process in which plant cells contract or shrink due to the loss of water when exposed to a hypertonic solution. Stages of Plasmolysis Plasmolysis is a complex process that occurs in plant cells when exposed to hypertonic solutions, leading to water loss and cellular contraction. This ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Plastids - Types, Structure, Functions
Plastid is a two-membrane-bound organelle that is involved in the synthesis and preservation of nutrients. typically found in the photosynthesis cells of plants. Plastids were first discovered and identified in the work of Ernst Haeckel, but A. F. W. Schimper was the first to offer an accurate definition.
Plate Count Agar (PCA) - Composition, Principle, Preparation, Results, Uses
PCA, also known as plate count (PCA) is an bacteriological medium that is used to determine the total amount of aerobic live bacteria present in a sample. This is not considered to be a specific medium. The quantity of bacteria is expressed in units of colony-forming units per Gram (CFU/g) in solid samples, and per milliliter (CFU/ml) for liquid samples. The preferred method is to use the pour plate method. The samples are dilute and the appropriate dilutions added to Petri plates. Sterile molten Agar is added to the plates. The plates are rotated with care to ensure an even mixing of the sample with the agar. The plates are then incubated at 20 or 30degC over three days. After incubation, the amount of colonies counted is recorded on the plate using 25-250 colonies, which is believed to provide the most precise results. When calculating the amount of bacteria present within the specimen, the dilution factors is to be considered.
Platelets (Thrombocytes) - Definition, Structure, Function
What are Platelets (Thrombocytes)? Platelets (Thrombocytes) Definition Platelets, also known as thrombocytes, are anucleated cells derived from megakaryocytic cells in the bone marrow. They are the second most abundant cells in the blood circulation and play a crucial role in maintaining hemostasis by initiating blood clotting. Platelets also have non-hemostatic immune functions and can release ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Pleiotropism - Definition, Types, Examples
What is Pleiotropism? Short Definition of Pleiotropism Pleiotropism refers to the phenomenon where a single gene or mutation affects multiple, seemingly unrelated traits or physiological processes. This occurs when one genetic change leads to a range of different effects across various aspects of an organism’s phenotype. Types of pleiotropy Examples of Pleiotropism Significance of Pleiotropism
Pneumocystosis - Causative Agent, Treatment, Prevention
Properties There are three unique morphological phases in this organism: Pathogenesis and Immunity Clinical Syndromes Epidemiology Laboratory Diagnosis Treatment Prevention and Control
Pocket Microscope - Principle, Parts, Uses, Types
It is designed in a way that is compact and portable which is why it's called a pocket'. They're pocket-sized however some are bigger. Their size is not enough to be able to hold a mirror in order to put the image in the proper place. However, they contain a small stage where one can place an object to observe. They're portable so that they can be utilized by both professionals and amateurs according to the task they're designed to fulfill.
Point mutation - Definition, Causes, Types, Examples
What is Point mutation? Definition of Point mutation A point mutation is a genetic mutation involving a change in a single nucleotide base in the DNA or RNA sequence, which can affect the sequence of amino acids in a protein. Causes of Point mutation Point mutations are primarily caused by various mechanisms that affect the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Poison Apparatus And The Biting Mechanism of Snakes
Poison Apparatus of Snake Poisonous apparatus of snakes include the following parts; 1. Poison Glands 2. Poison Ducts of Snakes 3. Fangs Fangs are specialized teeth found in certain species of snakes that have evolved to inject venom into their prey. These elongated, curved, sharp, and pointed teeth serve as a mechanism for delivering venom ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Polarizing Microscopes - Principle, Parts, Procedure, Uses
What is Polarizing Microscope? Principles of Polarized Light Microscopes The Light Path and Image Formation of Polarized Light Microscopes Parts of a Polarized Light Microscope 1. Light Source – usually a halogen bulb that gives bright white light; it must be stable so the color don’t change by heating or voltage drift. 2. Condenser – ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Polio Virus - Structure, Genome, Replicationm, Pathogenesis
Polio Virus Structure of Polio Virus In summary, the poliovirus is a small, simple virus that contains a naked RNA genome enclosed in a protein shell. The capsid is composed of four structural proteins that form the basic building blocks of the capsid. The virus does not have a lipid envelope and is insensitive to ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Pollen Grain - Structure, Types, Development and Evolution
What is Pollen? What are Pollen Grain? Characteristics of Pollen Grain Structure of Pollen Grain The structure of pollen grains, also known as microspores, is a fundamental aspect of plant reproduction and offers insights into evolutionary and taxonomic relationships among plant species. Pollen grains are minute, unicellular structures with complex features that can be categorized ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Pollen Under The Microscope
What is Pollen? Requirements for Pollen Microscopy Sample Collection for Pollen Microscopy Observation of Pollen Under Stereo Microscope Requirements Procedure for Observation of Pollen Under Stereo Microscope Observing pollen grains under a stereo microscope is a captivating journey into the hidden world of botanical wonders. With its ability to provide a three-dimensional view, the stereo ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Pollen-Pistil Interaction - Steps, Importance
Pollen-pistil interaction is a critical phase in plant reproduction, acting as a sophisticated biological dialogue between male pollen grains and the female reproductive structure, the pistil. When pollen lands on the stigma—the sticky tip of the pistil—it doesn’t immediately guarantee fertilization. Instead, the pistil initiates a series of biochemical checks to assess compatibility. These interactions ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Pollination - Definition, Types, Process, Agents, Adaptation
What is Pollination? Definition of Pollination Pollination is the transfer of pollen from the male part (anther) of a flower to the female part (stigma) of the same or another flower, enabling fertilization and seed production. Process of Pollination Pollination is a critical phase in the reproductive cycle of flowering plants, involving several key steps: ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Polyacrylamide Gel Electrophoresis (PAGE)
What is Polyacrylamide Gel Electrophoresis (PAGE)? Definition of Polyacrylamide Gel Electrophoresis (PAGE) Polyacrylamide Gel Electrophoresis (PAGE) is a technique used to separate and analyze proteins or nucleic acids based on their mobility in a porous polyacrylamide gel matrix under the influence of an electric field. Types of Polyacrylamide Gel Electrophoresis (PAGE) Native PAGE – Proteins ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Polyculture of Fishes - Definition, Objectives, Advantages
What is Polyculture of Fishes? Indian Polyculture System In India, the polyculture system has evolved significantly over time, primarily focusing on the integration of various fish species to optimize production in aquaculture. Initially, this system prominently featured Indian major carps such as rohu (Labeo rohita), catla (Catla catla), and mrigal (Cirrhinus mrigala). Subsequently, the practice ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Polyembryony - Definition, Types, Functions, Examples
What is Polyembryony? Definition of Polyembryony Polyembryony is the development of multiple embryos from a single ovule or seed, resulting in several embryos within the same seed, which are genetically identical to each other but distinct from the parent plant. Types of Polyembryony Polyembryony can be classified based on various criteria including the source of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Polygenic Inheritance (Quantitative inheritance) - Characteristics, Mechanism, Examples, Importance
What is Polygenic Inheritance (Quantitative inheritance)? Definition of Polygenic Inheritance Polygenic inheritance is a genetic mechanism where a single phenotypic trait is controlled by the additive effects of multiple genes, resulting in continuous variation rather than discrete categories. Characteristics of Polygenic Inheritance Examples of Polygenic Inheritance in Humans This section explores how polygenic inheritance influences ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Polymerase Chain Reaction (PCR) - Definition, Steps, Principle, Application
Polymerase chain reaction or PCR is a laboratory technique that is used to make multiple copies (millions or billions!) of a specific region of DNA in vitro (in a test tube rather than an organism).
Polymorphism in cnidarians
What is Polymorphism in cnidarians? The majority of polyps are sessile, whereas meduase types are motile. Nonetheless, there is a similarity between the two in their fundamental characteristics. Importance of Polymorphism Polymorphism is fundamentally a phenomena of labour division. Rather than assigning diverse functions to the components or organs of a single individual, distinct functions ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Polyploidy in Plant Breeding
Polyploidy plays a pivotal role in plant breeding, especially in enhancing the genetic diversity and adaptability of crops. Polyploidy refers to the condition in which a plant has more than two complete sets of chromosomes, a state that naturally occurs due to irregularities in mitotic or meiotic divisions. These irregularities can lead to an increase ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Polysaccharide - Definition, Types, Structure, Functions, Examples
What is Polysaccharide? Characteristics of Polysaccharides Polysaccharides possess several characteristic properties: Chemically, polysaccharides are characterized by their complex structure, consisting of multiple monosaccharide units linked together by glycosidic bonds. The general chemical formula of polysaccharides is (C6H10O5)n, where “n” represents the number of monosaccharide units in the polysaccharide chain. Polysaccharides exhibit great structural diversity, ranging ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Pond Water Under the Microscope
Pond Water and Microorganisms Pond water is a fascinating ecosystem teeming with life, both visible and invisible to the naked eye. It encompasses a wide range of microorganisms, which are crucial to the balance and health of this aquatic environment. These tiny organisms contribute to various ecological processes, making the study of pond water a ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Population - Definition, Characteristics, Growth, Regulation, Types
What is Population? Definition of Population Population can be defined as the total number of individuals, whether human, animal, plant, or microorganism, residing in a specific area or ecosystem. Features/Characteristics Of Population Population characteristics are fundamental in understanding ecological dynamics, encompassing various aspects such as size, density, dispersion patterns, and dispersal mechanisms. The properties of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Population Characteristics
Population, a term derived from the Latin word populus meaning “people,” refers to a group of organisms belonging to the same species that live in a specific geographical area and have the potential to interbreed. In ecological terms, a population is an assemblage of individuals of a species that occupy a particular space at a ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Population genetics - Unitary and modular population, Hardy-Weinberg law
Population genetics is a subfield of genetics that focuses on understanding how genetic variation is distributed across populations, and how these variations evolve over time. A population, in this context, refers to a group of individuals from the same species that occupy a specific geographic area and have the potential to interbreed. Unlike isolated groups, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Positive Displacement Pipette - Principle, Procedure, Applications, Advantages
Positive displacement pipettes are characterised by piston-driven displacement. The piston in a positive displacement pipette makes direct contact with the sample, which allows the aspiration force to remain constant. Air displacement pipettes accurately dispense the majority of liquids. However, the precision may be affected negatively by the solution’s viscosity, volatility, surface tension, and temperature. For ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Positive staining of Viruses - Principle, Procedure, Result
What is positive staining of Virus? Positive staining of viruses is the process in which the viral particle is made dark on a light background. It is the opposite of negative staining where the virus image is light and the background becomes dark. It is used widely to study the diverse morphology of viruses especially ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Post-glycolysis processes
Post-glycolysis processes Glycolysis is a process that involves: Glucose + 2 NAD+ + 2 ADP + 2 Pi → 2 pyruvate + 2 NADH + 2 H+ + 2 ATP Glycolysis could not continue indefinitely if all NAD+ was used up and glycolysis would cease. Organisms must be capable of oxidizing NADH back into NAD+ ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Post-Harvest Diseases - Definition, Classification, Types and Control
What Are Post-Harvest Diseases? Classification of Post-Harvest Diseases Post-harvest diseases can be classified based on the timing of pathogen infection, specifically focusing on two primary categories: field pathogens and storage pathogens. This classification aids in understanding the nature and timing of infections that affect harvested plant products, allowing for more effective management strategies. Types of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Post-Harvest Technology - Principle, Objective, Stages, Factors
What is Post-harvest technology? Principles of Post-Harvest Technology (PHT) Post-harvest technology (PHT) is a crucial component in the agricultural sector, serving as a scientific approach to ensure the efficient handling, preservation, and processing of food commodities after harvest. Its principles focus on maintaining product quality, minimizing losses, and enhancing the value and utility of agricultural ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Post-transcriptional Modification - Definition, Types, Process, Importance
Post-transcriptional modification is a set of biological processes common to most eukaryotic cells by which an primary RNA transcript is chemically altered following transcription from a gene to produce a mature, functional RNA molecule that can then leave the nucleus and perform any of a variety of different functions in the cell.
Potato Dextrose Agar (PDA) - Principle, Composition, Preparation, Uses
Potato Dextrose Agar (PDA) is commonly abbreviated as PDA.
Potato Dextrose Agar has been suggested by APHA and F.D.A.for the count of moulds and yeasts during the testing of food items and dairy products.
Pour Plate Method - Principle, Procedure, Objective, Result, Advantages
The pour Plate Method technique was created in the laboratory by Robert Koch and is still widely used in the laboratory since his time. This technique is appropriate for Microaerophilic, facultative, or anaerobic microorganisms. It is straightforward to use, requires fewer resources, and is simple and cost-effective. However, it requires the specimen to be placed ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Poxviruses - Definition, Classification, Morphology, Life cycle
What are Poxviruses? Classification of Poxviruses Based on whether they infect insect or vertebrate hosts, the family Poxviridae has been divided into two subfamilies: Chordopoxvirinae and Entomopoxvirinae. The subfamily Chordopoxvirinae encompasses viruses that infect vertebrate hosts and consists of eight genera, at least four of which cause human illness. These are the categories: The genera ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Pratylencus (lesion nematode) - Morphology, Life cycle, Control, Importance
What is lesion nematode? Symptoms of lesion nematode Lesion nematode infestations can cause a range of symptoms in both herbaceous and woody plants, primarily affecting root systems and leading to noticeable aboveground effects. The severity of symptoms depends on nematode population levels, environmental conditions, and plant susceptibility. The following list outlines key symptoms and contributing ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Prebiotics - Definition, Types, Sources, Mechanisms
Definition of Prebiotics Types of Prebiotics There are numerous varieties of prebiotics. The majority of them are a subset of carbohydrate groups and are largely oligosaccharide carbohydrates (OSCs) (OSCs). 1. Fructans 2. Galacto-Oligosaccharides 3. Starch and Glucose-Derived Oligosaccharides 4. Other Oligosaccharides 5. Non-Carbohydrate Oligosaccharides Criteria for Eligibility as Prebiotic To qualify as prebiotic, food items ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Precipitation Reaction - Definition, Principle, Types
What is Precipitation Reaction? Precipitation Reaction Definition Precipitation reaction refers to a chemical reaction in which two soluble substances react to form an insoluble solid compound, known as a precipitate. This reaction occurs when two aqueous solutions containing ions combine, resulting in the formation of an insoluble product that settles out of the solution as ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Predation - Definition, Types, Examples
What is Predation? – Predation Definition Characteristics of Predators 1. Physical adaptations 2. Diet and behaviour 3. Camouflage and mimicry 4. Venom 5. Electric fields 6. Physiology Types of Predators Predation comes in four main forms: 1. Carnivory Example of Carnivorous Predation 2. Herbivory Example of Herbivorous Predation 3. Parasitism Examples of Parasitic Predation 4. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Preparation of Crystal Violet for the Gram Stain
This is the recipe for the crystal violet stain used in the Gram stain and other staining procedures.
Preparation of Different pH Buffer
pH Buffer solution A pH buffer or hydrogen ion buffer is defined as an aqueous solution that is composed of a mixture of a weak acid and its conjugate base, or vice versa. In addition of a small amount of strong acid or base, it shows very little changes in pH. pH buffer is mainly ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Preparation of Liquid Medium/broth
The process of growing an organism in the surface of a medium is known as culture. The food source that supports the development of the organism is known as a culture medium. The media for culture are designed so that the organism will receive all the nutrition requirements. However, the media for culture are made in laboratories by weighing and dispensing particular ingredients or by purchasing ready-made media on the market. The majority of the media include organic as well as inorganic nutrients. However, to cultivate a variety of microorganisms, special media are created. If the media is to be solidified required, agar-agar can be mixed with other ingredients. The culture media can be classified into three categories that include semi-synthetic, natural and synthetic media each of which is employed for microbiological studies.
Preparation of Solid Media - Agar deep tubes, Agar Slants, Plates
If the broth medium is supplemented with agar-agar it is referred to as agar medium like the nutrient Agar Medium (NAM) for the cultivation of bacteria potato dextrose (PDA) medium for the cultivation and storage of general fungi Czapek Dox agar (CDA) medium for fungi, starch-casein (SCA) media for the cultivation of actinomycetes, and so on.
Preparation Of Temporary Cotton Plugs and Permanent Cotton Plugs
Microorganisms are everywhere in their the distribution. In any given environment, many microorganisms are present at any given time. It is difficult to identify a specific kind of microbe until we understand their ecological needs. For instance, anaerobic microbes do not require oxygen those that are aerobic require oxygen micro-aerophiles to have oxygen however, in a small amount. So, we require cotton plugs to provide an conditions that are aerobic and keep the growing culture uninvolved with unwanted microbes. Cotton plugs are made of cotton along with air pours. Air can flow through air pours, but not the bacteria that cause microbial contamination. They are fixed to the surface of cotton fibres , and prevent them from being able from getting into flasks, tubes, etc. Air aids in for the development of microorganisms within glass equipment.
Preservation and Spoilage of Canned Foods
Causes of Canned Foods Spoilage Appearance of The Unopened Container Types of Biological Spoilage of Canned Foods Typically, types of microorganism-induced spoiling of canned foods are separated into those caused by thermophilic bacteria and those caused by mesophilic microorganisms. Other approaches for categorising types of food spoilage are based on the types of changes that ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Preservation and Spoilage of Sugars and Sugar Products
Contamination Of Sugars And Sugar Products Sucrose Maple Syrup Honey Candy Preservation Spoilage Sucrose During the production of sugar, the original cane or beet juice becomes increasingly purified toward sucrose and the concentration of sugar in solution increases until crystalline sugar and high-sugar molasses are produced. The more pure a product is, the less suitable ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Preservation of Meat and Meat Products From Microbial Spoilage
Preservation of meat and meat products from microbial spoilage is crucial for several reasons: By implementing appropriate preservation methods, following good manufacturing practices, and adhering to recommended storage and handling guidelines, the risks associated with microbial spoilage can be minimized, ensuring the safety, quality, and availability of meat and meat products for consumers. Methods for ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Preservation of Milk and Milk Products From Microbial Spoilage
Preservation of milk and milk products refers to the methods and techniques used to prevent or slow down the spoilage and deterioration of these products, thereby extending their shelf life and maintaining their quality and safety. Preservation methods aim to inhibit or control the growth of microorganisms, enzymes, and other factors that can lead to ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Preservation, and Spoilage of Meats and Meat Products
Contamination of Meats and Meat Products – Contamination source and causes Meat spoilage can occur through natural processes as well as microbial contamination. Let’s explore the factors responsible for microbial contamination and the events that take place during the rigor mortis phase after animal slaughter: These events and factors emphasize the importance of proper hygiene ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Preservation, and Spoilage of Milk and Milk Products
Milk and milk products that provide nutrition have been of fundamental importance since ancient times. These are aids for improving the economic status of farmers and sellers, as well as the health of consumers. However, microbial contamination may cause these products to spoil, resulting in the potential loss of not only producers and sellers, but ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Preservation, and Spoilage of Poultry
The discussion of poultry focuses primarily on chicken meat, but the principles also apply to the meat of turkey, geese, ducks, and squab. Contamination of Poultry Preservation of Poultry 1. Asepsis 2. Use of Heat 3. Use of Low Temperatures a. Chilling b. Freezing 4. Use of Preservatives 5. Carbon Dioxide Atmosphere 6. Use of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Preservation, and Spoilage of Vegetables and Fruit
Contamination of Vegetables And Fruit Preservation of Vegetables Microorganisms on the surfaces of freshly picked fruits and vegetables comprise not just the regular surface flora, but also microorganisms from the soil and water, and possibly plant diseases. Additionally, a variety of moulds and occasionally a few yeasts may be present. Some germs may thrive between ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Primary and Secondary Immune Response
What is Immune Response? What is Primary Immune Response? Mechanism Stages of Primary Immune Response When an individual is exposed to an antigen for the first time, an initial immune response that is very transient and feeble occurs. This can be separated into four phases: lag, exponential, steady state, and decline. Lag (latent) phase Exponential ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Primary Consumers - Definition, Importance, Examples
Primary consumers are fundamental components of ecological food chains, holding a critical position as the link between producers and higher trophic levels. In essence, they are organisms that feed directly on primary producers, typically plants or algae, which are capable of photosynthesis. Occupying the second trophic level, primary consumers are mostly herbivores, although some omnivorous ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Primary Databases - Definition, Types, Examples, Applications
Data has become the lifeblood of businesses and organizations of all stripes in today’s increasingly digital environment. The ability to gather, store, and analyze massive amounts of data has completely altered the ways in which we think about problems, formulate solutions, and acquire understanding. Primary databases, the bedrock of effective data management, are at the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Primer - Definition, Primer Design, Types, Online Tools, Uses
What is Primer? Types of Primers There are two main types of primers: DNA primers and RNA primers. DNA primers are commonly used in vitro, specifically for PCR amplification and DNA sequencing. On the other hand, RNA primers are utilized in in vivo processes like DNA replication and cloning. 1. DNA Primers: 2. RNA Primers: ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Principles and aerodynamics of flight in Aves (bird) and Flight adaptations
What is aerodynamics? Aerodynamics is the branch of science and engineering that deals with the study of how gases, particularly air, interact with moving objects. It focuses on understanding the forces of drag and lift that are induced by the flow of air over and around solid bodies. While aerodynamics encompasses a wide range of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Principles of Food Preservation
Unwanted microorganisms can cause food to be contaminated. The contamination is usually natural, but it can also be artificial. Natural contamination is when microorganisms attach to food during its growing stages. For example, Fruits are often contaminated by yeasts, which ferment the fruits' carbohydrates. Artificial contamination is when food is improperly handled or processed.
Prions - Definition, Structure, Replication, Function, Disease
What are Prions? Definition of Prion A prion is an infectious, misfolded protein that causes neurodegenerative diseases by inducing abnormal folding of normal cellular proteins, leading to the accumulation of these misfolded proteins in the brain. Unlike other infectious agents, prions lack nucleic acids and propagate their abnormal structure through direct protein-protein interactions. Characteristics of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Probiotics - Definition, Mechanisms, Health Effects
Probiotics Definition Probiotics are living microorganisms that mitigate the negative effects of antibiotics by restoring the body’s natural homeostasis. Probiotics are identified by their genus, species, and a strain-specific identifying name (e.g. Lactobacillus rhamnosus GG) and are available in a range of formulations, including yoghurt drinks, pills, and nutritional supplements. Probiotic Bacteria The majority of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Processes of Evolutionary Change
What is Evolution? Evolution refers to the process of change and development that occurs in living organisms over successive generations. It is the central concept in biology that explains the diversity of life on Earth and how species have come to exist in their present forms. Evolutionary theory explains how species evolve through the gradual ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Producers - Definition, Types, Examples
What is a Producer? Types of Producers Phototrophs and chemotrophs are the two most common forms of primary producers. Phototrophs Word origin: photo– (light) + troph (nourishment) On occasion, the terms’secondary producers’ and ‘tertiary producers’ are employed. Animals that devour plants are secondary producers because they “generate” biomass for their predators. Likewise, carnivores that are ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Production Media - Types, Characteristics, Examples, Uses
What is Production Media? Production media is the nutrient-rich medium used to support the large-scale growth of microorganisms or cell cultures for the purpose of producing useful biological substances. It is designed in such a way that optimum growth conditions is maintained, and the metabolic activities of the organisms is supported for yielding products like ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Production Strain - Screening, Development, Preservation, Preparation
Sources of industrially significant microorganisms and methods for isolating, preserving, and maintaining them, as well as strain improvement, A production strain is the most crucial factor for the success of any fermentation enterprise. Utilizing a producing strain with the following four traits is extremely desirable: 1. Screening Techniques Screening refers to the detection and isolation ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Prokaryotic Cell and Eukaryotic Cell
In the previous article we learned about cell structure and functions. Now in this article we will learn about Prokaryotic and eukaryotic cells. Introduction Hey, if I told you, that you are surrounded by 100 trillion bacterial cells, would you believe? Yes, If you look closer than you will find trillions of bacterial cells on ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Prokaryotic cells - Definition, Structure, Characteristics, Examples
It is important to note that the distinction between prokaryotes as well as eukaryotes was clearly established by microbiologists Roger Stanier and C. B. van Niel in their 1962 paper on the concept of bacteria (though they used the words procaryote as well as eucaryot in the paper).
Prokaryotic DNA Replication - Enzymes, Steps
What is Prokaryotic DNA Replication? Structure of Ori C OriC (Origin of Chromosome) is the specific locus in Escherichia coli where DNA replication is initiated. This critical region is located at approximately the 84.5 mpu position on the E. coli genome, situated opposite to the replication termination site. The structure of OriC is characterized by ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Prokaryotic Ribosomes - Definition, Subunits, Function
What is Prokaryotic Ribosomes? Definition of Prokaryotic Ribosomes Prokaryotic ribosomes are molecular complexes consisting of ribonucleic acid (RNA) and proteins that facilitate protein synthesis within prokaryotic cells, such as bacteria and archaea. Ribosome Subunits Ribosomes, intricate molecular complexes responsible for protein synthesis, consist of two essential subunits in prokaryotic cells, collectively referred to as the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Prometaphase - Definition, Stages, Importance
What is Prometaphase? Definition of Prometaphase Prometaphase is a stage in eukaryotic cell division characterized by the breakdown of the nuclear envelope and the attachment of microtubules to chromosomes, preparing them for alignment during metaphase. What Happend in Prometaphase? In prometaphase, several key events take place during eukaryotic cell division: Overall, prometaphase sets the stage ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Prophase - Definition, Staining, Steps, Importance
What is Prophase? Definition of Prophase Prophase is the initial stage of cell division in eukaryotes, characterized by the condensation of chromosomes, the separation of centrioles, and the breakdown of the nuclear envelope. What Happens in Prophase? Pointers to prophase Prophase, a pivotal stage in cell division, is marked by several distinct events that prepare ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Prophase I - Definition, Stages, Importance
What is Prophase I? Definition of Prophase I Prophase I is the initial stage of meiosis I, characterized by the exchange of genetic material between paired homologous chromosomes through homologous recombination, leading to increased genetic variation. This phase encompasses five sub-stages: leptotene, zygotene, pachytene, diplotene, and diakinesis. Prophase I Glossary of Terms By understanding these ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Prophase II - Definition, Stages, Importance
What is Prophase II? Definition of Prophase II Prophase II is a stage in meiosis II where chromatin condenses into distinct chromosomes, the nuclear envelope disintegrates, centrosomes migrate to opposite poles, and the spindle apparatus forms, preparing the cell for subsequent division. Unlike Prophase I, no crossing over of chromosomes occurs in this phase. What ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Protection of Plant Varieties - Objectives, Criteria, Process
The protection of plant varieties is crucial for preserving national resources and advancing agricultural development. Farmers play a vital role in maintaining and enhancing plant genetic resources, contributing to the creation of new plant varieties. Simultaneously, plant breeders are instrumental in developing these varieties through their research efforts. Therefore, it is essential to safeguard the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Protection of Traditional Knowledge - Objective, Significance, Issues
What is Traditional Knowledge (TK)? Significance of Traditional Knowledge (TK) The significance of Traditional Knowledge (TK) is deeply rooted in both cultural identity and practical utility for many indigenous and local communities. It forms a fundamental part of their daily lives and is essential for their continued development and sustainability. The following points outline the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Protein Databases - Definition, Types, Examples, Applications
Hey there! Ever wondered how scientists keep track of all the proteins in our bodies? It’s all thanks to protein databases! These handy tools are like giant digital libraries where researchers can find detailed info about proteins. In this article, we’ll break down what protein databases are, explore the different types out there, and check ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Protein Purification Methods
What is Protein Purification? Protein Purification Methods Creating a Crude Protein Extract – Extraction Precipitation and Differential Solubilisation – Concentration of crude extract Ammonium sulfate precipitation Fractional precipitation with acetone Ultracentrifugation Sucrose gradient centrifugation Chromatographic Methods Different chromatographic methods 1. Size Exclusion Chromatography 2. Ion Exchange Chromatography 3. Affinity Chromatography 4. Metal Binding 5. Immunoaffinity ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Protein Synthesis (Translation)- Definition, Steps, Sites, Machinery
What is Protein Synthesis? Protein synthesis is a fundamental biological process that occurs within cells, responsible for the formation of proteins through the assembly of amino acid chains, termed polypeptides. This process is pivotal to the central dogma of genetics and is instrumental in maintaining cellular function and structure. The process of protein synthesis can ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Protein Synthesis Inhibitors - Definition, Mechanism, Examples
What are Protein Synthesis Inhibitors? Types of Protein synthesis inhibitors On the basis of target organisms inhibitor of protein synthesis is categories as follows- 1. Acting only on prokaryotes 2. Acting on prokaryotes and Eukaryotes 3. Acting only on Eukaryotes Mechanism of Protein synthesis inhibitors Protein synthesis, a core biological process, occurs at the ribosomal ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Proteins - Structure, Properties, Type, Denaturation, Functions
What are Proteins? Definition of Proteins Proteins are large, complex molecules composed of amino acid chains that perform a vast array of functions in living organisms, including catalyzing metabolic reactions, providing structural support, and facilitating cell signaling and transport. Properties of Proteins Synthesis of peptides Peptides are short chains composed of amino acids. These chains, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Proteus - Overview
Morphology of Proteus Proteus demonstrates the following characteristics: Culture of Proteus Proteeae organisms are aerobic bacteria that thrive on common media like nutrient agar. On the medium, colonies of Proteus exude a putrefactive (or “fishy” or “seminal”) stench. Swarming Biochemical properties of Proteus Cell Wall Components and Antigenic Properties Antigens O and H are present ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Protist Under Microscope
What is Protists? Protists are a group of eukaryotic organisms belonging to the Kingdom Protista. They are distinct from animals, plants, and fungi. While all protists are eukaryotes with a nucleus and cellular organelles, they can vary widely in their characteristics. The majority of protists are unicellular, although there are a few multicellular protists, with ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Protochordata - Characteristics and Classification
What is Protochordata? Characteristics of Protochordata Protochordata, often referred to as primitive chordates, exhibit several defining features that differentiate them from more advanced vertebrates. These organisms are primarily marine and show a blend of both invertebrate and vertebrate characteristics. Below is a detailed overview of the key characteristics of protochordates: Classification of Protochordata Protochordate is ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Protoplast Culture Methods
Isolated protoplasts can be cultured in a liquid medium , or semisolid agar medium , either in thin layers or tiny drops of nutrient medium in petridish. The medium used to cultivate protoplasts is the same as that needed for suspension or callus culture. The increase in calcium concentration aids in maintaining the membrane’s integrity. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Protoplasts - Definition, Application and Protoplasts Culture
Protoplast Definition Protoplasts are plant cells that are completely naked with no cell wall however they do have plasma membranes and other components of the cell. They are functional cells, but without the presence of a barrier, cell wall. Protoplasts from various species can be merged to create a hybrid, and this is known as ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Protoplasts fusion - Somatic fusion
The process of somatic fusion is also known as protoplast Fusion, is a kind of genetic modification of plants in which two plant species are merged into a hybrid plant that has the traits of both species the species, an somatic hybrid. Hybrids are created among different species that are of the exact same species ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Protoplasts Isolation
The protoplast, sometimes referred to as a naked plant cell refers to all the constituents in a cell of plant that are not the wall of the cell. The term”protoplast” was first used in the work of Hanstein in 1880 to refer to the living matter contained within the membrane of the plant cell. The ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Protozoa - Definition, Classification, Characteristics, Structure, Locomotion, Examples
What is Protozoa? Protozoa Definition Protozoa are a diverse group of single-celled eukaryotic organisms that can be either free-living or parasitic. They primarily feed on organic matter, including microorganisms and organic debris. Protozoa are characterized by their lack of a rigid cell wall, motility, and heterotrophic feeding habits. Examples include Amoeba, Paramecium, Euglena, and Trypanosoma. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
PRP Centrifuge - Principle, Types, Parts, Applications
PRP Centrifuge is a specialized medical and laboratory device that is used to extract and concentrate Platelet-Rich Plasma (PRP) from the patient’s own blood. It works by spinning the blood sample at high speed. During this process, centrifugal force separates the blood components according to their specific density. The heavier red blood cells (RBCs) sink ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Pseudomonas aeruginosa - Habitat, Diagnosis, Pathogenesis, Treatment
What is Pseudomonas aeruginosa? Scientific classification of Pseudomonas aeruginosa Domain: Bacteria Phylum: Pseudomonadota Class: Gammaproteobacteria Order: Pseudomonadales Family: Pseudomonadaceae Genus: Pseudomonas Species: P. aeruginosa Morphology of Pseudomonas aeruginosa Pseudomonas aeruginosa is a Gram-negative bacterium with several distinctive morphological features that contribute to its pathogenicity and ability to thrive in various environments. Below is a breakdown of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Pseudomonas Aeruginosa on Macconkey Agar
Pseudomonas Aeruginosa Principle The MacConkey Agar is a specialized culture medium widely used in microbiology for the isolation, identification, and differentiation of gram-negative bacteria, particularly those belonging to the Enterobacteriaceae family. The principle of MacConkey Agar lies in its combination of selective and differential properties, making it an effective tool in microbiological analyses. The medium’s ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Pseudomonas Aeruginosa Under Microscope (Gram Staining)
Requirements for Gram stain Procedure Observation of Pseudomonas Aeruginosa Under Microscope When observing Pseudomonas aeruginosa under a microscope, several distinctive characteristics can be noted: In summary, under the microscope, Pseudomonas aeruginosa can be identified as Gram-negative rods with a reddish/pink coloration. They have a rod-like shape, are motile with a polar flagellum (sometimes more than ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Pseudomonas putida - Habitat, Morphology, Pathogenesis, Treatment
What is Pseudomonas putida? Scientific classification of Pseudomonas putida Domain: Bacteria Phylum: Pseudomonadota Class: Gammaproteobacteria Order: Pseudomonadales Family: Pseudomonadaceae Genus: Pseudomonas Species: P. putida Habitat of Pseudomonas putida Pseudomonas putida is a versatile bacterium found in a wide range of environments, thriving in both natural and man-made habitats. Its adaptability to various ecological niches is a ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Pseudopod - Definition, Types, Formation, Functions, Examples
What is Pseudopod? Definition of Pseudopod A pseudopod is a temporary, arm-like extension of the cytoplasm in eukaryotic cells, primarily utilized for cellular motility and phagocytosis. Composed of actin filaments and other cytoskeletal elements, pseudopods enable cells to move and ingest particles. They are highly dynamic and can adopt various forms, such as lamellipodia, filopodia, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Pseudostratified Columnar Epithelium - Definition, Structure, Function, Types
Definition of Pseudostratified columnar epithelium A pseudostratified columnar epithelium an epithelium made up of only one layer of cells which creates the appearance of multiple layers due to the nuclei in the cells are located at various levels. It is histologically an epithelium that is simple, even though when viewed from a cross-section it could ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Psilotum - Structure, Morphology, Anatomy, Reproduction, Life Cycle
Division: Psilophyta Class: Psilotopsida Order: Psilotales Family: Psilotaceae Genus: Psilotum Distribution of psilotum The distribution of Psilotum, commonly referred to as whisk fern, primarily encompasses two species: P. nudum and P. flaccidum. Understanding their geographic spread and ecological niches offers valuable insights into their adaptability and survival strategies. The occurrence of Psilotum The occurrence of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Pteridophyta - Characteristics, Classification, Origin, Ecological and economic importance
What is Pteridophyta? General Characteristics of Pteridophytes Pteridophytes are an ancient group of vascular plants known for their distinctive features and diverse forms. They primarily thrive in moist, shaded environments, although some adapt to aquatic or xerophytic conditions. Here are the key characteristics of pteridophytes, focusing on their morphology, structure, and reproductive processes: Habitat of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Pteridophyta - Characteristics, Life Cycle, Classification, Examples, Importance
Dive into the fascinating world of Pteridophyta, the diverse group of vascular plants commonly known as ferns and their allies. This comprehensive guide will explore: Discover the morphology, anatomy, and reproductive strategies of these ancient plants. Uncover their role in ecosystems and learn about their practical uses in today’s world. Whether you’re a botany student, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Pteris - Morphology and Reproduction
Pteris is a widely distributed genus of ferns that can be found in various geographical locations around the world. Although this genus is cosmopolitan in nature, it thrives primarily in tropical and subtropical climates. Pteris species are typically located in well-drained environments or in the crevices of rocks, where they exhibit a remarkable adaptability to ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Puberty - Definition, Importance, Changes in Male and Female
What is Puberty? Definition of Puberty Puberty is the natural process of physical changes during which a child’s body develops into an adult body capable of sexual reproduction. Effects of early and late puberty onset The effects of early and late puberty onset can have significant implications for both girls and boys. Here’s a breakdown ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Publication of a Research Report
What is Publication of a Research Report? Publication of a scientific research report refers to the process of sharing the findings and outcomes of a research study with the wider scientific community and the general public. It involves preparing a manuscript that describes the research objectives, methodology, results, and conclusions, and submitting it to a ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Pulse Field Gel Electrophoresis (PFGE) Protocol
Pulsed Field Gel Electrophoresis (PFGE) is a highly effective genotyping technique used for the separation and analysis of large DNA molecules, such as entire genomic DNA. It involves digesting the DNA with specific restriction enzymes and applying it to a gel matrix under an electric field that periodically changes direction. PFGE is a modified version ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Pulsed-field Gel Electrophoresis (PFGE) - Definition, Types, Steps, Applications
Pulsed-field Gel Electrophoresis (PFGE) is a molecular biology technique used for separation of very large DNA molecules in an agarose gel. It is used as a DNA fingerprinting method for large chromosomal DNA fragments. Normal agarose gel electrophoresis can separate only smaller DNA fragments, but PFGE can separate DNA fragments up to about 10 megabase ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Pureline Selection - Procedure, Applications, Advantages, Disadvantages
Pureline selection is a method used in plant breeding where plants are chosen from a single self-pollinated variety to create a population that is genetically uniform. It was first introduced by Johannsen (1903) while working with beans (Phaseolus vulgaris). The method based on assumption that variation seen in self-pollinated crops is mostly due to environment ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
PYR (Pyrrolidonyl Arylamidase) Test - Principle, Procedure, Result
PYR test (Pyrrolidonyl Arylamidase test) is a rapid colorimetric biochemical test used in clinical microbiology. It is done for detection of enzyme pyrrolidonyl arylamidase (pyrrolidonyl aminopeptidase) in bacteria. In this test the bacteria is exposed to a synthetic substrate L-pyrrolidonyl-β-naphthylamide. If the enzyme is present the substrate is hydrolyzed and β-naphthylamine is released which is ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Pyramid of Biomass - Definition, Types, Examples
What is Biomass Pyramid? Definition of Biomass Pyramid A biomass pyramid is a graphical representation of the total biomass or organic matter at each trophic level in an ecosystem, illustrating the flow of energy from producers to consumers. What is Biomass? In the scientific realm of ecology, “biomass” is defined as the cumulative mass of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Pyrimidines and Purines Nucleotides - Structure, Occurrence and Properties
Pyrimidines and Pyrimidine Nucleotides Structure of Pyrimidines and Pyrimidine Nucleotides Occurrence of Pyrimidines and Pyrimidine Nucleotides Properties of Pyrimidines and Pyrimidine Nucleotides Biosynthesis of Pyrimidine Pyrimidine Nucleotide Examples Cytosine Thymine Uracil Purines and Purine Nucleotides Structure of Purines and Purine Nucleotides Occurrence of Purines and Purine Nucleotides Properties of Purines and Purine Nucleotides Purine Nucleotides ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Pyronin Y (PY) Solution Preparation and Application
Pyronin Y(G) (PY) is a dye used for DNA staining. PY has orange spectral emission that is easily distinguishable from FITC and 7-AAD.
Pyruvate Broth Test - Principle, Purpose, Procedure, Result
Pyruvate Broth Test is a biochemical test used to determine the ability of a bacterium to utilize pyruvate as a carbon and energy source. It is done in a carbohydrate-free broth medium containing sodium pyruvate. The medium contains an indicator (bromothymol blue) which gives greenish-blue colour initially. If the organism metabolizes pyruvate, organic acids are ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Python Programming Language in Bioinformatics
What is Python Programming? Programming in Python refers to the process of creating computer programmes using the Python programming language. Python is a high-level, interpreted programming language renowned for its readability and simplicity. It was developed by Guido van Rossum and published for the first time in 1991. Python is extensively employed in numerous fields, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Quantitative Buffy Coat Test (QBC Test)
Two different methods of blood tests, thin and thick microscopy, are considered to be the "gold standard" for the diagnosis of malaria. A Quantitative Buffy Coat(QBC) is an additional quick and direct test to make the identification of malaria.
Quantitative Inheritance in Plant Breeding
What is Quantitative Inheritance? Characteristics of Quantitative Inheritance Quantitative inheritance is a complex genetic phenomenon characterized by the inheritance of traits influenced by multiple genes. This type of inheritance plays a critical role in the expression of various traits in organisms, especially those that demonstrate continuous variation rather than discrete categories. Examples of Quantitative Inheritance ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Questionnaires and Schedules
Without data collection, research is incomplete. This begins with the identification of research problems and the design of research. The collection of primary data can be done using a variety of methods, including interviews, observation, questionnaires, schedules and schedules. Schedule and questionnaire are two popular methods for collecting data in research surveys. These two methods ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
R Programming Language in Bioinformatics
What is R Programming Language? R is a programming language and environment developed in the early 1990s by Ross Ihaka and Robert Gentleman at University of Auckland as a free‑software implementation of the S language, intended for statistical computing, graphics, and data analysis, and now widely used across academia, finance, healthcare, data science and research, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Rabies Virus - Structure, Genome Organization, Pathogenesis, Replication
Rabies is a viral disease that causes inflammation of the brain in humans and other mammals. It is transmitted through the saliva of infected animals, usually through a bite. The virus attacks the central nervous system, leading to symptoms such as fever, muscle spasms, and hallucinations. If left untreated, rabies is almost always fatal. It ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Radial Immunodiffusion - Principle, Procedure, Result, Uses
Single Radial Immunodiffusion also referred to as Mancini technique is a quantitative immunodiffusion technique that is used to measure the antigen's concentration by measuring the size of the precipitin-based ring created by the interaction between the antigen with the antibody at the optimal concentration. The antibody is embedded in the agarose gel, while the antigen is diffused into it in the form of a radiatal pattern.
Radiation Sterilization - Types, Mechanism, Applications
Radiation is used to sterilize and decontaminate medical supplies (surgeon supplies, vaccines and drugs) as well as the food and beverage industries. There are two types of radiations available: ionizing or non-ionizing. Radiation sterilization isn’t widely used in the food industry because of concerns about radioactive contamination, toxic or carcinogenic products production, taste alteration, and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Radioimmunoassay (RIA) Test - Definition, Principle, Procedure, Results, Uses
What is Radioimmunoassay (RIA)? Dfinition of Radioimmunoassay (RIA) Radioimmunoassay (RIA) is a highly sensitive laboratory technique that uses radioisotopes to detect and measure the concentration of antigens or antibodies in a sample. Radioimmunoassay (RIA) Principle The principle of radioimmunoassay (RIA) is based on competitive binding, specificity, and sensitivity. In RIA, a radioactive antigen, also known as ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Rapid Furfural Test for Glucose and Fructose - Principle, Procedure, Result
Rapid Furfural Test is a rapid chemical assay used to quickly distinguish between aldohexoses such as glucose and ketohexoses such as fructose. It is done when carbohydrate test solution is mixed with ethanolic α-naphthol solution (Molisch reagent) and concentrated hydrochloric acid (HCl) and then direct boiling is performed. It is based on the principle that ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Rapid Plasma Reagin (RPR) Test - Principle, Procedure, Result, Applications
What is Rapid Plasma Reagin (RPR) Test? Principle of Rapid Plasma Reagin (RPR) Test The principle of the Rapid Plasma Reagin (RPR) test is based on the detection of antibodies produced in response to antigens released by damaged host cells during a syphilis infection. The RPR test is a macroscopic, non-treponemal flocculation card test that ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Raw Materials for Production Media
Industrial fermentation processes leverage a wide array of raw materials, with a significant emphasis on utilizing cost-effective and readily available sources. Among these, agricultural by-products stand out due to their abundance and potential for repurposing. The interest in these materials stems from several key factors: The concept of transforming ‘wastes into resources’ is not just ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
RCF Centrifugation and RPM Centrifugation
When working with centrifuges you’ll encounter two different measurement units that are called the Relative Centrifugal Force (RCF) and the number of revolutions per Minute (RPM). It is essential to be aware of the fact that they are both different. If they are not used correctly (which isn’t as rare as you believe) and the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Reactive Oxygen Species (ROS) - Definition, Types, chemistry, Defence, Roles
What is Reactive Oxygen Species (ROS)? Types of reactive oxygen species (ROS) Reactive oxygen species (ROS) encompass a diverse range of oxygen-containing molecules that exhibit significant chemical reactivity. These species are primarily generated as byproducts of cellular metabolism, particularly through mitochondrial oxidative phosphorylation, as well as through various enzymatic processes. Understanding the types of ROS ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Real-Time PCR (qPCR) - Definition, Principle, Protocol, Application, Advantages
A real-time polymerase chain reaction (real-time PCR) is a conventional polymerase chain reaction (PCR) based laboratory technique used in molecular biology for real-time monitoring of the amplification of a targeted DNA molecule during the PCR, not at its end, as the conventional PCR do.
Receptor - Definition, Structure, Types, Mechanism, Importance, Examples
What is Receptor? Definition of Receptor A receptor is a specialized protein molecule that selectively recognizes and binds to specific ligands, leading to cellular responses or signal transduction within the cell. Types of Receptors Receptors are specialized protein structures integral to cellular communication and response mechanisms. They are primarily categorized based on their cellular location ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Recombinant DNA - Definition, Formation, Applications, Examples
What is Recombinant DNA? Definition of Recombinant DNA Recombinant DNA (rDNA) is a form of DNA constructed in the laboratory by joining genetic material from multiple sources, creating sequences not naturally found in any organism. Characterisitcs Features of Recombinant DNA Recombinant DNA (rDNA) refers to the formation of new combinations of DNA sequences that are ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Recombinant DNA Technology - Steps, Application, Tools, and Limitations
What is Recombinant DNA Technology? Definitions of Recombinant DNA Technology Recombinant DNA technology is a method used to manipulate and combine DNA from different sources to create new genetic combinations. It involves inserting genes from one organism into the DNA of another, allowing for the production of specific proteins or traits not naturally found in ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Red Blood Cell - Morphology, Size, Shape, Color and Inclusion Bodies
Red blood cells constitute the primary cellular component in blood. Red blood cells that are mature are biconcave discs which have no nucleus and are devoid of most cell organelles , including the lysomes, endoplasmic-reticulum and mitochondria.
Reflex Action - Definition, Types, Mechanism & Examples
What is Reflex Action? Definition of Reflex Action Reflex action is an automatic and rapid response to a stimulus that occurs without conscious control or thought. It involves the activation of sensory neurons, interneurons, and motor neurons to produce a quick and stereotyped response, often for the purpose of self-preservation or protection. Types of reflex ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Regeneration - Definition, Types, Mechanism, Examples
What is Regeneration? Definition of Regeneration Regeneration is the natural process by which organisms restore, repair, or replace lost or damaged body parts through the growth and differentiation of specialized cells, often known as stem cells. Types of Regeneration Regeneration, a pivotal biological process, can be classified into distinct types based on the underlying mechanisms ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Regulation of Glycolysis
Glycolysis is the primary stage in the process of breaking down glucose in order to obtain energy to power the cell’s metabolism. The majority of living organisms perform glycolysis as a part in their metabolic process. This process does not require oxygen, which is why it is considered anaerobic. Glycolysis happens in the cytoplasms of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Regulation of Heart Rate - Nervous And Chemical Regulation
The regulation of heart rate is a critical component of cardiovascular physiology, influencing overall heart function and health. Heart rate (HR) is defined as the number of times the heart beats within a minute. Together with stroke volume (SV), which is the volume of blood ejected from each ventricle during a single contraction, heart rate ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Repeater Pipette - Parts, Procedure, uses
Repeater pipette is a special type of pipette used to dispense the same volume of liquid many times after a single aspiration. It is also called stepper pipette or multi dispenser pipette. It is used when repetitive dispensing is required in routine laboratory works. It works on positive displacement mechanism in which a piston inside ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Repetitive sequence-based PCR (rep-PCR) - Principle, Steps, Uses
Repetitive sequence-based PCR (rep-PCR) is a molecular technique used to produce genetic fingerprint of bacteria and fungi. It is used for identification and classification of microorganisms at species, subspecies or strain level. It is based on the presence of repetitive DNA sequences in microbial genome. These sequences are non-coding and occur in many copies. In ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Replicative Transposition of DNA Transposons and Retrotransposons
What is replicative transposition? Replicative transposition is a type of transposition in which the transposable element is duplicated during its movement from one site to another. It is the process where the original transposable element remains at the donor site and a new copy is inserted into the target DNA. This is referred to as ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Reproduction In Protista and Life Cycle
Reproduction in Protista Methods of Reproduction in Protists The following paragraphs emphasise the two essential reproductive strategies of protists. The procedures are: A. Asexual Reproduction in Protists Mode of Asexual Reproduction In Protista 1. Binary Fission Mitosis is the division of the parent cell into two identical daughter cells. Examples: Amoeba, Euglena and Paramecium. 2. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Reproduction in Protozoa - Sexual reproduction, Asexual reproduction
Protozoa carried out their reproduction by asexual and sexual mode of reproduction. The higher group of protozoa follow mainly sexual reproduction. Some protozoa carried out both asexual and sexual reproduction based on the types of the host cells.
Reproduction of Fungi - Sexual, Asexual and Vegetative Reproduction
There are different modes of reproduction in fungi such as sexual, asexual, and vegetative modes of reproduction. There are involve different methods in asexual mode, sexual mode, and vegetative mode of reproduction, each of these methods are discussed below; Different modes of reproduction in fungi Mainly there are three types of reproduction in fungi such ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Reproductive System - Development and Differentiation
What is Reproductive System? The reproductive system, also known as the genital system or the reproductive tract, is a collection of organs and structures in the human body that are involved in the process of sexual reproduction. Its primary function is to produce, nurture, and deliver gametes (sex cells) and facilitate the union of sperm ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Reproductive System in Insects - Structure, Types, Functions
The reproductive system in insects is highly specialized and varies significantly across species, reflecting their diverse life histories and ecological roles. In general, both male and female insects possess distinct reproductive organs tailored for the production, fertilization, and development of offspring. The male reproductive system typically consists of paired testes that produce sperm, which is ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Reproductive System of Earthworm
Reproductive System of Earthworm Male Reproductive Organs of Earthworm The male reproductive system of the earthworm is a meticulously organized structure, designed for the efficient production and transportation of sperm. This system is characterized by a series of specialized organs, each playing a pivotal role in the reproductive process. 1. Testes: 2. Testis Sacs: 3. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Reproductive System of Fish - Types, Organs, Modes, Factors
Types and modes of reproduction in Fish Reproduction in fish is characterized by diverse methods and strategies that reflect adaptations to their environments. Fish reproduction is broadly categorized into two main types: sexual and asexual reproduction. Each of these methods has distinct processes and implications for the species involved. Organs of reproduction TESTES The testes ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Reptilia - Definition, Characteristics, Classification
What is Reptilia? Reptilia Scientific Classification Characteristics of Reptilia The characteristics of animals belonging to Class Reptilia are as follows: Some examples of reptiles include snakes, turtles, lizards, and crocodiles. These animals exhibit a wide range of adaptations and behaviors that have allowed them to thrive in diverse habitats across the globe. Origin of the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Research - Definition, Objectives, Components, Steps, Significance
What is Research? Definition of Research Research is a systematic and methodical investigation aimed at generating new knowledge, solving problems, or validating existing information through the collection, analysis, and interpretation of data. Objectives of research The objectives of research are diverse and depend on the specific goals of the study. Research is fundamentally aimed at ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Respiration in Mollusca
Types of Respiration in Mollusca Mollusca exhibit various types of respiration, depending on their habitat and morphology. Their respiratory systems are adapted to meet the specific demands of their environments. The three primary types of respiration in mollusks are cutaneous, branchial, and pulmonary respiration. Aquatic Respiration in Mollusca Aquatic respiration in mollusks involves the extraction ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Respiratory Pigments - Examples and Functions
What Are Respiratory Pigments? Examples of Respiratory pigments Below are the primary examples of respiratory pigments, highlighting their structure, function, and variations. Comparative analysis of respiratory pigments reveals distinct differences and similarities among them: Evolutionary significance of respiratory pigments The evolutionary significance of respiratory pigments is profound, as these molecules have enabled organisms to adapt ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Respiratory Syncytial Virus (RSV) - Definition, Structure, Genome, Replication, Pathogenesis
Respiratory syncytial virus RSV is a member of the family Paramyxoviridae and possesses a continuous, single-stranded, negative-sense RNA genome. Paramyxoviruses are globally significant to both human and animal populations. This family contains several highly contagious viruses, including the human pathogens measles, mumps, and RSV, and the zoonotic viruses Hendra and Nipah. Human RSV (hRSV) is ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Respiratory System of Fishes
The respiratory system of fishes is a highly specialized and efficient mechanism that allows them to extract oxygen from water. As aquatic organisms, fish must adapt to the lower oxygen content in water compared to air, and their respiratory systems have evolved to maximize the efficiency of gas exchange. Below is an overview of the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Respiratory System of Frog
The respiratory system of a frog is quite interesting because frogs have multiple ways to exchange gases with their environment. Here’s a brief overview: It’s important to note that while frogs have lungs, they rely heavily on their skin for gas exchange, especially when they are in water. This dual mode of respiration allows them ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Respiratory System of Vertebrata - Skin, Gills, Lungs and Air Sacs
What is Respiratory System? The respiratory system is a complex network of organs and tissues in living organisms that is responsible for the exchange of gases, primarily oxygen and carbon dioxide, between the organism and its environment. It plays a crucial role in facilitating the intake of oxygen required for cellular respiration and eliminating carbon ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Restriction Digest - Protocol, Principle, result
The restriction enzymes cleave the DNA molecule at a specific site or specific nucleotide sequence, is known as recognition sequences or Restriction sites.
Restriction Enzyme (Restriction Endonuclease) - Definition, Types, Examples, Functions
What is Restriction Enzyme (Restriction Endonuclease)? Definition of Restriction Enzyme (Restriction Endonuclease) A restriction enzyme, also known as a restriction endonuclease, is an enzyme that cuts DNA at specific recognition sites, called restriction sites. It is primarily found in bacteria and archaea and serves as a defense mechanism against invading viruses. Restriction enzymes are commonly ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Restriction Fragment Length Polymorphism (RFLP)
What is Restriction Fragment Length Polymorphism (RFLP)? Principle of Restriction Fragment Length Polymorphism (RFLP) Restriction Fragment Length Polymorphism (RFLP) is a powerful technique used in molecular biology to analyze genetic variations and identify differences in DNA sequences. This technique relies on the principle that the DNA fragments generated by the digestion of DNA with specific ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Reticulocyte Count - Principle, Procedure, Calculations and Clinical Significances
What is Reticulocytes? Reticulocytes are immature red blood cells (erythrocytes) that have not yet completed the final stages of maturation. They are usually produced in the bone marrow and have a characteristic reticulated (network-like) appearance when stained with special dyes. Reticulocytes are important in the evaluation of anemia, as they provide information about the bone ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Retrogressive Metamorphosis in Urochordates
Retrogressive Metamorphosis Retrogressive metamorphosis refers to a specific type of metamorphosis observed in ascidians or tunicates, which are a type of urochordate. Metamorphosis is a process in which an organism undergoes a profound change in form during post-embryonic development, typically transitioning from a larval stage to an adult stage. In retrogressive metamorphosis, the larva possesses ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Retrovirus - Definition, Types, Structure, Replication
What is a Retrovirus? Definition of Retrovirus A retrovirus is a type of RNA virus that replicates by converting its RNA genome into DNA through the enzyme reverse transcriptase. This DNA is then integrated into the host cell’s genome, where it directs the production of new viral particles. Retroviruses are associated with various diseases, including ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Reverse Blood Grouping - Principle, Procedure, Result
Reverse grouping is defined as using the reagent cells with known ABO antigens and testing the patient’s serum for ABO group antibodies.
Reverse CAMP test - Principle, Procedure, Result, Uses
In this method, the Group B Streptococcus (CAMP test positive) is streaked in the center of sheep blood agar, and Clostridium perfringens is streaked perpendicular to it.
Reverse Transcription PCR (RT-PCR) - Principle, Steps, Applications
Reverse Transcription PCR (RT-PCR) is a molecular technique used to detect and amplify RNA. It is used because normal PCR cannot directly amplify RNA. In this technique, RNA is first converted into complementary DNA (cDNA). This conversion is done by the enzyme reverse transcriptase. The formed cDNA is more stable than RNA and it works ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Reverse transfection - Definition, Protocol, Applications
Reverse transfection is a technique used in molecular biology to introduce a sample of RNA, DNA or protein into cells in culture. Instead of adding the reagents to the cells and allowing them to take them up (forward transfection), reverse transfection involves incubating the cells on a surface that is coated with the reagents. The ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Reversed-Phase Chromatography - Principle, Protocol, Applications
What is Reversed-Phase Chromatography? Principle of Reversed-Phase Chromatography The matrix in reversed-phase chromatography Stationary phases Mobile phases Protocol of Reverse-phase chromatography Uses of Reverse-phase chromatography Advantages of Reverse-phase chromatography Limitations of Reverse-phase chromatography FAQ
Rh Blood Group System - Definition, Antigens, Antibody
What is The Rh blood group? Nomenclature of Rh blood group Antigens of the Rh blood group The Rh blood group system consists of 49 antigens, with the most significant ones being D, C, E, c, and e. The specificity of most Rh antigens is determined by the sequence of amino acids in the proteins. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Rhizopus microsporus - overview
Rhizopus species, such as Rhizopus microsporus, are frequently associated with mucormycosis, a fatal fungal infection that affects immunocompromised patients. Mucormycosis necessitates the development of new therapeutic modalities due to its escalating prevalence, unacceptably high mortality rate, and the extreme morbidity of its highly disfiguring surgical treatment. Creative Biolabs has the knowledge and experience in the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Rhizopus nigricans - Life Cycle, Repoduction, Morphology, Pathogenesis
Rhizopus nigricans is a species of fungus belonging to the genus Rhizopus in the order Mucorales. It is commonly known as black bread mold or black mold. Rhizopus nigricans is a saprophytic fungus, meaning it obtains its nutrients from dead organic matter. It is known for its rapid growth and ability to spoil a variety ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Rhizopus oligosporus - Overview
Rhizopus oligosporus classification Rhizopus oligosporus is a filamentous fungus belonging to the kingdom Fungi and the phylum Zygomycota (also known as the phylum Glomeromycota). It is further classified into the following taxonomic ranks: So, the complete taxonomy classification of Rhizopus oligosporus is as follows: Morphology of Rhizopus oligosporus The morphology of Rhizopus oligosporus can be ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Rhizopus sporangia - Overview
Habitat of Rhizopus sporangia Rhizopus sporangia are typically found in a variety of habitats where the fungi of the genus Rhizopus thrive. These habitats include: Rhizopus sporangia Characteristics Rhizopus sporangia have several characteristic features that distinguish them from other fungal structures. Here are some key characteristics of Rhizopus sporangia: Rhizopus sporangia Taxonomy Classification Rhizopus sporangia ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Rhizopus spp - Structure, Life cycle, Habitat, Pathogenesis
Habitat of Rhizopus spp Rhizopus spp. is a genus of fungi found in numerous habitats, including soil, decomposing plant matter, and food. Additionally, they are prevalent in indoor environments, such as homes and businesses. Rhizopus spp. can thrive in a variety of environments, including warm and humid conditions as well as cooler and drier conditions. Additionally, they ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Rhizopus stolonifer - Life Cycle, Habitat, Nutrition, Disease, Importance.
Rhizopus stolonifer is responsible for ripe fruits, such as strawberries, melon, and peach, mainly those contain wounds and higher sugar content. During germination, it produces esterases, including cutinase which enable the penetration of fungus into the plant cell wall.
Rhizopus Under Microscope
What is Rhizopus? Mold or Rhizopus Under the Microscope Preparing specimen Studying the intricate world of mold and fungi under the microscope offers a fascinating glimpse into the hidden realms of life. While one can readily discover mold on decaying organic matter in nature, cultivating and preparing specimens for microscopic observation provides a controlled and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Rhizosphere - Definition, Bacteria, Structure, Importance
What is Rhizosphere? The rhizosphere is the small area of soil around plant roots that is directly affected by root secretions and the microbes that live there. Usually goes about one millimeter from the root surface and includes soil that sticks to the roots and can be easily shook off. Root exudates and rhizodeposition: Roots ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Rhodophyta (Red Algae) - Characteristics, Morphology, Importance
What is Rhodophyta (Red Algae)? The Rhodophyta (red algae) are a group of mostly marine, photosynthetic, eukaryotic organisms. They are colored red (or shades of red / purple) because of accessory pigments like phycoerythrin (and phycocyanin) which mask the green of chlorophyll. The cells do not have flagella or centrioles at any stage. Unstacked thylakoids ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Ribosome - Types, Structure, Function, and Diagram
Ribosomes, sometimes referred to as Palade granules (after the discovery of George Palade and due to their granular shape) are macromolecular devices which are present in every cell, and that carry out biochemical protein synthesizing (mRNA translation).
Ribozymes (RNA enzymes) - Definition, Structure, Function, Types
Ribozymes are catalytic RNA molecules, and it is the process where RNA itself act as an enzyme in different biochemical reactions. It is the first biological evidence that RNA can work both as a genetic material and also as a catalyst. This is referred to as the dual activity of RNA, and it gives support ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Rickettsia Infection (Tick-Borne Rickettsioses) - Transmission, Diagnosis, Pathogenesis, Treatment
Rickettsia is a small, Gram-negative, obligately intracellular bacterium. It is the organism which can grow and multiply only inside the living host cell. It is highly specialized bacteria showing extreme genomic reduction. Due to this, many metabolic pathways are absent and the bacteria is unable to synthesize its own energy. It depends on the host ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Ring Precipitation Test - Principle, Procedure, Result
To determine the presence or absence of antigens or antibodies in a patient, many tests have been developed that use the interaction of antibodies and antigens. These tests require specificity and sensitivity. Specificity refers to the property of only binding to one antigen. Sensitivity means that the antibody can recognize and bind the antigen.
RNA - Definition, Structure, Types, Application
What is RNA? Definition of RNA RNA, or Ribonucleic acid, is a nucleic acid molecule that plays a crucial role in gene expression and protein synthesis. It is a single-stranded molecule composed of nucleotides, including adenine (A), cytosine (C), guanine (G), and uracil (U). RNA carries genetic information from DNA and acts as a template ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
RNA Interference (RNAi) - Definition, Mechanism, Application
RNA Interference Definition RNA interference is the process by which RNA molecules suppress gene expression by neutralising the targeted messenger RNA molecules. RNA Interference Mechanism The RNA interference mechanism can be explained in the following steps: Why RNAi as a genetic tool? RNA Interference Applications References
RNA Polymerase - Structure, Definition, Types, and Functions
Ribonucleic acid (RNA) Polymerase (RNAP) enzyme is a multi-subunit enzyme which uses its function to catalyze the transcription process RNA produced from DNA template.
RNA Splicing - Definition, Types, Mechanisms
What is RNA splicing? In order for mRNA to be translated into a protein, RNA splicing removes the intervening, non-coding sections of genes (introns) from pre-mRNA and links the protein-coding sequences (exons) together. Facts of RNA splicing What is Intron? What is Exon? What is Spliceosome? Types of Spliceosome There are two types of spliceosomes: ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Robertson’s Cooked Meat Medium (RCM Medium) - Composition, Preparation, Uses
Cooked Meat Medium was originally developed by Robertson to cultivate specific anaerobes isolated from wounds.
The current formulation is a modified version, sometimes referred to by the name of Chopped Meat Medium, which allows for the growth of a variety of spores and non-spore-forming strict anaerobes.
Rocket Immunoelectrophoresis - Definition, Principle, Procedure, Result, Application
Rocket Immunoelectrophoresis (RIEP) also known as electro-immuno diffusion is a simple, quick and reproducible method for determining the concentration of antigen (Ag) in an unknown sample.
Role of ADH, Angiotensin and Aldosterone In Osmoregulation
What is Osmoregulation? Role of ADH, Renin-Angiotensin and Aldosterone in Osmoregulation 1. Role of ADH (Anti-diuretic Hormone) in Osmoregulation The role of the antidiuretic hormone (ADH), also known as vasopressin, in osmoregulation is pivotal for maintaining the body’s water balance and ensuring the stability of its internal environment. Here’s a detailed and sequential explanation of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Role of Ethnobotany In Modern Medicine
In this article you will. learn about Medico-ethnobotanical sources in India;Significance of the following plants in ethnobotanical practices (along with their habitat and morphology) a) Azadiractha indica b) Ocimum sanctum c) Vitex negundo. d) Gloriosa superba e) Tribulus terrestris f) Pongamia pinnata g) Cassia auriculata h) Indigofera tinctoria. Role of ethnobotany in modern medicine with ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Rolling Circle Replication - Mechanism, Importance
What is Rolling circle replication? Rolling circle replication is a unidirectional and asymmetric process of nucleic acid replication. It is the process by which multiple copies of circular DNA or RNA molecules is synthesized rapidly. This mechanism is commonly seen in bacterial plasmids, bacteriophages and certain plant and animal viruses. In this type of replication ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Romanowsky Stains - Principle, Types, Applications
What are the Romanowsky Stains? Romanowsky stains are the polychromatic stains that are used in hematological and cytological studies to differentiate blood cells and bone marrow cells under the microscope. It is the process where a mixture of acidic dye (Eosin Y) and basic dyes (oxidized methylene blue or Azure B) is applied, and this ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Root Cap - Definition, Structure, Development, Functions
What is Root Cap? Definition of Root Cap The root cap is a protective, cap-like structure at the tip of a plant root, composed of parenchyma cells. It safeguards the sensitive root tip during growth through soil, facilitates downward root growth through gravity perception, and secretes mucilage to ease movement through soil. Structure of Root ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Root Culture - Principle, Protocol, Importance and Applications
What is Root Culture? Principle of Root Culture Protocol of Root Culture Below is a detailed protocol outlining the processes involved in initiating root cultures and clones. Importance of Root Culture Root culture is a critical area of plant biotechnology that contributes significantly to our understanding of root physiology and various applications in plant science. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Root Endodermis and Exodermis - Structure, Function, and Responses to the Environment
What is endodermis? Structure of endodermis The endodermis is a specialized layer of cells that plays a crucial role in the roots of vascular plants. Its structure is uniquely designed to fulfill specific functions essential for the regulation of water and nutrient uptake while providing protection against environmental stressors. Below are the key structural features ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Root Hair Cells - Structure, Formation, Functions
What are root hair cells? Structure of Root Hair Root hairs are slender, tubular extensions of epidermal cells located at the root tips, specializing in water and nutrient absorption. Their unique structure is optimized for efficient interaction with the soil environment, allowing plants to maximize the uptake of essential resources. Key Components of Root Hair ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Rotavirus - Structure, Genome, Replication, Pathogenesis
Rotavirus is a family of double-stranded RNA viruses belonging to the genus Reoviridae. Rotaviruses are the leading cause of diarrhea in neonates and young children. By the age of five, nearly every child in the world has been infected with rotavirus at least once.Immunity develops with each infection, reducing the severity of subsequent infections. Rarely ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Rothera's test - Principle, Procedure, Result
Acetoacetic acid and acetone react with an alkaline solution of sodium nitroprusside to form a purple-colored complex. This method can detect above 1-5 mg/dl of acetoacetic acid and 10-20 mg/dl of acetone. Beta-hydroxybutyrate is not detected.
Rotor Stator Homogenizers - Principle, Procedure, Parts, Uses
Rotor Stator Homogenizer is a mechanical homogenizer used for mixing, emulsification and particle size reduction. It consists of two main parts, the rotor and the stator. The rotor is the rotating part and the stator is the fixed outer part. The rotor rotates at high speed inside the stator. Due to this rotation, the liquid ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Rough vs Smooth Endoplasmic Reticulum
The rough and smooth ERs are the two kinds of endoplasmic-reticulum that form an interconnected system made up of membrane-bound channels that are located in the cell's cytoplasm. ER is an organelle that is enclosed by membranes found only in the eukaryotic cell.
rRNA - Structure, Definition, Types, Functions
What is Ribosomal RNA (rRNA)? Discovery of Ribosomal RNA Structure of rRNA Detail Structure of rRNA 5S ribosomal RNA 5S ribosomal RNA Structure Location within the ribosome Functions of 5s rRNA 23S ribosomal RNA Structure 23S rRNA Functions 16S ribosomal RNA Structure Functions of 16S ribosomal RNA 28S ribosomal RNA Structure Functions 18S ribosomal RNA ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Rubber Yielding Plants
What is Natural Rubber? Para Rubber The Para rubber tree (Hevea brasiliensis) is the main source of natural rubber, contributing 90-95% of the world’s rubber production. This species is indigenous to the Amazon and Orinoco river valleys in South America, where the hot, humid climate provides optimal growing conditions. The region, spanning over one million ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Sabouraud Dextrose Agar (SDA) - Composition, Preparation, Principle, Uses, Results
Raymond Sabouraud created Sabouraud Dextrose Aga or SDA in 1892. Sabouraud Dextrose Aggar is useful in the cultivation of fungi (yeasts and moulds), especially for skin infections.
Saccharomyces Life cycle, Morphology, Economic Importance.
Yeast or Saccharomyces cerevisiae is a eukaryotic, unicellular microorganism and a member of the fungus kingdom. These are the unicellular microorganism which is evolved from multicellular ancestors.
Sahli’s Method For The Estimation Of Hemoglobin
Hemoglobin, often abbreviated as Hb, is a vital protein found in red blood cells (RBCs). Its primary role in the human body includes the transport of oxygen from the lungs to various tissues and the transfer of carbon dioxide from tissues back to the lungs. Additionally, hemoglobin plays a significant role in maintaining the pH ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Salmonella - Morphology, Antigenic structure, Cultural and Biochemical Characteristics
What is Genus Salmonella? Scientific classification Domain: Bacteria Phylum: Pseudomonadota Class: Gammaproteobacteria Order: Enterobacterales Family: Enterobacteriaceae Genus: Salmonella History of Salmonella The discovery and study of Salmonella have significantly advanced our understanding of bacterial pathogens. Below is a breakdown of key historical milestones in the study of this genus. Geographical Distribution and Habitat of S. Typhi ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Salmonella Shigella Agar (SS Agar) - Principle, Composition, Application
Salmonella Shigella (SS) Agar can be moderately specific and a differing medium used for the cultivation, isolation as well as differentiation Salmonella spp. and a few varieties that belong to Shigella spp.
Salmonella Under Microscope
What is Salmonella? Salmonella is a group of gram-negative bacillus bacteria that is responsible for causing food poisoning and subsequent infections in the intestinal tract. While some infections can be effectively treated, there are certain strains that have developed resistance to antibiotics, making them potentially deadly. Consequently, Salmonella infections should not be underestimated and require ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Salmonellosis - Food Infection and Food Poisoning by Salmonella
Salmonellae are common infections in both humans and animals. They practically populate any animal, including livestock, poultry, birds, reptiles, rodents, domesticated animals, and people. One of three clinical syndromes, such as gastroenteritis, enteric fever, or localised disease, are frequently brought on by salmonella infections in humans. Salmonella infections in animals also result in significant losses ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Salt Meat Broth
Salt Meat Broth is used as an enrichment medium for staphylococci isolation from severely contaminated specimens.
Salt Tolerance Test - Principle, Purpose, Procedure, Result
The ability to develop in the presence of varying concentrations of sodium chloride (NaCl) has been used to distinguish between various bacteria.
Sample Preparation and composition
ACK Lysis Buffer Preparation ACK Lysis Buffer is used to lyse red blood cells. To prepare 1L of ACK Lysis Buffer the following components are required; Component Amount Concentration NH4Cl (mw: 53.49 g/mol) 8.02 g 0.15 M KHCO3 (mw: 100.12 g/mol) 1 g 0.01 M Na2EDTA (mw: 372.24 g/mol) 37 mg 0.0001 M ACK Lysis ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Sampling of Bacteria From Air
The process of collecting bacteria from the air for analysis involves several techniques, one of the simplest being the utilization of open Petri dishes filled with a growth medium. These dishes are exposed to the air, allowing airborne bacteria to settle and subsequently grow on the medium, which can then be examined to identify the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Sampling of Bacteria From Air
The process of collecting bacteria from the air for analysis involves several techniques, one of the simplest being the utilization of open Petri dishes filled with a growth medium. These dishes are exposed to the air, allowing airborne bacteria to settle and subsequently grow on the medium, which can then be examined to identify the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Sampling of Bacteria From Water
When examining water samples for bacterial content, direct microscopic observation often yields minimal visible bacteria due to their small size and low concentrations. To overcome this challenge and accurately assess the bacterial population in water, scientists employ the filtration technique. This method is pivotal for both quantifying bacteria per unit volume of water and analyzing ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Sampling of Microorganisms From Soil
Exploring the microscopic world within soil requires precise techniques for the effective sampling of microorganisms, such as bacteria. These organisms play crucial roles in various ecological processes, including nutrient cycling, and understanding their presence and diversity is vital for both scientific research and environmental monitoring. Two widely recognized methods facilitate the direct observation of these ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Sandwich (Davson–Danielli) model of cell membrane
The Davson Danielli model (or the paucimolecular model) was an illustration that depicts the membrane in cells. It was developed in the year 1935 by Hugh Davson and James Danielli The model is a bilayer of phospholipids which is located within two layers of protein globular. the model is trilaminar as well as lipoproteinous.
Sandwich ELISA - Definition, Principle, Steps, Advantages
What is Sandwich ELISA? Sandwich ELISA Principle The principle of sandwich ELISA involves the detection of antigens using a combination of specific antibodies. The test begins by coating and immobilizing a known antibody onto the wells of a microtiter plate. This immobilized antibody serves as the capture antibody, which will bind to the antigen of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Sanger Sequencing - Principle, Steps, Advantages, Uses
What is Sanger Sequencing? Principle of Sanger Sequencing The principle of Sanger sequencing is rooted in the termination of DNA strand elongation by dideoxynucleotide triphosphates (ddNTPs). These ddNTPs are modified versions of normal DNA nucleotides that lack a 3’ hydroxyl group, which is essential for forming a phosphodiester bond. Without this bond, the DNA strand ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Sanger Sequencing vs Next Generation Sequencing (NGS)
What is Sanger Sequencing? Sanger Sequencing Workflow/Steps Sanger sequencing is a DNA sequencing method known for its reliability and accuracy. The process involves the formation of a reaction system, amplification of the target segment, gel electrophoresis, and sequence reading. Here’s a step-by-step breakdown of the Sanger sequencing workflow: 1. DNA Sequence for Chain Termination PCR ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Saprophytes - Definition, Types, Characteristics, Nutritions, Examples
Sometimes referred to as saprotrophs saprophytes are organisms that receive nutrition from decaying and dead organic matter, particularly plant matter.
Sapwood and Heartwood - Definition, Structure, Functions
What are Sapwood and Heartwood? Sapwood and heartwood represent two distinct yet essential components of a tree’s structure, playing crucial roles in the overall functionality and durability of wood. Understanding these components is fundamental for students and educators studying plant biology, botany, or forestry. Structure and Development of Sapwood and Heartwood The structure and development ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
SARS-CoV-2 (COVID-19): Transmission, pathogenesis, replication
SARS-CoV-2 is the virus that causes COVID-19. COVID-19 is a highly infectious respiratory illness that can spread from person to person through respiratory droplets or close contact. The virus was first identified in Wuhan, China in December 2019 and has since spread to become a global pandemic. Symptoms of COVID-19 can range from mild to ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Satellitism Test - Principle, Procedure, Result, Applications
What is Satellitism Test? Definition of Satellitism Test The Satellitism Test is a biochemical assay used to differentiate Haemophilus influenzae from other Haemophilus species based on their growth factor requirements. In this test, H. influenzae grows proximally to Staphylococcus aureus colonies on blood agar due to the latter’s production of necessary growth factors, a phenomenon ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Scanning Electron Microscope - Principle, Parts, Uses
Scanning Electron Microscope (SEM) is an advanced magnifying instrument that is used to observe the surface of a sample by using focused beam of accelerated electrons. It does not use visible light for image formation. It uses electron beam because electrons have much shorter wavelength than light photons. So, SEM can produce image with very ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Schistosoma haematobium - Life cycle, pathogenicity and prophylaxis
What is Schistosoma haematobium? Kingdom: Animalia Phylum: Platyhelminthes Class: Trematoda Order: Diplostomida Family: Schistosomatidae Genus: Schistosoma Species: S. haematobium History and Distribution of Schistosoma haematobium Habitat Below are the key aspects of the habitat of S. haematobium: Hosts of Schistosoma haematobium Below are the key aspects regarding its hosts: Characteristics of Schistosoma haematobium Morphology of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Schistosomiasis - Life cycle, Symptoms, Treatment, Prevention
Schistosomiasis also termed snail fever or bilharzia is a disease caused by parasitic flatworms called schistosomes. Infection with Schistosoma mansoni, S. haematobium, and S. japonicum causes illness in humans; less commonly, S. mekongi and S. intercalatum can cause disease.
Schizosaccharomyces: Morphology, Reproduction, life cycle
The S. octosporous contain a haploid somatic cell. During the favorable condition, cells undergo through asexual cycle known as fission and haplobiontic sexual cycle.
Scientific Method - Dfinition, Steps, Examples, Importance
What is Scientific Method? Definition of Scientific Method The scientific method is a systematic procedure used in scientific research to formulate hypotheses, gather data through observation and experimentation, and draw conclusions based on empirical evidence. It emphasizes objectivity, repeatability, and falsifiability in the pursuit of knowledge. Scientific Method Steps The scientific method is a systematic ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Scope of Epidemiology
Definition of Epidemiology Overview of Epidemiology Scope of Epidemiology/Objective of Epidemiology The objectives of epidemiology are to: Major Areas of Discussion in Epidemiology The Major Areas of Discussion in Epidemiology are; Population Disease frequency Disease Distribution Disease Determinants Disease Control Fields of Epidemiology
Scope of Microbiology
Microbiology is among the most popular subjects after BiPC and is an important field of Biology that studies the study of fungi, bacteria virus, as well as other microorganisms that can’t be observed with eyesight. Microbiologists identify and study the behaviors of microbes under certain circumstances and the effect they may have on the environment. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Scope of Microbiology in Nursing
As their name suggests, microorganisms are minute organisms with the potential to adapt to their environment; for instance, commensals can become pathogenic in certain altered environments. The adaptability of microbes to certain treatments or medications remains a challenge for nurses and other medical professionals. Microbiology influences the lives of a nurse working in a medical ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Scope of Zoology
Have you ever wondered how the human body operates? How did we discover that the human body contains 206 bones? How do we know that DNA is our body’s genetic material? Zoology, the study of animals, has enabled us to comprehend our bodies and those of all other species. It is also beneficial to comprehend ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
SDS-PAGE - Sodium Dodecyl Sulfate Polyacrylamide Gel Electrophoresis (PAGE)
What is SDS-PAGE? Definition of SDS-PAGE SDS-PAGE is a technique used to separate proteins based on their molecular weight by using a gel matrix and the denaturing agent sodium dodecyl sulfate (SDS). Objective Principle of SDS-PAGE SDS–PAGE refers as Sodium Dodecyl Sulfate–PolyAcrylamide Gel Electrophoresis, and its main principle based on separation of proteins mainly by ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Seafood Toxins and Fish & Shellfish Poisoning
Seafood toxins and fish and shellfish poisoning pose a significant risk to public health globally. These toxins are present in marine fish, bivalve shellfish, and even freshwater fish, and can cause foodborne illnesses when consumed by humans. While seafood is generally considered nutritious and beneficial to health, it can also harbor various toxins that can ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Secondary Consumers - Definition, Types, Functions, Examples
What are Secondary Consumers? Definition of Secondary Consumers Secondary consumers are organisms that primarily feed on primary consumers, which are herbivores, in a food chain. They occupy the third trophic level and can be either carnivores, who eat only other animals, or omnivores, who consume both animal and plant matter. Their role is vital in ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Secondary Databases - Definition, Types, Examples, Uses
Secondary Databases Definition Secondary databases are repositories or resources that are specialized in storing and providing access to specific types of biological data within the field of bioinformatics. The creation of these databases is commonly achieved through the curation, organization, and integration of data from diverse primary sources, including experimental studies, literature, and other primary ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Secretion - Definition, Mechanism, Importance
What is Secretion? Definition of Secretion Secretion is the process by which cells actively transport molecules, often synthesized within the cell, to their exterior environment. Purpose of Secretion How Does Secretion Occur? Cellular secretion is a multifaceted process that involves the transport of substances from the interior of a cell to its exterior. This process ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Secretory System In Plants - External secretory and Internal secretory Tissues
The classification of secretory tissues in plants The classification of secretory tissues in plants is essential for understanding how they function and interact with their environment. These tissues are broadly divided into two main categories based on their position within the plant body: external secretory tissues and internal secretory tissues. Each category serves specific purposes ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Secretory Vesicles - Definition, Structure, Functions, and Diagram
may contain materials that must be eliminated from the cell. These materials could be harmful to cells, such as end products of chemical reactions or waste products.
Seed - Structure, Types, Development, Germination, Dispersal
What is Seed? Size and shape of Seed The size and shape of seeds exhibit considerable diversity, reflecting their adaptation to various ecological niches and functional requirements. This variability plays a crucial role in dispersal, survival, and germination strategies. Type of seed Seeds can be classified based on various criteria, including the number of cotyledons ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Seed Dispersal - Methods, Agents, Significance, Examples
What is Seed Dispersal? Types of Seed Dispersal Seed dispersal is a critical process for plant reproduction, ensuring that seeds are spread to new locations where they can germinate and grow. Various methods have evolved, each adapted to different environmental conditions and ecological interactions. The primary types of seed dispersal include: Agents of Seed Dispersal ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Selaginella - Morphology, Anatomy and Reproduction
Class Lycopodiopsida Order Selaginellales Family Selaginellaceae Genus Selaginella Habitat of Selaginella Selaginella species exhibit remarkable diversity in their habitats, being widely distributed across both tropical and temperate regions. The genus, comprising around 700 species, thrives in a variety of environmental conditions, adapting to both humid and arid ecosystems. Below is a detailed exploration of their ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Selection Methods For Self pollinated Plants - Breeding self-pollinated species
What are self pollinated Plants? Self-pollinated plants are those that can fertilize themselves without the need for pollen from another plant. This process occurs when pollen from the flower’s own anthers (the part of the flower that produces pollen) transfers to its own stigma (the part of the flower that receives pollen). Self-pollination ensures that ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Selenite F Broth - Composition, Principle, Preparation, Results, Uses
Selenite Broth was invented by Leifson who proved that selenite is inhibitory to bacteria, coliforms, and other species, like streptococci from feces, which are found in fecal samples and, consequently, beneficial in the recuperation from Salmonella species. Selenite-F Broth is utilized to enrich the environment that is buffered by Lactose Peptone Broth to which Sodium Biselenite is added to act as the agent that is selective for elimination of Salmonella from urine, feces and water, as well as food items and other substances that are of sanitary significance.
Seliwanoff's Test - Principle, Procedure, Result, Uses
Seliwanoff’s Test is a biochemical colour reaction that is used mainly to distinguish between ketose sugar and aldose sugar. It is performed by using Seliwanoff’s reagent (resorcinol + concentrated hydrochloric acid) and the sugar solution is heated with this reagent. In this test the acid act as dehydrating agent and the reaction is based on ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Semiconservative Replication of DNA - Mechanism
Mode of DNA replication Imagine yourself in 1953, right after the discovery of the double helix structure of DNA. What are some burning questions you and other scientists might have? One big question concerned DNA replication. The double helix shape of DNA gave a tantalising hint about how copying might happen. It seemed likely that ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Sense Organs - Classification of receptors, Brief account of visual and auditory receptors in man
What are Sense Organs? Types of Sensory Receptors Sensory receptors in vertebrates are specialized structures that detect various types of stimuli from both the external and internal environments. These receptors convert sensory input into electrical signals, which are then transmitted to the brain for processing. Sensory receptors are classified based on their distribution, location, and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Sensory Receptors - Definition, Types, Mechanism, Functions
What is Sensory Receptor? Definition of Sensory Receptor A sensory receptor is a structure or specialized cell that detects and responds to physical stimuli in the environment, both internally and externally. It converts these stimuli into electrical signals that are transmitted to the central nervous system for processing and perception. How Sensory Systems Work? Classification ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Sensory Receptors of Insect - Examples and Functions
Insects possess a diverse array of sensory receptors that enable them to effectively interact with their environments and respond to various stimuli. The primary visual receptors are compound eyes, which consist of numerous individual units called ommatidia, allowing insects to detect light, motion, and color across a broad field of vision. Additionally, dorsal ocelli and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Sequence Alignment - Definition, Types, Tools, Applications
What is Sequence Alignment? Sequence alignment is a computational technique used to compare and analyze the similarities and differences between two or more sequences of biological data, such as DNA, RNA, or protein sequences. By aligning sequences, researchers can identify conserved regions, detect mutations, infer evolutionary relationships, and predict functional elements. It involves arranging the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Serial Dilution Method - Definition, Procedure, Application
What is a serial dilution? Serial dilution definition Serial dilution is a methodical process in which a solution is diluted sequentially to produce a series of progressively reduced concentrations. What is the purpose of serial dilution? – Serial Dilution Objectives Serial dilution serves as a foundational procedure in numerous scientific disciplines, especially microbiology. The primary ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Serological Pipette - Types, Parts, Procedure, Applications
Serological pipette is a long graduated pipette used in laboratory to measure and transfer liquid in ml range. It is commonly used for 1 ml to 50 ml volume transfer. It is mostly disposable plastic (polystyrene) and sometimes glass. It has clear graduation markings on the body to monitor the liquid level during measuring. It ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Serratia marcescens - Overview
Classification of Serratia marcescens Habitat of Serratia marcescens Serratia Marcescens Taxonomy Serratia Marcescens as a Tracer Organism Serratia Marcescens Symptoms Serratia Marcescens as a Cancer Therapy? Morphology of Serratia marcescens Virulence Factors of Serratia marcescens Hemolysin production Lipopolysaccharide Extracellular products Serratia marcescens Pathogenesis S. marcescens, an emerging multidrug-resistant organism, has the potential to manifest in ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Severe Acute Respiratory Syndrome Coronavirus (SARS-CoV)
SARS-CoV is a type of coronavirus that caused a global outbreak of severe respiratory illness in 2002-2003. The virus was first identified in China and quickly spread to other countries, including Canada, where there was a significant outbreak. The symptoms of SARS-CoV include fever, cough, and difficulty breathing. In severe cases, the illness can progress ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Sewage Treatment - Wastewater Treatment Procedure
Wastewater treatment or Sewage Treatment Characteristics of Wastewater Chemical Characteristics Biochemical Oxygen Demand (BOD) Microbiological Character Wastewater Treatment Process Diverse wastewater treatment technologies exist. We shall explain the treatment methods as they pertain to two distinct circumstances: (1) a single home or unit structure, and (2) a community or municipality. 1. Single Dwelling Unit Anaerobic ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Sex Determination - Definition, Methods, Significance
What is Sex Determination? Definition of Sex Determination Sex determination is the biological process that establishes whether an individual will develop as male or female, typically governed by genetic, environmental, or a combination of factors. It involves mechanisms that direct the differentiation of gonads and the subsequent development of sexual characteristics. Methods for Sex Determination ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Sex-linked Inheritance - Definition, Characteristics, Examples
What is Sex-linked Inheritance? Methods for Sex-linked inheritance Sex-linked inheritance refers to the transmission of genetic traits that are carried on the sex chromosomes, specifically the X or Y chromosome. These traits are inherited differently than those located on the autosomal chromosomes due to the unique nature of sex chromosome behavior. The two main categories ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Sexual Behaviour - Definition, Types, Factors
What is Sexual Behaviour? Factors Affecting Sexual Behaviors Sexual behavior in organisms, including humans, is influenced by a variety of factors. These factors can be broadly categorized into biological, environmental, psychological, and social influences. Here are some key factors that can affect sexual behaviors: It is important to note that these factors interact and vary ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Sexual Reproduction - Stages, Types, Advantages, Examples
What is Sexual Reproduction? Definition of Sexual Reproduction Sexual reproduction is a biological process in which offspring are produced through the fusion of male and female gametes, resulting in a diploid zygote that develops into a genetically distinct individual. This mode of reproduction promotes genetic diversity and variation within a species. Features of Sexual Reproduction ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Sheep blood agar - Composition, Principle, Procedure, Uses.
Sheep blood agar The principle of sheep blood agar Haemolysins are exotoxins created by bacteria that kill Red blood cell clots. The haemolytic process can be observed on blood Agar Plates. In blood agar plates, colonies of haemolytic bacterium may be covered by a the clear, uncoloured zone, in which the Red blood cells are ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Shelfords Law of Tolerance - Principles, Limiting Factors, Importance
What is Shelfords Law of Tolerance? Shelfords Law of Tolerance Shelford’s Law of Tolerance, formulated by Victor Ernest Shelford in 1911, outlines the relationship between organisms and their environmental conditions. The law is a key principle in ecology, describing how the success and distribution of organisms are influenced by their tolerance to various environmental factors. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Shiga toxin-producing Escherichia coli (STEC)
What is Shiga toxin-producing Escherichia coli (STEC)? Virulence factors Virulence factors are key components that contribute to the pathogenicity of Shiga toxin-producing Escherichia coli (STEC). Here are some important virulence factors associated with STEC: These virulence factors play crucial roles in the pathogenesis of STEC infections, contributing to the colonization and damage of the intestinal ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Shigella - Morphology, Pathogenesis, Diagnosis, Treatment
What is Shigella? Shigella is a genus of Gram-negative, facultatively anaerobic, rod-shaped bacteria that is non-motile and non-spore-forming. It belongs to the Escherichia genus and was discovered by Kiyoshi Shiga in 1897. Shigella is a major cause of dysentery and primarily infects humans and certain primates, such as gorillas. This pathogen is not known to ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
shRNA (Short-hairpin RNA) Structure, Definition, Mechanism
What is shRNA (Short-hairpin RNA)? The shRNA is our short hairpin RNA, which is shorter, artificially manufactured, double-stranded ribonucleic acid that can be used in gene silencing investigations. What is RNA Interference? This mechanism inhibits genes through the targeting of messenger RNA molecules. mRNA is degraded, blocking protein synthesis and transcription. This is accomplished by ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Signal Transduction in Plants
What is Signal Transduction? Historical Context of Signal Transduction in Plants The study of signal transduction in plants has undergone significant evolution, informed by technological advancements, developments in molecular biology, and an increased understanding of plant physiology. This narrative highlights key milestones in the historical context of this field, illustrating how insights into plant signaling ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Signal Transduction Pathway - Definition, Types, Functions, Examples
What is a Signal Transduction Pathway? Definition of Signal Transduction Pathway A signal transduction pathway is a series of molecular events inside a cell that converts an external signal into a specific cellular response. Components of signal transduction Signal transduction involves several key components that are common in both plants and animals. These components include: ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Silent Mutation - Definition, Causes, Mechanism, Examples, Applications
What are Silent mutations? Definition of Silent mutations Silent mutations are genetic changes in the DNA sequence that do not alter the amino acid sequence of a protein, resulting in no effect on the protein’s function or the organism’s phenotype. Cause of Silent Mutation Silent mutations are genetic changes that do not alter the final ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Silver Staining - Principle, Procedure, Result, Uses
Silver staining is the process used for detecting and identifying proteins and nucleic acids in different gels, and it is highly sensitive in nature. It is the method where silver ions (Ag⁺) binds to different chemical groups present in proteins like carboxyl and sulfhydryl groups, and these ions is then reduced into metallic silver (Ag⁰). ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Simmons Citrate Agar - Composition, Principle, Preparation, Results, Uses
What is Simmons Citrate Agar? Composition of Simmons Citrate Agar Ingredients Gms/liter Magnesium sulfate 0.200 Ammonium dihydrogen phosphate 1.000 Dipotassium phosphate 1.000 Sodium citrate 2.000 Sodium chloride 5.000 Bromothymol blue 0.080 Agar 15.000 Final pH ( at 25°C) 6.8±0.2 Principle of Simmons Citrate Agar The principle of Simmons Citrate Agar revolves around the ability of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Simmons Citrate Agar - Principle, Composition, Procedure, Result, uses
Simmons Citrate Agar is a specialized solid microbiological culture medium which is used mainly to differentiate Gram-negative bacteria especially the members of Enterobacteriaceae family. It is used to test the ability of an organism to survive by using citrate as the sole carbon and energy source and ammonium salts as the sole nitrogen source. It ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Simple columnar epithelium - definition, structure, functions, examples
Definition of Simple columnar epithelium The simple columnar epithelium, which is one type of epithelium, is made up of a single layer consisting of long, elongated cells. These cells are located in areas where absorption or secretion are the primary functions. The cells of the columnar epithelium can also be modified, just like cuboidal epithelium. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Simple Diffusion - definition, principle, examples, applications
Definition of Simple diffusion Simple diffusion is one of the types of passive transport that is, as the name implies is the simple movement of solute that happens when the electrochemical potentials of one side of the permeable barrier differ. Principle of Simple diffusion/How does simple diffusion work? In free diffusion across a membrane, solute ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Simple Microscope - Definition, Principle, Parts, Uses
A simple microscope is an optical device consisting of a single convex lens that magnifies objects by enlarging their image through light refraction. Simple Microscope is a simple optical instrument used to magnify very small objects so that they can be seen by the unaided eye. It is mainly a single convex lens (mostly double ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Simple Staining - Procedure, Principle, Result
The main purpose of simple staining is to determine the cell shape, size, and arrangement of bacterial cells.
Single Cell Protein (SCP) – Definition, Sources, Production, Uses
What is Single Cell Protein(SCP)? Definition of Single Cell Protein(SCP) Single Cell Protein (SCP) refers to edible proteins derived from unicellular microorganisms such as algae, yeasts, fungi, or bacteria. It can be used as a protein supplement in human or animal diets and is produced through the cultivation and processing of these microorganisms, which convert ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Single Pan or Unequal Arm Mechanical Balance
What is Single Pan or Unequal Arm Mechanical Balance? Parts of Single Pan/Unequal Arm Mechanical Balance Principle of Single Pan/Unequal Arm Mechanical Balance Operating Procedure of Single Pan/Unequal Arm Mechanical Balance Factors that affect readings on Single Pan/Unequal Arm Mechanical Balance 1. Air Currents– Movement of air around the balance cause pointer fluctuation, it affect ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Single Use Bioreactor - Principle, Parts, Types, Uses
Single Use Bioreactor is a cell cultivation system where the reusable glass or stainless steel vessel is replaced by a disposable plastic bag. It is also known as Disposable Bioreactor. The bag is pre-sterilized and used only for one batch. This flexible polymeric bag acts as the sterile place for the growth of cells. It ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
siRNA (Small Interfering RNA) - Structure, Mechanism, Functions
What is Small Interfering RNA (siRNA)? Properties of siRNA Structure of siRNA Naturally occurring siRNAs have a well-defined structure consisting of phosphorylated 5′ ends, hydroxylated 3′ ends, and two overhanging nucleotides. Mechanism of siRNA action The following describes the process by which natural siRNA induces gene silencing via suppression of translation. siRNA is also similar ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Skeletal System - Definition, Types, Anatomy, Functions
What is Skeletal system? Definition of Skeletal system The skeletal system is the framework of bones, joints, and cartilages that provides support, protection, and facilitates movement in the human body. Types of Skeletal Systems There are three main types of skeletal systems found in different organisms: hydrostatic skeleton, exoskeleton, and endoskeleton. Each type of skeletal ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Skeletal System In Vertebrates - Axial and Appendicular Skeleton
Cartilage and Bone: Key Components of the Vertebrate Skeletal System The vertebrate skeletal system is primarily composed of two types of connective tissue: cartilage and bone. Both play crucial roles in providing structural support, protection, and aiding in locomotion. Although both tissues are essential for the overall functioning of the skeleton, they differ significantly in ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Skeletal System of Fish - Structure, Classification, Functions
Classification of Fish Based on the Habitat and Skeletal System The classification of fish is primarily based on two factors: the type of skeletal system and their habitat. This categorization facilitates a deeper understanding of their biological and ecological adaptations. Structure of the Fish Skeleton System The composition of the fish skeleton system is intricate ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Skin - Definition, Structure, Disorders, Functions
What is Skin? Definition of Skin Skin is the body’s largest organ, serving as a protective outer layer that covers and shields internal organs, muscles, and bones. It regulates body temperature, enables sensory perception, synthesizes vitamins, and acts as a barrier against pathogens and environmental damage. Gross Structure of Skin The skin’s composition varies across ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Sludge Wastes Treatment - Methods, Types, Factors, Uses
What is Sludge? Objectives of Treating Sludge 1. Reducing its Volume 2. Stabilizing its Organic Materials 3. Kill off the odor 4. To Ensure it Can be Safely Used 5. Pathogen Inactivation 6. Dewatering 7. The alternative (incineration and landfill disposal) are Not Environmentally Friendly Sources of Sludge Wastes The following unit operations are the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Small nuclear RNA (snRNA) - Structure, Types, Definition
What is Small nuclear RNA (snRNA)? Types of Small nuclear RNA (snRNA) The snRNAs can be divided into two classes on the basis of common sequence features and protein cofactors. 1. Sm-class RNAS 2. Lsm-class RNAs Structure of snRNA Steps of snRNA gene transcription phosphorylation of the CTD of Pol II during snRNA gene transcription. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Smell - Organs, Olfactory Receptor, Central Olfactory Pathways
What is Smell? The Organs of Smell The organs of smell primarily involve the olfactory system, which is responsible for detecting and processing odors. Unlike common misconceptions, the nose itself does not perform the act of smelling; rather, it serves as a conduit for air to reach specialized cells within the nasal cavity. The key ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Smooth Muscle - Definition, Structure, Mechanism, Functions
What is Smooth Muscle? Definition of Smooth Muscle Smooth muscle is an involuntary, non-striated muscle tissue found primarily in the walls of hollow organs and blood vessels, responsible for functions such as regulating blood flow and propelling substances through organs. Characteristics of smooth muscle Smooth muscle tissue, distinct from its skeletal and cardiac counterparts, exhibits ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Social insects - Types, Examples with Social life, Importance, Advantages
What is a Social Insect? Characteristics of Social Insects Social insects, including species such as ants, termites, bees, and wasps, exhibit distinct characteristics that allow them to thrive in highly organized colonies. These characteristics ensure cooperation, survival, and efficiency within the colony. Social insects are not only known for their complex societies but also for ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Social Organization and social behaviour of Insects
Social behavior refers to interactions between individuals of the same species, often providing mutual or individual benefits. In the case of insects, social behavior has evolved due to its advantages in survival and reproduction. By working together, individuals in insect societies enhance their ability to defend their colony, forage efficiently, and reproduce more successfully, thus ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Soil Biology - Definition, Types, Proterties, Importance
What is Soil Biology? What is Soil? Components of Soil The components of soil exhibit variations in their ratios across different locations due to various soil-forming factors, climate, topology, the presence of organisms, human influences, and the duration of their interaction. These components can be broadly categorized into four main groups: The relative proportions and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Soil Formation (Pedogenesis)- Definition, Factors, Process, Steps, Examples
What is Pedogenesis? Pedogenesis is the natural process of soil formation resulting from the interplay of physical, chemical, biological, and climatic elements throughout time. Chronology – In 1883, Vasily Dokuchaev posited that soil is a product of climate, vegetation, parent material, and temporal factors. In 1941, Hans Jenny established the CLORPT model—Climate, Organisms, Relief, Parent ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Soil Microorganisms - Types, Examples, Factors, Importance
What are Soil Microorganisms or Soil Microflora? The term “soil microflora” is used to describe the community of microorganisms that make up most of the soil’s organic matter and a smaller, colloidal amount of humus. What is Soil Microfauna? What is Soil Microflora? What is Soil Microbiology? Factors Affecting Microbial Community in Soil Like higher ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Soil profile and Soil Horizon - Definition, Types, Importance
What is Soil? Soil Properties Distribution of soil layers Importance of Soil Soil Forming Factors Climate, organisms, relief, parent material, and time are the five major factors that influence the formation of soil. One may say that the local soil environment is determined by the relief, climate, and organisms, which work together to induce weathering ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Solid State Fermentation (SSF) - Steps, Bioreactor, Applications
Solid State Fermentation (SSF) is a bioprocess in which microorganisms are grown on moist solid substrate. It is done in absence or near absence of free flowing water. The solid substrate acts as physical support for microbes. It also works as nutrient source. It gives carbon, nitrogen and essential minerals for growth of microorganisms. In ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Solid Waste Management
What is Solid Waste Management? Management of solid waste is the collection, treatment, and disposal of solid material that has served its purpose or is no longer useful. Improper disposal of municipal solid waste can result in unsanitary circumstances, which in turn can lead to environmental contamination and outbreaks of vector-borne diseases, which are transmitted ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Solubility Tests of Proteins - Principle, Procedure, Result, Uses
Solubility Tests is a type of biochemical test which is performed to check the ability of compounds to dissolve within a liquid solvent.
Solution and Cell/Culture/Growth Media Preparations
Chelation Medium Preparation To prepare 1L of Chelation Medium the following components are required. Component Amount Concentration NaCl (mw: 58.44 g/mol) 40.9 g 0.7 M MgCl2·6H2O (mw: 203.3 g/mol) 6.1 g 0.03 M MgSO4·7H2O (mw: 246.47 g/mol) 7.39 g 0.03 M KCl (mw: 74.55 g/mol) 1.49 g 0.02 M EGTA (mw: 380.35 g/mol) 7.6 g ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Somatic Mutation - Definition, Causes, Mechanism, Examples
What is Somatic Mutation? Definition of Somatic Mutation A somatic mutation is a genetic change that occurs in non-reproductive cells after fertilization, which typically does not get passed on to offspring. Causes of Somatic Mutation Several factors and stressors can contribute to somatic mutations. These can be categorized into endogenous factors, chemical mutagens, physical mutagens, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Sorbitol MacConkey Agar - Composition, Preparation and Uses
MacConkey Sorbitol Agar is an adaptation of the formulation that was described by Rappaport and Henigh. It is selective and differential media for the detection of sorbitol-nonfermenting Escherichia coli serotype O157:H7 associated with hemorrhagic colitis. E. coli serotype O157:H7 is a human pathogen that is associated with hemorrhagic colitis which is caused by the actions of a Shiga-like toxins (SLT).
SOS Repair - SOS Response in Bacteria
What is SOS Response or SOS Repair? Definition of SOS Response or SOS Repair The SOS response or SOS repair is a cellular mechanism activated in response to DNA damage, where the cell cycle is temporarily halted to facilitate DNA repair and mutagenesis. Central to this system is the RecA protein, which, when stimulated by ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Southern Blot - Definition, Principle, Steps, Importance
Southern Blotting is a molecular biology technique used for the identification of a specific DNA sequence in a collected DNA sample.
Southern Blot vs Western Blot
What is Southern Blot? What is Western Blot? Southern Blot vs Western Blot Here is a detailed comparison between Southern blotting and Western blotting: Feature Southern Blotting Western Blotting Target Molecule DNA Protein Purpose Detection of specific DNA sequences within a complex DNA sample Detection and analysis of specific proteins in a sample Developed By ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Speciation - Definition, Causes, Types, Process
What is Speciation? Speciation is the evolutionary process by which new species are formed from a pre-existing species. It is the process where a single ancestral population is gradually divided into two or more distinct species. This process occurs when population of a species becomes isolated from each other and the gene flow between them ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Spectrometer vs Spectrophotometer
What is a Spectrometer? Types of Spectrometers Spectrometers, pivotal instruments in the realm of scientific research, are designed to detect and analyze various properties of substances. These devices are categorized based on their specific functionalities and the type of measurements they are engineered to perform. Herein, we delve into the primary types of spectrometers and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Spectrophotometer - Principle, Parts, Types, Mechanism, Uses
Spectrophotometer is an analytical instrument which is used to measure the light absorbed, transmitted or reflected by a substance at particular wavelength. It has a light source, sample holder and detector. The liquid sample is kept in a cuvette. Then the beam of light is passed through the sample. The detector detects the light which ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Spectrophotometer Cuvette - Features, Types, Materials, Precautions, Advantages
A spectrophotometer cuvette is a small optical cell that is used to hold the liquid sample during absorbance or transmittance measurement. It is usually made in a rectangular shape and two opposite sides are kept clear and highly polished so that the light beam can pass through the solution without scattering. It is the process ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Sperm Cell - Definition, Structure, Functions
What is Sperm Cell? Definition of Sperm Cell A sperm cell, or spermatozoon, is the male reproductive cell in sexual reproduction, produced in the testes through the process of spermatogenesis. It is a haploid cell containing half the number of chromosomes and is designed to fertilize a female egg cell, leading to the formation of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Sphaeroplasts - Definition, Formation, Applications
What is Sphaeroplast? A Spheroplast (or sphaeroplast according to British use) can be described as a microbe organism with a cell wall that is almost entirely gone through the penicillin or Lysozyme. According to certain definitions the term is employed to refer to Gram-negative bacteria. In other definitions, the word also includes yeasts. Spheroplast’s name ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Sphagnum - Habit, characteristics, structure, reproduction
Introduction to Sphagnum Sphagnum is commonly referred to as peat moss, bog turf moss or moss moss due of its ecological significance in the creation of peat and bog. These plants are perennial and thrive in swamps and damp habitats such as rocky slopes, where water accumulates , or in areas where it drips. They ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Sphenodon - Morphology, Anatomy, Habitat, Distribution, Affinities
What is Sphenodon? Sphenodon is the reptile that is commonly known as the tuatara, and it is the only living representative of the order Rhynchocephalia. It is the reptile that is found naturally in New Zealand, and it is considered a very old lineage that diverged from other reptiles in ancient geological time. The body ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Sphingolipid – Definition, Structure, Types, Functions
What is Sphingolipid? Definition of Sphingolipid Sphingolipids are a class of lipids that contain sphingoid bases, such as sphingosine, and play important roles in cell signaling and recognition. Structure of Sphingolipid Types of Sphingolipid Sphingolipids are a diverse class of lipids that play important roles in cellular structure and signaling. They can be classified into ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Spinal Cord - Definition, Structure, Functions
What is Spinal cord? Definition of Spinal cord The spinal cord is a long, tubular structure made of nervous tissue that extends from the brainstem to the lower back. It is a vital part of the central nervous system, responsible for transmitting nerve signals between the brain and the rest of the body. It plays ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Spindle Fibers - Definition, Types, Structure, Formation, Functions
What are Spindle Fibres? Definition of Spindle Fibres Spindle fibres are microtubule structures that facilitate the separation and movement of chromosomes during eukaryotic cell division. Importance of Spindle Fiber Spindle Fibers are essential structures in the process of cell division, ensuring the accurate and proper segregation of chromosomes. Their significance can be highlighted through the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Spirochete - Definition, Morphology, Diseases
What is Spirochete? Definition of Spirochete Spirochete is a type of bacteria characterized by its elongated, helically coiled (corkscrew-shaped) morphology, belonging to the phylum Spirochaetota. These bacteria are known for their unique movement mechanism using endoflagella and can be found in diverse environments, with some species causing diseases like Lyme disease and syphilis. Taxonomic organization ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Spirogyra - Definition, Structure, Life Cycle, Diagram, Reproduction
Spirogyra is a genus of filamentous green algae that belongs to the Chlorophyta phylum. It is commonly found in freshwater habitats and is known for its spiral chloroplasts that give it its distinctive appearance. In this article, you will learn about the definition and structure of Spirogyra, as well as its reproduction process. A detailed ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Spleen - Definition, Location, Structure and Functions
What is Spleen? Definition of Spleen The spleen is a large organ located on the left side of the body, below the diaphragm. It acts as a blood filter and plays important roles in immune function, removing old red blood cells, recycling iron, and storing a reserve of blood cells. It is part of the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Spliceosome - Definition, Types, Structure, Mechanism
What is Spliceosome? Properties of Spliceosome Structure and composition of Spliceosome Components of Spliceosome In addition to the pre-mRNA, spliceosomes include many other RNAs and proteins. Small nuclear ribonucleoproteins (snRNPs, pronounced “snurps”) are a type of RNA-protein complex that includes a small nuclear RNA (snRNA) bound to a protein. Gel electrophoresis enables the snRNAs to ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Spoilage and Defects of Fermented Dairy Products
For its production, fermented milk and cheese require a specific fermentation or series of fermentations. Therefore, any abnormalities in these fermentations will harm the product’s quality and may even cause it to spoil. Even the final product may be susceptible to deterioration by microbes. Fermented Milks Cheese Cheese defects may be caused by mechanical or ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Spoilage of Chocolate and Its Preservation
What is a Chocolate? Contamination source of chocolate The delightful world of chocolate, while enchanting, is not immune to potential sources of contamination. Several factors can contribute to the presence of contaminants in chocolate, compromising its quality and safety. Let’s delve into some of the key sources of contamination associated with this beloved treat. In ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Spoilage of Confectionery and Its Preservation
What are Confectionaries? Contamination source of confectionaries When it comes to the production of confectionaries, it is crucial to be aware of potential sources of contamination that may compromise the quality and safety of these delightful treats. Several factors can contribute to the contamination of confectionaries, ranging from the raw ingredients used to the equipment ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Spoilage of Eggs - Contamination, Preservation Steps
Contamination of Eggs Eggs, in their natural state, are typically sterile. However, contamination can occur after they are laid due to a variety of reasons. It is essential to understand these potential sources of contamination in order to minimize the risk of egg spoilage. The following factors contribute to the contamination and subsequent spoilage of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Spontaneous Generation - Definition, Experiments, Importance
What is Spontaneous Generation Theory? Definition of Spontaneous Generation Spontaneous generation is the historical theory that living organisms can arise directly from nonliving matter. Spontaneous Generation Theory The spontaneous generation theory, as delineated by Aristotle in his seminal work “On the Generation of Animals” circa 350 B.C., offers a scientific proposition to elucidate the seemingly ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Sporangium - Definition, Characteristics, Structure, Importance
What is Sporangium? Definition of Sporangium A sporangium is a specialized cellular structure in plants and fungi responsible for the formation, encapsulation, and dissemination of spores. Characteristics of Sporangium Structure of Sporangium The sporangium is a specialized structure designed for the production and protection of spores. Its structure can vary depending on the organism, but ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Sporothrix schenckii - Morphology, Pathogenesis, Transmission
Sporothrix schenckii is a globally distributed fungus that was first isolated from a human specimen in 1896 by medical student Benjamin Schenck. The species is found in soil as well as on living and decaying plant matter, such as peat moss, and in soil. It is capable of infecting both humans and animals and is ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Sporozoa - Definition, Examples, Classification and Characteristics
What is Sporozoa? Short Definition of Sporozoa Sporozoa are unicellular, parasitic organisms that undergo complex life cycles involving two hosts and alternating between sexual and asexual stages. Classification of Sporozoa Characteristics of Sporozoa Motility of Sporozoa Feeding of Sporozoa Types of Spores Sporozoans, a group of parasitic protozoa, can be classified into four categories based ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Spot Indole Test - Principle, Procedure, Result, Uses
What is Spot Indole Test? Spot Indole Test is a rapid biochemical test used in diagnostic microbiology to detect the production of enzyme tryptophanase by bacteria. It is a qualitative test that determines whether the organism can degrade the amino acid tryptophan to produce indole. This test is commonly used for the presumptive identification of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Spread Plate Method - Procedure, Principle, Purpose, Result.
Spread Plate Method in microbiology The spread plate method is used to isolate individual colonies from a diluted sample of mix population. Different methods have been developed for the isolation of microorganisms from a mixture sample but among them Spread plate culture method is the most widely used technique in laboratory. An ideal spread plate ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
SSC (Northern Blot, 20x) and SSPE (Blot, 20x, pH 7.4) Preparation and Recipe
SSPE (Blot, 20x, pH 7.4) Preparation and Recipe Required components Component Amount Concentration Sodium chloride (mw: 58.44 g/mol) 175.3 g 3 M Sodium Phosphate Monobasic Monohydrate (mw: 137.99 g/mol) 27.6 g 0.2 M EDTA (mw: 292.24 g/mol) 7.4 g 0.02 M SSPE (Blot, 20x, pH 7.4) Preparation Prepare 800 mL of distilled water in a suitable container. Add 175.3 g of Sodium chloride to the solution. Add 27.6 g of Sodium Phosphate Monobasic Monohydrate to the solution. Add 7.4 g of EDTA to the solution. Add distilled water until the volume is 1 L. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Stage Micrometer - Principle, Types, Parts, Procedure, Applications
Definition of Stage Micrometer A stage micrometer is a calibrated slide with a ruled scale used to calibrate microscopes and measure the size of objects under a microscope. Principle of Stage micrometer Parts of Stage micrometer Types of Stage Micrometer A. Based on Scale Design / Measurement Function B. Based on Physical Construction/ Traceability C. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Stages in Chick Embryo Development
The development of a chick embryo from a freshly laid hen’s egg involves various stages and intricate processes. Let’s explore the initial stages of chick embryo development based on the provided information: The hen’s egg, when laid, is relatively large, measuring about 3cm in diameter and 5cm in length. It is considered a macrolecithal egg ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Staphylococcal food poisoning (SFP) - Staphylococcus aureus enterotoxins
What is Staphylococcal Food Poisoning? Contamination Sources for Staphylococcal food poisoning Production of Toxin during Staphylococcal food poisoning Staphylococcus aureus Enterotoxins Structure of Staphylococcus aureus Enterotoxins Mode of Action of Staphylococcus aureus Enterotoxins The mode of action of Staphylococcus aureus enterotoxins (SEs) involves their ability to induce emesis (vomiting) and activate immune responses. The specific amino acids and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Staphylococcus aureus - Habitat, Morphology, Characteristics, Infection
Staphylococcus aureus is a Gram‑positive, facultative anaerobic bacterium, usually found in clusters that resemble grapes and typically 0.5–1µm in diameter. Harbor, as a commensal organism, in the human nasal passages, skin, and mucous membranes of 20–30% of people without causing disease It is an opportunistic pathogen that can cause a wide range of infections—from simple ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Starch Casein Agar (SCA) - Composition, Principle, Preparation
Starch casein agar can be described as an nutrient-rich medium that is used for the cultivation and growth of the saccharolytic marine bacteria.
Starch Hydrolysis Test - Principle, Procedure, Results, Uses
Starch Hydrolysis Test is a simple biochemical test used to determine whether a microorganism can hydrolyze starch into smaller sugars. It is done because starch is a large polysaccharide and cannot pass through the bacterial cell membrane, so some bacteria secrete extracellular amylase to break it down. In this test, the organism is inoculated on ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Starter Culture - Definition, Types, Preparation, and Applications
Starter Culture Definition A starter culture is a microbial preparation containing a very high number of cells (such as 1012 g-1) of one or more microbe species that is given to raw material to produce fermented food by accelerating and directing fermentation. Functions of Starter Cultures The fundamental function of lactic starters is to convert ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Starter Cultures - Preparation, Maintenance and Preservation
Principles to maintain active tarter culture The preparation of cultures depends on a number of variables: 1. The choice of milk 2. Heat treatment of milk 3. Containers/Utensils 4. Amount of inoculum 5. Aseptic culture transfer 6. Time of inoculation 7. Cooling Preparation of mother culture The preparation of the mother culture is a crucial ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Stem cell - Definition, Types, Application, Advantages
What is Stem cell? Stem Cells Definition Stem cells are unique cells in the body that have the potential to develop into different types of specialized cells or divide to produce more stem cells. Properties of Stem Cells Stem cells possess several intrinsic properties that make them unique and give them remarkable capabilities: These properties ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Stem cell culture - Definition, Types, Application, Preparation
What is Stem cell? Classification of Stem Cells Stem cells can be classified into different categories based on their origin, potency, and differentiation potential. Here are the main classifications of stem cells: It’s important to note that the classification of stem cells is not always rigid, as there can be overlap and ongoing research to ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Stereoisomerism - Definition, Types, Structure, Functions
What is Stereoisomerism? Types of Stereoisomerism Stereoisomerism, a form of isomerism based on the three-dimensional arrangement of atoms within molecules, can be classified into two main subtypes: conformational isomerism and configurational isomerism. Configurational isomerism, in turn, can be further divided into two subtypes: geometric isomerism (also known as cis-trans isomerism) and optical isomerism (enantiomerism). These ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Sterilization - Physical and Chemical methods
What is Sterilization? Important Definitions Methods of Sterilization A. Physical Methods of Sterilization Method Description Key Agents/Processes Applications Sunlight Utilizes ultraviolet rays for germicidal effects. Reduces microorganisms in natural bodies of water. Ultraviolet Rays Water sterilization Heat Involves dry heat and moist heat to kill microorganisms through protein denaturation and coagulation. Dry Heat, Moist Heat ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Stokes Disc Diffusion Method - Principle, Procedure, Result.
Stokes disc diffusion method isn't as well-standardized as Kirby-Bauer's method and is utilized in labs especially where the exact amount of antimicrobial present in discs isn't known because of the difficulty in getting discs and correctly storing them or when other requirements needed for the Kirby-Bauer method cannot be fulfilled.
Stomata - Definition, Structure, Mechanism, Functions
Wha is Stomata? Definition of Stomata Stomata are tiny pores located on the epidermis of plant leaves and stems that regulate gas exchange, allowing carbon dioxide, oxygen, and water vapor to enter and exit the plant. Each stoma is flanked by guard cells that control its opening and closing, facilitating processes such as photosynthesis and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Stomata Under Microscope - Temporary Mount Technique
What is Stomata? Aim To prepare a temporary mount of a leaf peel in order to show the stomata of a leaf Principle/Theory The principle or theory of the stomata under a microscope experiment is based on the understanding that plants, as primary producers, perform essential physiological processes like photosynthesis and respiration. To facilitate these ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Storage Granules - Definition, Structure, Functions
Storage Granules Definition Structure of Storage Granules Storage Granules in Bacteria Storage Granules Function Storage granules have several important functions in cells, including: Overall, storage granules play a critical role in maintaining cellular homeostasis and allowing cells to adapt to changing environmental conditions. FAQ References
Stratified Cuboidal Epithelium
What is Stratified cuboidal epithelium? Definition of Stratified cuboidal epithelium Stratified cuboidal epithelium is a type of epithelial tissue characterized by multiple layers of cells, with the surface layer consisting of cube-shaped cells. It is primarily found in glandular structures and plays roles in protection, selective absorption, and secretion. Stratified cuboidal epithelium labeled Stratified cuboidal ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Stratified squamous epithelium - Function, Definition, Location, Types.
Stratified squamous epithelium Definition Stratified squamous epithelium diagram and Structure Classification of stratified squamous epithelium The stratified squamous epithelium is divided into two classes based on the accumulation of keratin by the cells towards the surface; Keratinized stratified squamous epithelium Non-keratinized stratified squamous epithelium Function of stratified squamous epithelium Stratified squamous epithelium play an important ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Streak Plate Method - Patterns, Procedure, Principle
Streak Plate Method Overview There are two types of microbial culture such as mixed culture and pure culture. The mixed culture contains two or more species while the pure culture contains only a single species. During the identification of a microorganism, the first and important step is to isolate the individual species from a mixed ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Streptococcus pneumoniae - Habitat, Morphology, Genomes
Streptococcus pneumoniae Overview Streptococcus pneumoniae, commonly known as pneumococcus, is a Gram-positive, spherical bacterium. It is alpha-hemolytic and belongs to the genus Streptococcus. Discovered by Louis Pasteur and George Sternberg in the late 19th century, it is a significant human pathogen, especially noted for causing pneumonia. S. pneumoniae typically appears as lancet-shaped diplococci, meaning it ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Streptococcus pyogenes - Morphology, Pathogenesis, Treatment
What is Streptococcus pyogenes? Classification of Streptococcus Streptococcus species are diverse bacteria that are classified based on their oxygen requirements, hemolytic activity, and antigenic structure. These classifications provide a framework for identifying different types of streptococci and understanding their roles in human health and disease. Classification by Oxygen Requirement Classification Based on Hemolysis on Blood ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Streptococcus Selective Agar - Composition, Preparation, and Principle
Roantree et al introduced a medium for the isolation of streptococci from group A beta-hemolytic. The medium was enriched with yeast nucleic acids and maltose boosted the size of colonies and improved the clarity, sharpness and precision of the hemolytic zones created by these organisms.
Stroma in chloroplast and Stroma in Animal Tissue
Stroma, as a term in botany, refers to the transparent fluid that surrounds the grana inside the chloroplast. In the stroma, there are the grana (stacks of the thylakoid) and sub-organelles, or daughter cells in which photosynthesis begins prior to the chemical reactions being completed within the stroma.
Strongyloides stercoralis (Parasitic Roundworm)
Strongyloides stercoralis Distribution of Strongyloides stercoralis Habitat of Strongyloides stercoralis Morphology of Strongyloides stercoralis There are two different species of Strongyloides stercolaris: parasitic and free-living. The females are easily found during the parasite phase, but not the males. Parasitic female Parasitic males Eggs Larva The larva of S. Stercoratis is of two types: 1. Rhabditiform larva (first stage larva) 2. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Structural Isomer - Definition, Types, Examples
What is Structural isomer? Types of Structural isomer Structural isomerism, also known as constitutional isomerism, is a form of isomerism in which the atoms within a molecule are arranged in different orders, resulting in compounds with the same molecular formula but different structural formulae. Structural isomers often exhibit distinct physical and chemical properties. Let’s explore ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Structure and Function of Ecosystems - Definition, Types
What is an Ecosystem? Ecosystem Definition An ecosystem is a complex interplay of living organisms and their physical environment, interacting as a functional unit. Characteristics of Ecosystem An ecosystem, as delineated by Smith (1966), possesses several distinct characteristics that underscore its significance in the realm of ecology: In essence, these characteristics elucidate the dynamic nature ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Structure and Genome of SARS-CoV-2 (COVID-19) with diagram
Coronaviruses are a type of virus that can cause illness, ranging from the common cold to more severe diseases such as Middle East Respiratory Syndrome (MERS) and Severe Acute Respiratory Syndrome (SARS). Coronaviruses are so named because they have a crown-like appearance when viewed under a microscope. They are primarily transmitted from person to person ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Structure of Flower - Parts of a Flower With Diagram and Their Functions
What is Flower? Symmetry of Flower The symmetry of a flower is an important characteristic that affects its overall structure and function. Flowers can be classified based on how their parts are arranged around a central axis and how they can be divided into symmetrical halves. Bracts: Position of Floral Organs Relative to the Ovary: ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Structure of Gram-positive Cell Wall
Bacterial Cell Wall Characteristics of Peptidoglycan Peptidoglycan is a fundamental component of bacterial cell walls, forming a complex, mesh-like structure known as the sacculus. This structure is crucial for maintaining cell shape and integrity. Here are the key characteristics of peptidoglycan: Cell membrane of Gram-Positive Cell Wall The cell membrane of Gram-positive bacteria is a ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Structure of Water and Hydrogen Bonding
Water Molecules Structure of Water The structure of water is fundamental to its unique properties and functions in various biological systems. The molecular composition, bonding characteristics, and phase transitions of water are essential concepts in understanding its role in life processes. Properties of Water Properties Values Chemical formula H₂O Molar mass 18.01528(33) g/mol Odour None ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Study legumes through specimens and micro chemical test
Materials required The study of legumes, particularly in understanding their biochemical composition and properties, requires specific materials to conduct experiments effectively. The following items are essential for analyzing legumes such as Glycine max (soybean) and Cicer arietinum (gram). Each material plays a critical role in the experimental process, ensuring accurate results and insights into the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Study of Aspergillus by using Temporary Mount Technique
The Lactophenol Cotton Blue solution stains the chitinous cell wall of the fungal cell, which makes them different from the surrounding environments and can easily distinguishable. LCB is made of three main components such as Phenol, Lactic acid, and Cotton blue.
Study of biting and chewing, and piercing and sucking type of mouth parts
Biting and Chewing Chewing and Lapping Piercing and Sucking The piercing and sucking mouth parts found in various insects, such as mosquitoes and bugs, are highly adapted for piercing the tissues of animals and plants to extract blood or plant juices. These mouth parts are specialized for their specific feeding habits and can be categorized ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Study of Cereals Through Specimens And Micro chemical Test
Materials Required The study of cereals, particularly wheat and rice, necessitates a range of materials to facilitate effective specimen analysis and testing. Below is a comprehensive list of materials essential for this investigation, each serving a specific function in the experimental process. Procedure The following procedure outlines the steps required to study the herbarium specimens ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Study of Chlamydomonas and Volvox by using Whole mount
Chlamydomonas are single-celled green flagellates while Volvox is a part of colonial phytoflagellate that develops a hollow spheroid with several thousand cells enclosed in its mucilaginous wall.
Study of larval forms In Protochordates
Protochordate larvae is the juvenile stage found in lower chordates, and it is seen in members of Urochordata and Cephalochordata. It is the stage where the animal shows the typical chordate features very clearly. It is the notochord, dorsal hollow nerve cord, pharyngeal slits, and the post-anal tail that appear in this larval period. It ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Study of Penicillium using Temporary Mount
Penicillium can be found in a freezer that has not been cleaned for a duration of 2 months or longer.
Study of Rhizopus by using Temporary Mount.
Rhizopus is a multicellular, saprophytic fungi and found on plants. They are parasitic on animals.
Subculturing technique for Broth Culture
Aim Transfer of microbial cells from a parent culture medium to a fresh broth culture. Principle The broth is a liquid medium, which is used to grown microorganisms within the laboratory on a small scale. It also used in an industrial fermentor on a large scale. The media called broths, milks, or nutrient solutions are ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Subculturing Technique In Agar Slant/Agar Plate
Overview of Subculturing Technique In microbiology, subculture is defined as a new cell or microbiological culture, which is prepared by transferring a few or all cells to a fresh growth medium from an old culture or a previous culture. In a single word, the transfer of cells from a previous culture to a fresh or ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Submandibular Gland - Definition, Structure, Functions
What is Submandibular Gland? Definition of Submandibular Gland The submandibular gland is one of the major salivary glands located beneath the floor of the mouth, responsible for producing a significant portion of saliva that aids in lubrication and digestion. Anatomical Position of Submandibular Gland Situated within the anterior region of the submandibular triangle, the submandibular ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Sucrose Gradient Centrifugation
Sucrose gradient centrifugation Definition Technique for the characterization and preparation of subcellular particles. A sucrose gradient is used to fill a centrifuge tube of the type swinging-bucket design. The bottom is the most dense, and the top the least dense. The solution is then layered with a suspension of the particles. Centrifugation separates particles in ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Sudan Black B Staining - Principle, Procedure, Uses
Sudan Black is a slightly basic dye and will combine with acidic groups in compound lipids, thus staining phospholipids also. An alternative stain to the Sudan Black B stain.
Sulfur Reduction Test - Principle, Purpose, Procedure, Result
Sulfur Reduction Test (H2S production test) is a biochemical test used to see the ability of bacteria to reduce sulfur containing compounds and liberate hydrogen sulfide gas (H2S). It is used mainly for differentiation of Gram negative enteric bacilli. It helps to separate H2S producers like Salmonella and Proteus from non producers like Shigella and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Sulphosalicylic Acid Test for Proteinuria - Principle, Procedure, Result, Uses
Sulfosalicylic acid (SSA) test is a simple screening test which is used to detect excessive proteins in urine. It is a rapid and low cost method and it is mainly used for checking proteinuria which indicates kidney impairment. The test is done on clear urine sample after centrifugation so that turbidity is observed clearly. It ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Sulphur cycle - Definition, Steps, Types, Importance
Sulphur cycle Definition Sulfur Cycle Overview Types of Sulphur Cycle There are two major kinds of the Sulphur Cycle, namely; 1 . Gaseous Sulphur Cycle 2. Sedimentary Sulphur Cycle Sulphur Cycle Steps The key phases of the sulphur cycle are as follows: 1. Decomposition of Organic Compounds 2. Oxidation of Hydrogen Sulphide to Elemental Sulphur ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Superantigens (SAgs) - Definition, Structure, Examples
What are Superantigens (SAgs)? Superantigens (SAgs) are a type of antigens that stimulate the immune system excessively. It specifically results in non-specific T-cell activation, polyclonal T-cell activation, and large cytokine release. Features of Superantigens (SAgs) Classification of Superantigens (SAgs) The superantigens can be grouped generally into the subsequent families: Structure of Superantigens (SAgs) Examples of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Sustainable utilization of Natural Resources - Concept, Approaches
The Concept of Sustainability Resource Use and Sustainability Resource use and sustainability are fundamentally interconnected concepts that shape the dynamics of environmental stewardship and economic development. Understanding how resources are classified, utilized, and the implications of their use is essential for fostering sustainable practices. Below are the key components of resource use and its relationship ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Swim bladder - Structure, Types, Functions, Modifications
What is Swim bladder? Development of Swim-Bladder The development of the swim bladder in fish is a complex process that varies among different groups, particularly in teleosts and certain primitive forms. This internal organ plays a crucial role in buoyancy regulation and has evolutionary significance, linking it to the lungs of tetrapods. The development process ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
SXT (Sulfamethoxazole-Trimethoprim) Test - Principle, Procedure, Result
The SXT (sulfamethoxazole-trimethoprim) susceptibility test tells the difference between group A and B streptococci and other hemolytic streptococci.
Sycon - Anatomy, Diagram, Habitat, Nutrition, Reproduction
What is Sycon? Definition of Sycon Sycon is a genus of small, tube-shaped calcareous sponges from the family Sycettidae, commonly found attached to rocks, corals, and mollusc shells in shallow, temperate marine waters. Sycon Classification Sycon is a genus of calcareous sponges within the broader classification system of the animal kingdom. Understanding its classification helps ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Symbiosis - Definition, Types, Examples
What is Symbiosis? Symbiosis, derived from the Greek words “σύν” (sýn) meaning “together” and “βίωσις” (bíōsis) signifying “living,” refers to a prolonged biological interaction between two distinct species, known as symbionts. This interaction can manifest in various forms, ranging from mutualistic, where both entities benefit, to commensalistic, where one benefits without harming the other, and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Synapse - Definition, Structure, Principles, Types & Function
What is Synapse? Definition of Synapse A synapse is a junction between two neurons or between a neuron and an effector cell, such as a muscle cell, that allows for the transmission of electrical or chemical signals. It consists of a presynaptic terminal, a synaptic cleft, and a postsynaptic terminal, facilitating communication within the nervous ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Synchronous Culture - Definition, Methods, Application.
Synchronous culture Definition A synchronous or synchronized culture is a microbiological culture or a cell culture which contains the cells that are all in the same growth stage. Obtaining Synchronous culture There are present different method for obtaining a Synchronous culture such as; Application of Synchronous culture References
Synthesis of Fatty Acid
What is Fatty Acid? Location of Fatty Acid Synthesis Fatty Acid Synthesis Pathway Fatty acid synthesis proceeds through a series of steps, each involving specific enzymatic reactions and the utilization of various substrates. The pathway can be summarized as follows: It is important to note that palmitate can undergo further modifications, such as desaturation or ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Systems of Classification - Artificial, Natural and Phylogenetic
Types Of Classification In the study of botany, the classification of plants is a fundamental task aimed at organizing the immense diversity of plant species into manageable categories. Due to the vast number of plant species and their complex relationships, it is essential to classify them into hierarchical groups based on similarities and differences. This ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
T cell (T Lymphocyte) - Definition, Structure, Types, Development, Functions
What is T cell (T Lymphocyte)? Definition of T cell (T Lymphocyte) T cells, also known as T lymphocytes, are a type of white blood cell that plays a crucial role in the immune system. They are responsible for recognizing and attacking foreign pathogens, infected cells, and cancer cells. T cells have specialized receptors on ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
T Dependent Antigen and T Independent Antigen
Thymus-Independent Antigens (T Independent Antigen) Properties of Thymus-Independent Antigens (T Independent Antigen) Thymus-Dependent Antigens (T Dependent Antigen) Properties of Thymus-Dependent Antigens (T Dependent Antigen) Main steps during B-cell activation by a thymus-dependent antigen This CD40/CD40L interaction is crucial for B-cell survival, development of germinal centres, production of memory-cell populations, and somatic hypermutation (for affinity maturation). ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Taenia solium - Structure, Reproduction, Life Cycle, Characteristics
What is Taenia Solium? Classification of Taenia solium Phylum Platyhelminthes Class Cestoda Subclass Eucestoda Order Taenioidea Genus Taenia Species solium Habitat of Taenia Solium This parasitic organism occupies specific ecological niches, which facilitate its survival and proliferation. Structure of Taenia Solium The structure of Taenia solium, commonly known as the pork tapeworm, is intricate and specifically ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Taproot vs Fibrous root - Difference between Taproot and Fibrous root
Taproot is among the two important root systems in which the primary root produces branches of the secondary as well as tertiary roots which are growing downwards as primary root tapers toward the final.
TaqMan Probe - Definition, Principle, Applications
What is TaqMan Probe? Definition of TaqMan TaqMan probes are hydrolysis probes used in quantitative PCR (qPCR) to increase specificity by utilizing the 5´–3´ exonuclease activity of Taq polymerase to cleave a dual-labeled probe during hybridization, resulting in a fluorescence signal that allows for precise quantification of the target DNA. Principle of TaqMan TaqMan technology ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Taste - Organs, Receptor, Mechanisms, Central Taste Pathways, Neural Coding
What is Taste? The Organs of Taste The organs of taste are essential in helping humans detect and differentiate between various flavors. While the tongue is the primary organ associated with taste, other areas such as the palate, pharynx, and epiglottis also play a role in the tasting process. Additionally, odors from food contribute to ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Tautomer (Tautomerism) - Definition, Types, Example, Applications
What is Tautomer? Tautomer definition A tautomer is a type of isomer that exists in multiple interconvertible structures, differing in the relative position of a specific atomic nucleus, typically hydrogen. What Is Tautomerism? Structural Requirement of Tautomerism Tautomerism, the phenomenon of interconversion between different isomeric forms of a compound, has specific structural requirements. Here are ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Taxonomic Evidences from Palynology, Cytology, Phytochemistry and Molecular Data
In Taxonomy, evidence is the information used in context for a purpose such as identification or classification. The foundation of plant taxonomy was laid on a number of characters (attributes) of plants and plant groups studied from time to time. Such taxonomic information can be realised in many ways to prove a hypothesis, solve a ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Taxonomic Hierarchy - Ranks, Categories and Taxonomic groups
What is Taxonomic Hierarchy? Taxonomic hierarchy is a fundamental concept in biological classification that organizes the vast diversity of life into a structured framework. This system is essential for the accurate identification, naming, and classification of organisms, allowing biologists to communicate effectively about the characteristics and relationships of various species. At the core of plant ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Taxonomy - Definition, Hierarchy, Example, Importance
What is Taxonomy? History of Taxonomy Taxonomy, the science of classifying living organisms, has evolved significantly since its inception. The journey of taxonomy traces back to ancient civilizations, undergoing various transformations through the ages, influenced by the works of numerous scholars and the advent of scientific methodologies. Ancient Beginnings: The earliest inklings of taxonomy can ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
TCBS Agar - Composition, Principle, Preparation, Results, Uses
Thiosulfate-citrate-bile salts-sucrose (TCBS) Agar, is a type of selective agar that is used in microbiology laboratories to isolate Vibrio species. TCBS Agar can be used to cultivate Vibrio cholerae from clinical specimens or other materials. Kobayashi et. al. developed TCBS Agar, which modified the Nakanishi selective medium. This medium was originally intended to isolate V. cholerae from V. parahaemolyticus. However, Vibrios can grow healthy colonies with many different colonial morphologies.
Tea - Morphology, Types, Processing, Uses
What is Tea? Types of Tea Tea is classified into several distinct types, primarily based on the processing techniques used after harvesting the Camellia sinensis leaves. Each type of tea varies in terms of oxidation, fermentation, and the preservation of specific chemical compounds such as polyphenols and catechins. Below is a detailed explanation of the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Telomerase - Structure, Mechanism, Regulation, Functions
What is Telomerase? Telomerase (terminal transferase) is a ribonucleoprotein enzyme that extends telomeres, the repetitive nucleotide sequences at the ends of eukaryotic chromosomes. Telomeres function as protective caps, stopping chromosome ends from being erroneously perceived as DNA damage or from bonding with neighboring chromosomes. Most eukaryotes use telomerase to maintain their telomeres, but some organisms, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Telomeres - Structure, Aging, Shortening, Functions
What Are Telomeres (telomere)? At the ends of linear eukaryotic chromosomes are specialized structures called telomeres. DNA degradation is prevented by repetitive nucleotide sequences of the telomere, which caps and so stabilizes chromosomal DNA during cell division. The termini of chromosomes not only have no translation product but instead have a highly important role in ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Telophase - Definition, Mechanism, Significance
What is Telophase? Telophase, derived from the Ancient Greek terms τέλος (télos) meaning ‘end’ and φάσις (phásis) signifying ‘appearance’, represents the concluding phase in the intricate process of cell division, both in mitosis and meiosis of eukaryotic cells. This phase is characterized by a series of events that essentially reverse the changes observed during prophase ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Temporary Wet Mount technique - Procedure, Requirement, Uses
In Mounting technique, the specimen to be observed is held on a microscopic slide by using a coverslip.
Teratogenesis - Definition, Factors, Mechanism
What is Teratogenesis? Teratogenic Agents 1. Infectious agents 2. Physical agents 3. Chemical agents Chemical agents, including certain medications and substances, can have teratogenic effects on the developing fetus. These agents can disrupt normal development and contribute to the occurrence of birth defects. Here are some key points about different chemical agents and their teratogenic ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Terrestrial Ecosystem - Definition, Types, Examples
Definition of Terrestrial Ecosystem Features of Terrestrial Ecosystem The terrestrial ecosystem has the following characteristics: Types Of Terrestrial Ecosystems Different types of terrestrial ecosystems are widely dispersed throughout the geological zones. They consist of: 1. Desert Ecosystem 2. Forest Ecosystem Types of forest Ecosystem According to climate and tree type, they are divided into the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Testing of Disinfectants (evaluation methods of disinfectants)
Testing of Disinfectants/ Evaluation of disinfectants definition. Different methods for Testing of Disinfectants There are present different tests which can be used to test the efficiency of disinfectants such as; 1. Phenol coefficient test Methods of Phenol coefficient test There are two distinct methods of Phenol coefficient test, such as; A. Rideal Walker method for ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Testis - Definition, Structure, Hormones, Functions
What is Testicle (Testis)? Definition of Testicle (Testis) A testicle, or testis, is a male reproductive gland responsible for producing sperm and the hormone testosterone. Located in the scrotum, the testicles are essential for male fertility and the regulation of male secondary sexual characteristics. Structure of Testes The structure of the testes is integral to ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Thallus Organisation in Algae - Types, Structure, Examples
What is Algae? What is the thallus organization of algae? Types of thallus organization in Algae The organization of the algal thallus varies considerably across different species. The thallus, or plant body, can be categorized into several distinct types based on its structural complexity and organization. The algal thallus organization can be classified in these ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
The Biology Crossword Puzzle Challenge 1 - Cell Structure and Function
Cell Structure and Function Crossword: Dive into the microscopic world with this biology crossword that explores the essential building blocks of life. Test your knowledge of cell organelles, their functions, and key cellular processes like mitosis and osmosis. From the powerhouse mitochondria to the command center nucleus, challenge yourself to unlock the mysteries of what ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
The Biology Crossword Puzzle Challenge 10 – Marine Biology
Marine Biology Crossword: Dive into the depths of the ocean with this marine biology-themed crossword! Explore the fascinating world of marine ecosystems, coral reefs, and the diverse species that inhabit our seas. From tiny plankton to mighty whales, challenge yourself with clues about oceanography, marine life, and the delicate balance of aquatic environments. Discover the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
The Biology Crossword Puzzle Challenge 11 – Zoology
Zoology Crossword: Embark on an exciting journey through the animal kingdom with this zoology-themed crossword! Test your knowledge of various animal species, their classifications, habitats, and behaviors. Solve clues about key concepts such as evolution, adaptation, and conservation, while learning about the rich diversity of life on Earth. From the tiniest insects to the largest ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
The Biology Crossword Puzzle Challenge 2 - Genetics and Heredity
Genetics and Heredity Crossword: Unravel the secrets of inheritance with this genetics-themed crossword! Explore the building blocks of life by solving clues about DNA, genes, chromosomes, and Mendelian laws. Discover how traits are passed from generation to generation, and test your understanding of genetic variation, mutations, and inheritance patterns. It’s a puzzle where every answer ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
The Biology Crossword Puzzle Challenge 3 – Human Anatomy
Human Anatomy Crossword: Take a deep dive into the inner workings of the human body with this anatomy-themed crossword! From major organs like the heart, lungs, and brain to the intricate systems that keep us alive, challenge yourself to identify body parts and their functions. Explore the skeletal, muscular, circulatory, and nervous systems, and see ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
The Biology Crossword Puzzle Challenge 4 - Genetics and Heredity
Genetics and Heredity Crossword: Step into the world of genes and discover how traits are passed down through generations. This puzzle challenges your understanding of DNA, chromosomes, alleles, and Mendel’s laws of inheritance. Test your knowledge of genetic variations, hereditary patterns, and the molecular mechanisms that make each of us unique. Decode the puzzle of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
The Biology Crossword Puzzle Challenge 5 – Ecology and Ecosystems
Ecology and Ecosystems Crossword: Explore the delicate balance of nature with this ecology-themed crossword! Solve clues about food chains, energy flow, biomes, and the interdependence of living organisms. Delve into key ecological concepts such as producers, consumers, decomposers, and how ecosystems respond to environmental changes. This puzzle will test your understanding of the complex relationships ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
The Biology Crossword Puzzle Challenge 6 – Evolution and Natural Selection
Evolution and Natural Selection Crossword: Journey through time with this evolution-themed crossword, exploring the mechanisms that have shaped life on Earth. From Darwin’s theory of natural selection to the fossil record, solve clues about species adaptation, mutations, and survival of the fittest. Challenge your knowledge of evolutionary biology and uncover how life has evolved and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
The Biology Crossword Puzzle Challenge 7 – Microbiology
Microbiology Crossword: Enter the microscopic realm with this microbiology-themed crossword! Test your knowledge of bacteria, viruses, fungi, and other microorganisms that play crucial roles in health, disease, and ecosystems. From antibiotics and vaccines to the immune system and microbial metabolism, explore the unseen world that shapes life at the smallest scale. Challenge yourself to identify ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
The Biology Crossword Puzzle Challenge 8 – Botany and Plant Biology
Botany and Plant Biology Crossword: Immerse yourself in the vibrant world of plants with this botany-themed crossword! Explore the intricacies of plant structure, including leaves, stems, roots, and flowers. Solve clues about photosynthesis, plant reproduction, and the diverse classifications of plants, from flowering species to ferns. Challenge your knowledge of the vital roles plants play ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
The Biology Crossword Puzzle Challenge 9 – Biochemistry
Biochemistry Crossword: Unlock the molecular mysteries of life with this biochemistry-themed crossword! Challenge yourself with clues about macromolecules such as proteins, carbohydrates, lipids, and nucleic acids. Explore key metabolic pathways, enzyme functions, and the chemical reactions that fuel biological processes. This puzzle will test your understanding of how complex molecules interact to sustain life, revealing ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
The Complement Pathway - Activation, Functions, and Deficiencies.
Hey, in this article I will discuss the complement pathway which is one of the easiest pathways. Basically, This complement pathway helps to kill microorganisms by antibodies or phagocytosis. The complement pathway has been accomplished in three main ways, which I have discussed step by step below. Believe me, if you understand the first step ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
The Earth BioGenome Project (EBP)
In a world dominated by technological advancements and an increasing knowledge of the intricacies of our planet’s natural environment scientists and researchers have launched an innovative project known as the Earth BioGenome Project (EBP). This ambitious global project aims to sequence and catalogue the genomes of every known species of Earth which will lead to a ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
The Germ Theory of Disease - Experiments, Principles, Key Figures
What is Germ Theory of Disease? Germ theory of disease is a scientific theory. It states that many infectious diseases are caused due to invasion of host organism by microscopic pathogens (germs). These germs are not seen by naked eye. These pathogens includes bacteria, viruses, fungi and protozoa. The germs enters in body and then ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
The Glyoxylate Cycle - Definition, Steps, Functions.
Glyoxylate cycle Definition Glyoxylate cycle Steps Glyoxylate cycle functions The conversation of dicarboxylic and tricarboxylic acids in germinating seeds occurs in three compartments such as mitochondria, glyoxysomes, and cytosol. During the conversation, the oxaloacetate from the TCA cycle (mitochondria) enters into the glyoxysomes in the form of aspartate. After that, the aspartate converted into oxaloacetate ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
The Human Genome Project - An Overview
The Human Genome Project (HGP) was an international scientific research endeavor with the objective of identifying, mapping, and sequencing all the genes of the human genome from a physical and functional standpoint. It began in 1990 and was finished in 2003.It remains the largest collaborative biological project in the globe.After its adoption by the US ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
The Michaelis–Menten Model and its Plot, Equation, Importance
What is Michaelis–Menten model? The Michaelis–Menten model is a fundamental concept in biochemistry, specifically in the realm of enzyme kinetics. Enzymes, which are proteins, play a pivotal role as catalysts in biochemical reactions. Their primary function is to reduce the Gibbs free energy of activation, ΔG, thereby facilitating the reaction to reach its transition state ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
The most lethal viruses of all Time
Humans have been fighting off viruses way before the time our species evolved into its current version. In the case of some viral diseases vaccinations and antiviral medications have helped us stop the spread of infections to a minimum and helped people suffering from illness recover. In the case of one disease called smallpox, we've managed to eliminate it, clearing the globe of cases.
The progression of SARS-CoV-2 infection throughout the respiratory system
SARS-CoV-2 is the virus that causes the disease COVID-19 (coronavirus disease 2019). It is a highly infectious disease that can spread from person to person through respiratory droplets or close contact. The virus was first identified in Wuhan, China in December 2019 and has since spread to become a global pandemic. Symptoms of COVID-19 can ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
The Structure of the Nervous System - Gross Organization, Development, Features
The nervous system represents one of the most intricate and essential systems in multicellular organisms, functioning as the primary coordinator of actions, sensory information, and responses to environmental stimuli. This complex network is responsible for detecting changes in the environment, processing that information, and enabling organisms to react accordingly, working closely with the endocrine system ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
The Wobble Hypothesis - Definition, Exaplanation, Importance
What is The Wobble Hypothesis? The Wobble Hypothesis, proposed by Francis Crick in 1966, provides an explanation for the degeneracy of the genetic code. Degeneracy refers to the fact that multiple codons can code for the same amino acid. According to the Wobble Hypothesis, the precise pairing between the bases of the codon and the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Thermodynamics - Definition, Types, 1st, 2nd, 3rd Law
The chemical energy stored in molecules can be released as heat in chemical reactions that occur when the fuel methane, coal or cooking gas burns in the air. Chemical energy could also be utilized to carry out mechanical work when fuel is burned in an engine or to generate electric energy via an electrolytic cell ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Theta Model of Replication - Steps, Applications, Examples
What is Theta model of DNA Replication? The theta model of DNA replication is a mechanism for DNA replication which occurs in circular DNA molecules, in particular, those of bacteria, and also the mitochondria and chloroplasts. True to its name, this replication process creates an intermediate structure during replication that resembles the Greek letter theta ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Thick and Thin Blood Smear Preparation
A blood smear is a simple diagnostic preparation where a drop of peripheral blood is spread on a clean slide, and it is dried for staining. It is the process used for observing blood cells and also for detecting parasites after staining methods like Giemsa. It is an important technique because it helps in demonstrating ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Thin Layer Chromatography - Principle, Components, Procedure, Application
Thin Layer Chromatography (TLC) is an analytical technique used for separation and identification of components present in non-volatile mixtures. It is carried out on a TLC plate, which is made up of glass, plastic or aluminium sheet coated with thin layer of adsorbent material. The adsorbent material is generally silica gel or alumina, which acts ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Thioglycollate Broth - Composition, Principle, Preparation, Results, Uses
Thioglycolate broth, an enrichment broth that is multipurpose and can be used to determine the oxygen needs of microorganisms, is called a differential medium. It is used most often in diagnostic bacteriology as an enrichment broth. This broth is supportive of the growth and development of microorganisms fastidious, anaerophilic, microaerophilic and aerobes.
Three-domain system - Carl Woese’s Classification
All living organisms are grouped into three major categories under the three-domain system, a modern way to classify life based on genetic and evolutionary relationships. Proposed by microbiologist Carl Woese in the 1990s, this system splits life into Bacteria, Archaea, and Eukarya. Bacteria are the familiar single-celled microbes found everywhere, from soil to our bodies, lacking a cell ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Thymus Gland - Definition, Structure, Location, Hormones, Functions
What is Thymus Gland? Definition of Thymus Gland The thymus gland is an important organ of the lymphatic system located in the chest behind the breastbone. It plays a crucial role in the development and maturation of immune cells known as T cells, which are essential for the body’s immune response. The thymus gland is ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Thyroid Gland - Structure, Hormones, Functions, Disorders
What is Thyroid Gland? Definition of Thyroid Gland The thyroid gland is a butterfly-shaped endocrine organ located in the anterior neck that produces hormones such as thyroxine (T4), triiodothyronine (T3), and calcitonin, which regulate metabolism, growth, and calcium homeostasis. It plays a crucial role in maintaining the body’s metabolic rate and overall hormonal balance. Anatomical ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Ticks - Morphology, Types, Life Cycle and Examples
What are Ticks? Definition of Ticks Ticks are small, parasitic arachnids belonging to the order Ixodida, feeding on the blood of mammals, birds, reptiles, and amphibians. They are classified into two main families: Ixodidae (hard ticks) and Argasidae (soft ticks). Ticks have a complex life cycle that includes four stages: egg, larva, nymph, and adult, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Tissue Homogenizer - Principle, Parts, Types, Procedure
Tissue Homogenizer is a laboratory device that is used to break biological tissues into small and uniform particles. It physically disrupts the tissue structure by rupturing the cell wall and cell membrane. During this process, intracellular components like proteins, nucleic acids (DNA and RNA) and microorganisms are released from the tissue matrix. The uniform mixture ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Tissues - Definition, Types, Structure, Examples
What are Tissues? Definition of Tissues Tissues are groups of similar cells that work together to perform specific functions in an organism. They serve as the structural and functional units that form organs, playing critical roles in various biological processes. Characteristics of Tissues Location of Tissues Formation of Tissues The formation of tissues, known as ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Tobacco mosaic virus (TMV) - Structure, Life cycle, Infection, Treatment
What is Tobacco mosaic virus (TMV)? Characteristics of Tobacco Mosaic Virus (TMV) TMV has a range of distinctive features that set it apart as a widespread and resilient plant virus, impacting several economically important crops, especially within the Solanaceae family. TMV’s combination of durability, wide host range, and ease of spread underscores the importance of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Tobacco Plant - Morphology, Processing, Uses and Health Hazards
Disclaimer: The information presented in this blog post about the tobacco plant is intended solely for educational purposes, particularly for botany students and enthusiasts. The content aims to provide a comprehensive understanding of the plant’s characteristics, uses, and cultivation methods. We do not endorse or promote the use of tobacco in any form, nor do ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Tollens’ Test - Principle, Procedure, Result, Application
It is a type of biochemical test which is used to distinguish reducing sugars from non-reducing sugars. This biochemical test is also known as the silver mirror test based on the end product of this test. This test was also used to differentiate between aldehydes and ketones through routine qualitative organic analysis.
Toluidine Blue Staining - Principle, Procedure, Uses
Toluidine blue is a basic thiazine metachromatic dye that stains nuclei blue, and can be used to differentiate different types of granules (e.g. within mast cells).
Tomato Spotted Wilt Virus (TSWV) - Life Cycle, Structure, Symptoms, Vector
Tomato Spotted Wilt Virus, often called TSWV for short, is one of those frustrating problems that can really throw a wrench into your gardening plans or hit farmers hard. It’s not just a tomato issue either – this nasty virus has a surprisingly broad appetite, targeting everything from peppers and lettuce to popular flowers like ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Tonicity - Definition, Types, Examples
To function properly, cells must be kept turgid. To function properly, a well-watered plant will grow and produce fruits and flowers. A plant that is not watered for several days will wilt and eventually die. This happens because water leaves the cell and causes the cell to lose its turgidity. Based on the concentration of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Toolmakers Microscope - Principle, Procedure, Parts, Applications
What is Toolmakers Microscope? The Toolmaker’s Microscope is referred to as a compact Precision optical device that is utilized for measurement rather than ordinary viewing, and it projects a magnified shadow-image of a component’s contour in to an eyepiece or screen. It is considered to be contactless equipment, which is necessary for measuring very thin ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Tools and Techniques Used in Research
Research plays a crucial role in advancing knowledge and understanding across various fields, from science and medicine to social sciences and humanities. To carry out effective research, researchers employ a wide array of tools and techniques that enable them to collect, analyze, and interpret data in order to address research questions and achieve their objectives. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Top 10 Difference Between Monera, Protista, Fungi, Animalia, Plantae
Difference Between Monera, Protista, Fungi, Animalia, Plantae. The five-kingdom classification was proposed by R.H. Whittaker in 1969 and was built on the work of two-kingdom classification. In Five Kingdom Classification, the organisms are classified based on several characteristics such as mode of nutrition, thallus organization, cell structure, phylogenetic relationships, and reproduction. It is the most ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Top 11 Books for Cell Biology
In this article, I will share a list of Top and Best Books for Cell Biology. In this paper on microbiology, you will study about Structure and organization of Cell, Nucleus, Protein Sorting and Transport, Cell Signalling, Cell Cycle, Cell Death and Cell Renewal. Our goal: Find the Best Books for Cell Biology, based on ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Top 13 Lab Techniques You Must Know
The average Researcher will spend about 4-5 years of time in the lab. The whole period is focused on setting goals and defining experiments, carrying out experiments, taking notes and analyzing results from experiments in the process of interpreting and concluding results of the experiment for publication of the outcomes. The most crucial steps is performing experiments that can be practical unlike other experiments that are theoretical and can be carried out. To get the most effective results from the tests it is vital to be proficient with the instruments as well as to be proficient with wet-lab methods.
Top 14 books for Industrial Microbiology
List of Top 14 books for Industrial Microbiology
Top 14 Difference Between Monera and Protista
Difference Between Monera and Protista. The five-kingdom classification system divides the different life forms of earth into five distinct categories such as Kingdom Monera, Protists, Fungi, Plantae, and Animalia. Among them, Monera is the most primitive organism. The key difference between Monera and Protista is that Monera has a prokaryotic cellular organization, whereas Protista has ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Top 15 Books for Food and diary Microbiology
Food and diary Microbiology is a branch of microbiology. In this portion of microbiology, we discuss about preparation procedures of dairy products and different foods in industries. Now, in this article, I will discuss about Top books for Food and diary Microbiology which you can buy from online stores. List of Top 15 Books for ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Top 15 Books for Molecular Biology
In this article, I will share a list of Top and Best Molecular Biology Books. In this paper on microbiology, you will study about Structures of DNA and RNA / Genetic Material, Replication of DNA (Prokaryotes and Eukaryotes), Transcription in Prokaryotes and Eukaryotes, Post-Transcriptional Processing, Translation (Prokaryotes and Eukaryotes), Regulation of gene Expression in Prokaryotes ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Top 16 Infectious and Deadliest Diseases Caused By Bacteria
The worldwide issue of deadly and infectious illnesses caused by bacteria are becoming one of the biggest medical and scientific issues of the moment.
Top 18 books for Environmental Microbiology
Here i am with Top books for Environmental Microbiology. All these books are recommended for the study of environmental microbiology. List of Top 18 books for Environmental Microbiology
Top 22 Difference Between Bacteria and Virus
Difference Between Bacteria and Virus Bacteria Bacteria are referred to as microscopic, single-celled organisms which exist in their millions, in every environment, both inside and outside other organisms. In 1676, a Dutch microscopist Antonie van Leeuwenhoek first observed a bacterial cell by using a single-lens microscope of his own design. In 1828, Christian Gottfried Ehrenberg ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Top 30 Differences Between Bacteria, Archae, and Eukarya
What is Bacteria? Bacteria represent a category of microscopic, unicellular organisms that are classified as prokaryotes, characterised by the absence of a membrane-bound nucleus and organelles. These organisms are found in a wide range of habitats across the planet, including extreme environments such as deep-sea vents and arctic ice, as well as more common settings ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Top 6 Books on Microbial Physiology and Metabolism
In this article, I will share a list of top and best books on Microbial Physiology and Metabolism. In this paper, you will study about Microbial Growth and Effect of Environment on Microbial Growth, Nutrient uptake and Transport, Chemoheterotrophic Metabolism – Aerobic Respiration, Chemoheterotrophic Metabolism- Anaerobic respiration and fermentation, Chemolithotrophic and Phototrophic Metabolism, Nitrogen Metabolism. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Top 7 Books For Biofertilizers and Biopesticides
The world of biofertilizers and biopesticides is a fascinating one that’s full of new developments and discoveries. If you’re interested in learning more about these sustainable alternatives to traditional chemical fertilizers and pesticides, then you’ll be pleased to know that there are a wealth of books out there to help you do just that. In ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Top 8 AI Generated Picture of Microscope
Are you fascinated by the intricate details of the microscopic world? Have you ever wondered what it would be like to see beyond the limitations of traditional microscopy? Look no further because the world of Artificial Intelligence (AI) has made it possible to generate highly detailed and visually stunning images of the microscopic world. In ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Top 8 Book for Biodiversity
Discover the top 8 books that provide comprehensive insights into biodiversity, covering microbes, algae, fungi, and archegoniate plants. These recommended reads are essential for anyone interested in the intricate world of microscopic life forms and their crucial roles in ecosystems. From foundational texts to advanced guides, this list offers valuable resources for students, researchers, and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Top and Best Books for Microbiology
In this article we will discuss about the Top and Best Books for Microbiology. Best Microbiology Textbook for B.Sc and M.Sc Students. There are 14 core subject of Microbiology. Introduction to Microbiology and Microbial Diversity Bacteriology Biochemistry Virology Microbial Physiology and Metabolism Cell Biology Molecular Biology Microbial Genetics Environmental Microbiology Food and Dairy Microbiology Industrial ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Top Biotech Companies of India
Biotechnology companies have evolved as backbones to support the country's economy. To develop products or resolve problems, the techniques from living cells are employed by biotechnology companies. The source of DNA and identification has allowed the biotechnology industry to achieve great levels.
Top Life Sciences and Biotechnology Entrance Exams after B.Sc. and M.Sc In India
For students pursuing a career in Life Sciences, Biotechnology, and related fields, entrance exams are critical milestones that determine your path to higher education and research opportunities. This guide provides an in-depth look at 42 essential entrance exams that can help you secure admission to top institutions and prestigious fellowships in India. Importance of Life ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Top M.Sc in Microbiology (Private and Government) colleges in West Bengal (Wb)
In this article, we will discuss about Top MSc Microbiology colleges in West Bengal. All these Colleges conduct an MSc program in Microbiology and they are located in West Bengal. Top M.Sc in Microbiology Private and Government colleges in West Bengal Adamas University Address Adamas Knowledge City, Barasat – Barrackpore Road, P.O. – Jagannathpur, District ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Top Universities in West Bengal Offering Microbiology
Microbiology is a vital field of study that has a significant impact on our health, food, and environment. The study of microorganisms is crucial in understanding and addressing a wide range of issues such as the spread of infectious diseases, the production of food and beverages, and the development of medical treatments. In West Bengal, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Topoisomerase - Definition, Structure, Types, Functions, Mechanism
James Wang discovered the first DNA topoisomerase in bacteria in 1971, initially naming it ω (omega) protein; it is now known as Escherichia coli (E. coli) topoisomerase I (topo I) and is a member of the type IA family of enzymes. Subsequently, James Champoux and Renato Dulbecco discovered an analogous activity in eukaryotic cells (rat liver); the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Torovirus - Structure, Genome, Replication, Pathogenesis
Torovirus is a genus of enveloped, positive-strand RNA viruses belonging to the Nidovirales order and Tobaniviridae family.They infect predominantly vertebrates, particularly cattle, pigs, and horses. Among the diseases associated with this genus is gastroenteritis, a condition typically observed in mammals.Torovirus is the only genus in the monotypic Torovirinae subfamily.Torovirus is a monotypic taxon with a ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Torsion and Detorsion in Gastropoda
What is Torsion? Conditions before Torsion The following points outline the key features and conditions that are present in the veliger larva prior to the onset of torsion: How Torsion Occurs Torsion in gastropods is a complex, stepwise process that leads to the twisting of visceral organs in a counterclockwise direction, resulting in a significant ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Total Red Blood Cell (RBC) Count – Procedure, Principle, result
Haemocytometry is a quantitative method that quantifies the RBC count in blood samples. The manual method of counting RBCs is the Haemocytometer (or Neubauer’s chamber slides). Modern devices, such as photometric and electrometric counters, can be more precise or automated. They can count the cells in the blood sample. It is impossible to count the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Total White Blood Cell (WBC) Count - Total Leucocyte Count (TLC)
The White Blood Cells (WBCs) also known as Leucocytes are round nucleated cells in blood, that provide protection against foreign invaders. There are many types of White Blood cells found in blood, and identified as Granulocytes (Neutrophils, Eosinophils & Basophils) and Agranulocytes (Monocytes and Lymphocytes). The size of White Blood Cells can vary between 10 ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Toxigenic Fungi And Fungal Mycotoxins In Food
Growth of prevalent filamentous fungi in foods may result in the production of mycotoxins, which can cause a variety of adverse effects in humans, including allergic reactions, immunosuppression, and cancer. Mycotoxins aflatoxins, ochratoxin A, fumonisins, tnchothecenes, and zearalenone are the most significant. Aflatoxins are potent carcinogens and, in conjunction with the hepatitis B virus, are ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Trademarks - Definition, Objectives, Types, Registration Process, Infringement
In this article we will learn about Trademarks Objectives, Types, Rights, Protection of goodwill, Infringement, Passing off, Defences, Domain name. What is Trademark? Definition of Trademark A trademark is a unique word, symbol, phrase, or design used to identify and distinguish the goods or services of one business from those of others. It serves as ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Traditional Indian Fermented Foods
Dahi Idli Dosa Dhokla Fermented Leafy Vegetables Ziang sang/Ziang dui Sinki Gundruk Goyang Fermented Fish Products Ngari Hentak Tungtap Fermented Beans Kinema Hawaiijar Tungrumbai Ankhone/Bekang/Peruyyan Fermented Bamboo Shoots Soibum/Soidon Mesu Lung-Seij Bas-tenga Miya Mikhri Ekung/Hirring Fermented Alcoholic Beverages Ennog/Sai Mod Apong Kodo ko Jaanr Xaj-pani Zutho Judima Antingba Kiad Sujen
Transcription (RNA Synthesis) - Definition, Diagram, Steps, Inhibitors, Importance
The process of DNA transcription also referred to as RNA synthesis , is the process where genetic information in DNA is transformed into messenger (mRNA) (mRNA) through an enzyme known as RNA polymerase.
Transcription In Prokaryotes - Definition, Stages, Significance
Transcription refers to the process in which the information contained in the DNA strand is transformed into a new messenger RNA molecule (mRNA). In prokaryotic cells, transcription occurs in three stages called the initiation, the elongation, and the termination.
Transfection - Definition, Types, Principle, Applications
Transfection refers to the introduction of foreign DNA (non-host genome genetic material) into a cell. The primary goal of transfection is to modify the host genome in order to express or inhibit the production of the linked protein. The primary purpose of this page is to provide readers with a thorough explanation of the fundamental ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Transfection PEI (Polyethylenimine) Protocol
Standard protein expression systems, including E. coli, frequently fail to generate folded, monodisperse, or functional eukaryotic proteins (see Small-scale Expression of Proteins in E. coli). Utilizing a eukaryotic system, such as mammalian cells, that includes the required folding and posttranslational machinery is highly advantageous for the expression of these proteins. Using polyethylenimine, we present strategies ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Transfection Protocols - Principle, Protocol, Uses
Principle of Transfection According to the definition of transfection, the external genetic material must enter the cell via the cell membrane. It is essential to highlight that the genetic material, whether DNA or RNA, is negatively charged as a result of the proteins that surround it. Therefore, in an unmanipulated environment, exogenous DNA cannot cross ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Transfer-messenger RNA (tmRNA) - Definition, Structure, Properties
What is Transfer-messenger RNA (tmRNA)? History Properties of tmRNA tmRNA Structure tmRNA contain the following domains; tRNA-Mimic Domain Pseudoknots mRNA-Mimic Domain Protein Partners tmRNA Function ― Trans-Translation Trans-translation of tmRNA activity Steps Regulation of tmRNA activity Facts References
Transgenic Animal - Definition, Methods, Applications, Examples
What is Transgenic Animal? Definition of Transgenic Animal A transgenic animal is an organism that has had a foreign gene (transgene) deliberately inserted into its genome, allowing the gene to be expressed and passed on to future generations. Steps for Production of Transgenic Animals The production of transgenic animals involves a detailed and systematic approach ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Transgenic Crop - Insect, Viral, Disease, Abiotic Stresses resistance
Transgenic disease-resistant crops are those plants in which a foreign resistance gene is inserted into the plant genome so that the plant can defend itself from different pathogens. It is the process where genes taken from other plants, microbes or sometimes from the pathogen itself are introduced to produce proteins that stop the infection. In ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Transgenic Plants - Examples, Definition, Procedure, Application
What are Transgenic Plants? Definition of Transgenic Plants Transgenic plants are genetically modified organisms in which DNA from another species is inserted into their genome through genetic engineering techniques to confer new traits, such as pest resistance or improved nutritional content. Different Methods to Create Transgenic Plant Creating transgenic plants involves various techniques to introduce ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Transitional epithelium - Definition, Structure, Function, Location, and Example
The epithelium of transition is a form of stratified epithelium that comprises several layers of cells, where their shape cells changes in accordance with the function that the organ performs. The epithelium can have a varied appearance, as it appears to be circular or cubic in a relaxed state with the exception of the apical layer that appears flat when stretched. The epithelium is essentially restricted to the urinary system that's why it's sometimes referred to"urothelium" "urothelium".
Translation In Eukaryotes - Protein synthesis in Eukaryotic
Before going through Eukaryotic Translation steps, please take a look at our previous article Prokaryotic Translation Steps, Requirements, to check the components required for the translation procedure. Protein synthesis in eukaryotes, which includes organisms such as animals, plants, fungi, and protists, involves a complex process that occurs in two main stages: transcription and translation. Here’s ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Translational regulation - Definition, Mechanism
What is Translational regulation? In conclusion, translational regulation is a vital process that controls protein synthesis levels by modulating the initiation, elongation, and termination stages of translation. It enables rapid cellular adjustments in response to various stimuli and is critical for maintaining cellular homeostasis. Understanding the mechanisms and factors involved in translational regulation contributes to ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Translocation in Phloem - Structure, Phloem loading and unloading
Translocation in phloem refers to the process by which photoassimilates, primarily sugars, are transported over long distances within plants. This vital function occurs within the phloem, a type of vascular tissue responsible for distributing the products of photosynthesis from the sites of production to various sinks throughout the plant. The primary photosynthate transported by phloem ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Translocation in Prokaryotes - Components, Steps, Enzymes, Sites
In molecular biology and genetics, translation is the process in which ribosomes in the cytoplasm or endoplasmic reticulum synthesize proteins after the process of transcription of DNA to RNA in the cell's nucleus. The entire process is called gene expression.
Transmission Electron Microscope (TEM) - Principle, Parts, Uses
Transmission Electron Microscope (TEM) is an advanced analytical instrument used to visualize the internal structure of specimens. It uses highly energetic beam of electrons instead of light. It works under high vacuum condition. The electron gun produces electron beam. This beam is then focused and guided by a series of electromagnetic lenses. The specimen used ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Transpiration - Types, Mechanism, Factors, Significance
What is Transpiration? Types of Transpiration Transpiration in plants occurs through several distinct pathways, each playing a specific role in water movement and evaporation. These pathways are classified into four primary types: stomatal, cuticular, lenticular, and bark transpiration. Factors affecting Transpiration Transpiration is influenced by a variety of factors that can be classified into two ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Transplantation - Definition, Types, Examples
Modern medicine continues to provide numerous marvels that extend the lives of humans and vastly improve their quality of life. The replacement of faulty organs by transplantation has been one of medicine’s unachievable goals for millennia. The dream of health experts has been to replace or restore severely damaged tissues or organs. Successful transplantation needs ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Transport Media - Definition, Types, Principle, Uses, Examples
Transport media are basically buffer solutions that contain carbohydrate, peptones, along with other nutritional elements (excluding growing factors) that are designed to protect the health of bacteria during transport, without allowing for their multiplicity. The main goal of utilization of the medium is to keep the sample as close to its original condition as is possible.
Transport of Ions across cell membrane - Active and passive transport, carriers, channels and pumps
The transport of ions across the cell membrane is a fundamental process necessary for maintaining cellular homeostasis. The plasma membrane, acting as a selectively permeable barrier, allows certain substances to enter or leave the cell, ensuring proper balance between the intracellular and extracellular environments. This selectivity is crucial for the regulation of essential molecules such ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Transposable elements - Definition, Types, Examples, Application
Transposable elements can be described as mobile genetic segments that is able to move from one position of the genome to another without the need of any homology. It is the process where small DNA sequences is shifted or sometimes replicated inside the chromosomes, and this movement is referred to as transposition. It is seen ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Transposition - Definition, Types, Mechanism
What is Transposition? Transposition is the process in which a particular DNA sequence is shifted from one position of the genome to another position. It is the movement of a transposable element or jumping gene, and it is not dependent on any homologous sequence at the target site. It is the process that may occur ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Treponema Pallidum - Definition, Structure, Transmission, Pathogenesis, Treatment
What is Treponema Pallidum? Definition of Treponema Pallidum Treponema pallidum is a helical, microaerophilic bacterium responsible for causing syphilis, a sexually transmitted disease, and other related diseases such as bejel and yaws. It is characterized by its slow metabolic rate and is best visualized using dark-field microscopy. What is Syphilis? Classification of Treponema Pallidum Treponema ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Trichinella spiralis - Morphology, Life Cycle, Pathogenicity, Diagnosis, Prophylaxis and Treatment
What is Trichinella spiralis? History and Distribution of Trichinella spiralis Trichinella spiralis is a tissue nematode known as the causative agent of trichinosis, a significant zoonotic disease impacting human health. Its historical context and distribution reveal critical insights into its epidemiology and the public health challenges it poses. Habitat of Trichinella spiralis The habitat of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Trichomes Under Microscope
What are Trichomes? Trichomes Under Pocket Microscope (Handheld Microscope) Trichomes Under Stereo Microscope To observe trichomes under a stereo microscope effectively, a few key requirements must be met. A stereo microscope, also known as a dissecting microscope, is an essential tool for obtaining a three-dimensional view of trichomes, allowing for detailed examination and analysis. Here ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Trichonympha Under Microscope
What is Trichonympha? Morphology/Structure of Trichonympha Species Requirements Procedure By following this well-structured procedure, researchers can unlock the microscopic wonders of Trichonympha and gain valuable insights into their symbiotic relationships with termites and wood-feeding cockroaches. As scientists continue to refine their observations, this captivating journey into the microcosm contributes to our understanding of the complexities ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Trichophyton spp - Morphology, Life cycle, Pathogenesis
Trichophyton is a genus of fungi that comprises the parasitic species responsible for tinea, athlete’s foot, ringworm, jock itch, and similar infections of the nail, beard, skin, and scalp. Trichophyton fungi are characterized by the development of both macro- and microconidia with smooth walls. Macroconidia are thin- or thick-walled, clavate to fusiform, and range in ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Trinocular Microscope - Definition, Principle, Parts, Protocol, Uses
A trinocular microscope can define as a specialized Light-Microscopy instrument that adds a third optical tube for imaging or recording purpose’s, and this design is widely used in laboratory Observation’s where detailed visualization of micro-structures are needed. It is important to note that the three-tube arrangement give’s a look into how researchers try to observe ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Triosephosphate Isomerase - Definition, Structure, Mechanism, Functions
What is Triosephosphate isomerase? Mechanism of Triosephosphate isomerase Structure of Triosephosphate isomerase Triosephosphate isomerase in glycolysis Triosephosphate isomerase (TPI) plays a crucial role in the glycolysis pathway, which is the central metabolic pathway responsible for the breakdown of glucose to produce energy. TPI catalyzes the reversible isomerization of two triose phosphate molecules: dihydroxyacetone phosphate (DHAP) ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Triple Beam Balance - Parts, Procedure, Uses
What is Triple Beam Balance? Definition of Triple Beam Balance A triple beam balance is a precise measuring instrument used to determine the mass of an object. It consists of three beams, each with different sizes and scale readings, allowing for precise measurements ranging from 0.1 grams to 600 grams. Parts of Triple Beam Balance ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Triple Sugar Iron (TSI) - Principle, Composition, Procedure, Result
What is Triple Sugar Iron Test (TSIA Test)? Triple Sugar Iron (TSI) agar is a differential solid culture medium. It is mainly used in clinical microbiology to identify and distinguish different Gram negative enteric bacteria such as Enterobacteriaceae family. The medium is prepared in a test tube and it is solidified at an angle. Two ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Triple Sugar Iron (TSI) Agar - Composition, Principle, Preparation, Results, Uses
The majority of bacteria are able to ferment carbohydrates, especially sugars. Within them, every bacteria is able to ferment just a few of the sugars, whereas it is unable to ferment all the other sugars. So, the sugars that a bacterium is able to ferment, as well as the sugars that it can't, is the signature of the bacterium and is an important factor in its determination. It is the Triple Sugar Iron (TSI) Agar is a type of culture medium known for its capacity to determine a microorganism's capacity to produce sugars and generate hydrogen sulfur.
Tris-SDS Buffer Preparation of pH 6.8 and 8.8 for SDS PAGE
Tris-SDS Buffer (pH 6.8) is used to prepare buffer for stacking gel during SDS-PAGE (SDSPolyacrylamide gel electrophoresis). It is a discontinuous gel with a huge pores size to concentrate proteins prior to entering the separating zone. The buffer is sold in a 5X stock.
tRNA - Structure, Definition, Functions, Types
What is tRNA? History of tRNA Properties of tRNA tRNA biogenesis Structure of tRNA The transfer RNA (soluble RNA) molecule has a molecular weight of about 25,000 and has between 71 and 80 nucleotides, most of which are 75. There are at least 20 different kinds of tRNAs, which is the same number of amino ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Trochophore Larva - Features, Structure, Metamorphosis, Evolutionary significance
What Is Trochophore Larva? Trochophore larva refers as an early free-swimming stage found by many marine invertebrates like annelids, mollusks, etc. It can define as – a small, spherical or pear-shape larva having a ring of cilia (called prototroch) around its middle part. This larva usually formed after fertilization → from the zygote → and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Tropism - Definition, Types, Mechanism, Examples, Importance
What is Tropism? Tropism refers to the inherent capability of an organism, predominantly plants, to orient or move in reaction to an external stimulus. This response is not learned but is an innate, genetically encoded behavior. The nature of the response is contingent upon the direction of the stimulus, distinguishing it from nastic movements, which ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Trypanosoma gambiense - Life Cycle, Pathogenesis, Prophylaxis, Structure, Treatment
What is Trypanosoma gambiense? Classification Domain Eukaryota Phylum Euglenozoa Class Kinetoplastea Order Trypanosomatida Family Trypanosomatidae Genus Trypanosoma History and Distribution of Trypanosoma gambiense Trypanosoma gambiense, the parasite responsible for causing Human African Trypanosomiasis (HAT) or African sleeping sickness, has been a health concern in tropical Africa for centuries. Its history and distribution provide valuable insight ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Tryptic Soy Agar (TSA) - Composition, Principle, Preparation, Results, Uses
Tryptic Soy Agar can be used to grow microorganisms. These media are non-selective and general-purpose. They provide enough nutrients to support a variety of microorganisms. This medium can also be used to grow, store, maintain, and transport pure microorganism cultures.
Tryptone Soya Broth for the enrichment of Staph. aureus
Supplemented with sodium pyruvate and sodium chloride, tryptone soya soup can be used for selective enrichment of Staphylococcus Aureus.
Tryptophan (Trp) Operon - Repressible operon
Tryptophan (Trp) Operon Definition A collection of genes that are transcribed together encode the components for tryptophan synthesis. Note: The trp operon is a set of genes that, when transcribed together, encode the enzymes that cause bacteria to generate the amino acid tryptophan. The trp operon was initially defined in Escherichia coli, and it has ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Tumor - Types, Tumor Antigens, Risk Factors
What is a tumor? Risk factors for tumors Types of Tumors There is three types of Tumors such as; 1. Cancerous or Malignant Tumor Types of malignant tumors Examples of Cancerous or Malignant Tumor 2. Noncancerous or Benign Types of benign tumors Examples of Noncancerous or Benign Adenomas Fibroids Fibroids, also known as fibromas, are ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Tumor Antigen
Tumors Tumor Antigens Some Antigens Are Tumor-Specific Antigens unique to cancers caused by chemical or physical carcinogens, as well as some virally induced malignancies, have been found. It is particularly difficult to demonstrate the presence of tumor-specific antigens on spontaneously developing tumours since the immune response to such tumours destroys all of the tumour cells ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Tumor Immunology - Definition, features
Features of Malignant Cells Malignant cells exhibit the following characteristics: It has been hypothesised that the immune system is partially responsible for protecting the body from the development of cancers. In addition, the presence of multiple tumours in immunocompetent individuals suggests that the immune system has a limited function in defending against cancer and is ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Turgor Pressure - Definition, Mechanism, Functions
What is Turgor Pressure? Definition of Turgor Pressure Turgor pressure is the internal force exerted by water against a cell’s plasma membrane and its supporting cell wall, primarily observed in plants, fungi, and bacteria, resulting from the osmotic flow of water into the cell. Mechanism of Turgor Pressure Turgor pressure, a fundamental concept in cellular ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Two Pan or Equal Arm Analytical Balance
What is Two pan or equal arm analytical balance? Principle of Two pan or equal arm analytical balance Parts of a Two pan or equal arm analytical balance Beam – It is the main horizontal bar of the balance which carries two equal arms and supports the pans at its both ends. It made from ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Two-Dimensional (Crossed) lmmunoelectrophoresis (2D)
What is Two-Dimensional (Crossed) lmmunoelectrophoresis? Principle of Two-Dimensional lmmunoelectrophoresis The principle of two-dimensional (crossed) immunoelectrophoresis (2-D IEP) involves a two-step electrophoretic separation that permits antigen mixtures to be analysed and quantitated. In the first dimension the antigen (protein) mixture is loaded on an agarose gel and it is separated by electrophoresis by charge and mobility ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Two-Point and Three-Point Crosses
What is Two-Point Cross? A two-point cross is a genetic mapping technique used to determine the recombination frequency between two specific genes located on the same chromosome. In this method, a test cross is performed between a heterozygous individual (carrying two different alleles for the genes of interest) and a homozygous recessive individual (which has ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Type 1 (Anaphylactic) Hypersensitivity Reaction - Definition, Mechanism, Examples
What is Type I Hypersensitivity Reaction? Definition of Type I Hypersensitivity Reaction? Type I hypersensitivity reaction, also known as immediate hypersensitivity, is an exaggerated immune response triggered by the re-exposure to a specific allergen. It involves the rapid release of inflammatory mediators from mast cells and basophils sensitized with IgE antibodies. This type of reaction ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Type 1 Diabetes vs Type 2 Diabetes
Type 1 Diabetes vs Type 2 Diabetes Type 1 Diabetes: Type 2 Diabetes: Comparison chart of Type 1 Diabetes vs. Type 2 Diabetes ologies for the confusion. Here’s the information presented in a table format: Aspects Type 1 Diabetes Type 2 Diabetes Definition Beta cells in pancreas are attacked, resulting in no insulin production Insulin ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Type II (Cytotoxic) Hypersensitivity - Definition, Mechanism, Examples
What is Type II Hypersensitivity? Definition of Type II Hypersensitivity Type II hypersensitivity is an immune response characterized by the destruction of healthy cells mediated by antibodies, specifically IgG or IgM, targeting antigens on the surface of host cells. This antibody-mediated reaction can lead to cell lysis, tissue damage, or loss of function. Mechanism of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Type III Hypersensitivity - Definition, Types, Mechanism, Examples
What is Type III Hypersensitivity? Definition of Type III Hypersensitivity Type III hypersensitivity is an allergic reaction characterized by the accumulation of immune complexes (antigen-antibody complexes) in tissues, leading to inflammation and tissue damage. Types of Type III hypersensitivity reaction Type III hypersensitivity reactions can be categorized into localized and generalized reactions. The manifestation of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Type IV or Delayed-Type Hypersensitivity (DTH)
What is Type IV or Delayed-Type Hypersensitivity (DTH)? Definition of Type IV or Delayed-Type Hypersensitivity (DTH) Type IV or Delayed-Type Hypersensitivity (DTH) is an immune response mediated by T cells rather than antibodies, characterized by a delayed onset (usually 24-72 hours) after exposure to an antigen. It involves the interaction of CD4+ T cells, monocytes, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Types of Blood Collection Tubes and Their uses
Evacuated Tubes that are used for blood collection for different laboratory tests are made up of tubes in variable sizes, and color-coded tops to indicate tube contents. The majority of blood collection tubes contain an ingredient that either speeds up the blood's clotting (clot activator) or stops blood from becoming clot-free (anticoagulant). The following list lists the most frequently utilized blood collection tubes, along with their additives, and their uses in lab:
Types of Cells - Definition, Examples, Importance
What is Cell? Definition of Cell A cell is the fundamental, structural, and functional unit of living organisms, responsible for carrying out all the processes necessary for life. Types of Cells Cells, the fundamental units of life, operate akin to intricate factories, with specialized components working in harmony to achieve a unified goal. These cellular ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Types of Centrifuge - Definition, Principle, and Applications
A centrifuge can define as a laboratory device that use rapid rotational Force to separate component’s of a mixture based on their Density difference’s, and it is considered a key Instrumentation in many biological / chemical workflows. What is Relative Centrifugal Force (RCF)? Relative Centrifugal Force (RCF) is the effective acceleration a particle experiences in ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Types of Chromatography With their Definition, Principle, Steps, Uses
What is Chromatography? Chromatography Definition Chromatography is a technique used to separate and analyze the components of a mixture based on their properties and interactions with a stationary and mobile phase. What is a stationary phase? What is the mobile phase? Types of Chromatography Here is the Types of Chromatography; Type of Chromatography Description Gas ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Types of Crystals in Urine - Causes, Factors, Identification
Crystals in urine is the condition in which solid crystalline particles are seen in urine. It is referred to as crystalluria. These crystals are formed when urine contains excess amount of minerals and waste products and they are precipitated out as solid particles. In normal conditions, kidneys filter blood and different dissolved solutes are excreted ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Types of Immunoelectrophoresis Techniques- Principle, Uses
Immunoelectrophoresis (IEP) is the process in which proteins of a biological sample are first separated by electrophoresis and then allowed to react with specific antibodies inside a gel. It is the technique combining electrophoresis with immunodiffusion. In this method the sample like serum is placed on an agarose gel and an electric field is applied, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Types of Microorganisms In Pond Water
Types of Microorganisms In Pond Water 1. Arthropods 2. Bacteria 3. Protozoa 4. Hydra 5. Algae Algae are autotrophic protists commonly found in pond water. They exhibit a wide range of colors, with most microorganisms being green, while some may appear yellowish-brown. The diversity of algae extends to their structure, where they can exist as ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Types of Mutations
Mutations are changes in the genetic material of an organism. These alterations can occur in various ways, and they play a fundamental role in biological diversity and evolution. Broadly, mutations can be classified into two major categories: gene mutations and chromosomal mutations. Gene mutations, also known as point mutations, occur when a change takes place ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Types of PCR with Definition, Principle, and Uses
Types of PCR Here is the list of Types of PCR based on different categories; 1. Conventional PCR Conventional PCR is the basic type of PCR in which target DNA is amplified by repeated temperature cycles. It is also called end-point PCR or traditional PCR. In this method, detection of amplified DNA is done only ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Types of Plant Cell
They are multicellular, eukaryotic cells which comprise the Plant (a collection of eukaryotes that belong to the Plantae kingdom ) capable of producing their own food from sunlight, water and carbon dioxide). Since they are eukaryotic they possess a distinct nucleus, with specially designed organelles that allow them to function in a controlled way.
Types of Research
What is Research? Research refers to the systematic investigation, study, or inquiry conducted to discover new knowledge, expand understanding, solve problems, or validate existing theories. It is a process of gathering information, analyzing data, and drawing conclusions to contribute to the body of knowledge in a particular field. Research typically involves the following key elements: ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Types of RNA with Structure and Functions
What is RNA? Different Types of RNA and Their Functions RNA, or Ribonucleic acid, is a crucial molecule synthesized by RNA polymerase from DNA. It serves various functions in the cell, including protein-coding and non-coding roles. Understanding the different types of RNA is essential for comprehending their specific functions. Let’s delve into the main types ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Types of Staining Techniques With Examples and Uses
Staining is a method used to boost the contrast of samples, usually at the microscopic scale.
Types of Stains used in Microbiology
Different stains react or concentrate on different areas of a tissue or cell These properties can be utilized to highlight certain areas or regions. A few of the most well-known biological staining methods can be found below. If not otherwise indicated All of these dyes can be used on tissues and cells that are fixed as well as essential dyes (suitable for use in live organisms) are indicated.
Types of Vaccines With Examples
Scientists use a variety of methods for making vaccines. They are based on research on the diseases (caused by bacteria or viruses) the vaccine is designed to be able to prevent, like the way that germs infect cells, and the way the immune system responds to it.
Ultra structure of skeletal muscle - Definition, Functions
What is skeletal muscle? Definition of skeletal muscle Skeletal muscle is a type of voluntary muscle tissue that is attached to the bones and responsible for movement and various bodily functions. Properties Of Skeletal Muscle Skeletal muscles possess several important properties that contribute to their function and enable them to perform various tasks: These properties ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Ultracentrifuge - Principle, Parts, Types, Uses
Ultracentrifuge is a high speed centrifuge which is used for separation of very small particles from a liquid medium. It can rotate at very high speed, usually more than 100000 rpm. Due to this high speed, very strong centrifugal force is produced. This force may be more than 1000000 times of gravity. Ultracentrifuge works on ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Ultrasonic Homogenizer - Principle, Parts, Types, Uses
Ultrasonic Homogenizer is a scientific device used to disrupt, mix and homogenize liquid materials. It is also called sonicator or ultrasonic processor. It is used to make uniform dispersion and emulsion in liquid sample. It mainly consists of three parts, such as generator, piezoelectric transducer and metal probe. The metal probe is also called horn ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Unicellular organism - Definition, Types, Importance, Examples
What is Unicellular organism? Evolutionary History of Unicellular Organisms The evolutionary trajectory of unicellular organisms is a testament to the intricate processes that have shaped life on Earth. These microscopic entities, which form the foundation of the biological hierarchy, have a rich and complex history that spans billions of years. All cellular life forms exhibit ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Urea Cycle - Steps, Reactions, Enzymes, Products, Regulation
What is Urea Cycle? Definition of Urea Cycle The urea cycle is a series of biochemical reactions in the liver that convert ammonia, a toxic byproduct of protein metabolism, into urea, a less harmful compound that is excreted in the urine. Urea Cycle Reactions/Urea Cycle Steps The urea cycle is a critical metabolic pathway that operates primarily ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Urease Test - Principle, Procedure, Result
Urease test is a biochemical assay used in microbiology to detect whether microorganism produces urease enzyme or not. It is the process in which urea is broken down into ammonia and carbon dioxide by urease enzyme. When urease producing organism is inoculated in urease broth or agar the ammonia is rapidly accumulated and pH is ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Urethra -Definition, Structure, Paint, Treatment, Functions
What is Urethra? Definition of Urethra The urethra is a tube that carries urine from the bladder to the outside of the body. In males, it also transports semen during ejaculation. Structure of Urethra The urethra is a fibrous and muscular tube that serves as the conduit for urine from the urinary bladder to the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Urinary System - Definition, Anatomy and Physiology
What is Urinary System? Definition of Urinary System The urinary system is a collection of organs, including the kidneys, ureters, bladder, and urethra, that work together to eliminate waste from the body, regulate fluid balance, and maintain the chemical stability of the body. Anatomy of the Urinary System Two kidneys, two ureters, a urinary bladder, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Urinary Tract Infection (UTI) - Pathogenesis, Treatments, Diagnosis, Prevention
What is Urinary Tract Infection (UTI)? Urinary Tract Infection (UTI) is a common bacterial infection of urinary system. It is affecting any part of the urinary system which includes bladder, urethra, ureters and kidneys. It is most frequently caused by Escherichia coli (E. coli). It occurs more often in women than in men. UTI is ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Urochordata - Definition, Characteristics, and Classification
What is Urochordata? Characteristics of Urochordata The following characteristics distinguish Urochordata from the other subphylums of Chordata: Larval Characteristics During the larval stage of Urochordata, known as the ascidian tadpole larva, several characteristic features can be observed. These features contribute to their chordate nature and play important roles in their development and behavior. These larval ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Urogenital System in Vertebrates - Structure, Development, Succession, Evolution, Significance
What is Urogenital System? Male and Female Excretory System The male and female excretory systems share significant similarities in structure, particularly concerning the kidneys, ureters, bladder, and urethra. Despite these commonalities, there are notable differences, particularly in the anatomy and function of the urethra. Development of Urogenital System The development of the urogenital system is ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Uronic Acid Pathway - Definition, Enzymes, Steps, Importance
What is Uronic Acid Pathway or Glucuronic pathway? Overview The uronic acid pathway stands as a distinctive cytoplasmic thoroughfare within cellular metabolism, orchestrating intricate transformations that hold pivotal significance for various physiological processes. As we embark on an exploration of this biochemical route, we uncover its multifaceted roles and far-reaching implications for cellular health and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
USB Microscope - Principle, Parts,Uses, Advantages
This is a form of digital Microscope which is connected to a computer using an USB port. It operates on low power. The camera is fitted with a powerful macro lens. Additionally, they have an integrated LED light that is built into the lens.
UV Spectroscopy - Principle, Parts, Protocol, Applications
UV-Visible (UV-Vis) spectroscopy is an analytical technique used to measure the absorption or transmission of ultraviolet and visible light by a sample. It works in UV region (about 190–400 nm) and visible region (about 400–800 nm). It is a fast and simple method used in both qualitative and quantitative analysis. The absorption is recorded as ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
UV-Vis Spectroscopy - Principle, Instrumentation, Applications, Advantages, and Limitation
UV-Vis spectroscopy (Ultraviolet-visible spectroscopy) is an analytical technique used to measure the amount of ultraviolet and visible light absorbed or transmitted by a chemical sample. It measures light in UV and visible region. The reading is taken as absorbance or transmittance. This technique relies on interaction between electromagnetic radiation and matter. When molecules are exposed ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Vaccines - Definition, Development, Mechanism, Types, Examples, Side Effects
What is Vaccine? Definition of Vaccines Vaccines are medical preparations that stimulate the immune system to provide protection against specific diseases by promoting the production of antibodies and immune memory. How do vaccines work in Immune System? Types of Vaccines Vaccines can be classified into three main groups based on their composition and mode of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Vacuole Staining - Principle, Methods, Procedure, Results
A light microscope may be used to see and examine the vacuole's structure. While the vacuole doesn't stain as the other organelles of the cell (because it does not contain many constituents that stain) tests have demonstrated that staining is possible for this organelle because the vacuole's sap absorbs and stores dyes that are colored.
Vacuoles - Definition, Structure, Types, Functions, and Diagram
Bacteria cells. The most visible part of the majority of plants is a massive, fluid-filled vacuole.
Varicella Zoster Virus - Definition, Structure, Genome, Replication
Varicella zoster virus Varicella, also known as chickenpox, is an infectious disease caused by the varicella-zoster virus (VZV). The virus causes chickenpox (typically primary infection in non-immune hosts) and herpes zoster or shingles (after reactivation of latent infection). Chickenpox causes a rash consisting of small, itchy lesions that scab over. It begins on the chest, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Vascular Bundles - Definition, Structure, Types, Functions
What are Vascular Bundles? Components of vascular bundles Vascular bundles are fundamental structures in vascular plants, comprising two primary components: xylem and phloem. These components play essential roles in the transportation of water, minerals, and nutrients throughout the plant. Both xylem and phloem are classified as complex tissues, meaning they are made up of various ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Vascular Cambium - Structure and Function, Seasonal activity
What is the Vascular Cambium? Location of Vascular Cambium in Plants The vascular cambium is a key component of secondary growth in plants, responsible for producing secondary vascular tissues. Its location varies among different plant types, as detailed below: Structure of Vascular Cambium The vascular cambium, a crucial meristematic tissue in plants, is composed of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Vavilov's Centres of Origin of cultivated crop plants
What is Centers of origin? The concept of “centers of origin” refers to the geographical regions where specific groups of organisms, whether wild or domesticated, initially emerged on Earth. This term is often associated with the origins of crop plants and wild species, reflecting the places where these organisms first evolved. It is important to ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Vector - Definition, Examples, Characteristics, Types, Applications, Limitations
What is a vector in biology? Vector Definition A vector is a DNA molecule or genetic material used to transfer specific genetic information between cells in molecular biology and genetic engineering. Characteristics Features of vectors The following outlines the key features and functions of vectors, providing insights into their design and effectiveness. Types of vectors ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Vegetative Propagation - Definition, Types, Methods, Advantages
Many plants can reproduce genetically identical offshoots or clones of themselves through asexual reproduction. These offshoots then become independent plants. This is known as vegetative reproduction or vegetative propagation. Fragmentation is one way that vegetative propagation can occur. This means that a part of a plant can be regrown into a new plant. There are ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Venereal Disease Research Laboratory (VDRL) Test
What is Venereal Disease Research Laboratory (VDRL) Test? Principle of Venereal Disease Research Laboratory (VDRL) Test The VDRL test operates on the principle of detecting antibodies that are produced in response to antigens released by damaged host cells in individuals with syphilis. This test utilizes a specific antigen known as VDRL antigen, which consists of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Vernalization - Definition, Types, Mechanism, Examples
What is Vernalization? Definition of Vernalization Vernalization is the process by which exposure to prolonged cold temperatures induces flowering in plants, ensuring they bloom in favorable conditions, typically after winter. Types of Vernalization Vernalization can be categorized into two primary types, each influencing flowering in distinct ways: Mechanism of Vernalization Vernalization involves a series of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Vertebra - Definition, Structure, Development
What is Vertebra? Definition of Vertebra A vertebra is an individual bone that forms part of the vertebral column (spine) in vertebrate animals. It is an irregularly shaped bone composed of a central body, a vertebral arch, and various processes, providing structural support, flexibility, and protection for the spinal cord. Parts of Vertebrae 1. Vertebral ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Vertebrata – Definition, Classification, Characteristics, Features
Evolution of Vertebrata Vertebrata Vertebrates, also known as Craniata or Osseo Batch, are animal species characterized by the presence of a backbone or vertebrae. They belong to the Subphylum Vertebrata within the Kingdom Animalia, which encompasses the broader group of chordates with a backbone. Vertebrates are part of the clade Olfactories, which is a monophyletic ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Vertical Zonation - Definition, Types, Causes, Factors, Examples
What is Vertical Zonation? Vertical zonation refers to the distribution of different species or communities in distinct vertical layers or zones in an environment. This phenomenon is most commonly observed in marine ecosystems, especially along rocky intertidal shores, but it can also be found in forests and other terrestrial habitats. In each of these environments, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Vesicles - Definition, Structure, Types, and Functions
A vesicle can be described as a tiny part of a cell comprised of fluid that is enclosed by a bilayer of lipids. The membrane that surrounds the vesicle also has a lamellar phase like the plasma membrane.
Viability Staining by Loeffler’s Method - Principle, Procedure, Uses
Loeffler’s methylene blue staining is a simple staining method used mainly for observing the morphology of Corynebacterium diphtheriae. It is the process where Loeffler’s alkaline methylene blue solution is applied on a fixed smear, and this stain contains a small amount of potassium hydroxide (KOH) which makes the solution alkaline. It is the alkalinity that ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Vibrio cholerae Food Poisoning - Cholera toxin (CT)
What is Vibrio cholerae? Geographical Distribution and Habitat of Cholera Cholera is a global health issue, primarily affecting parts of Africa and Asia, though it has also spread to other regions. The condition is rare in developed countries, but still a persistent threat in many developing areas. Geographical Distribution Habitat of Vibrio cholerae The bacterium’s ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Vibrio parahaemolyticus Food Poisoning - Gastroenteritis
What is Vibrio parahaemolyticus Food Poisoning? Vibrio parahaemolyticus food poisoning is a type of acute gastroenteritis caused by the consumption of raw or undercooked seafood products contaminated with the bacterium. Here is information about Vibrio parahaemolyticus food poisoning: Characteristics of Vibrio parahaemolyticus Vibrio parahaemolyticus is a bacterium with distinct characteristics that contribute to its physiology and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Viral Entry Into The Host Body
Viral entry is the first phase of infection in the viral life cycle when the virus is in contact with the cell of its host and injects virus-related material into the cell.
Viral Life Cycle - Steps of Viral Infection
Introduction In our daily life, we are thinking about Viral Infection and their symptoms, when we get infected by any infectious virus such as the flu or the chickenpox. But ever you ask, what’s actually happening in your body when you have been infected by a virus? In biology, viral infection means viruses are started ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Viral Pathogenesis Definition, Mechanisms, Factors
Pathogenesis refers to the process by which infection by viruses causes illness. Thus, it is a description of the mechanism by which initial infection triggers the development of disease.
Viral Replication Cycle - Definition, Steps, Mechanisms
Viral replication is the process of forming of biological viruses in the course of the infection process within the host cells.
A virus has to go through the process of reproduction to generate new, infectious virions which are able to infect cells within the body and subsequent hosts.
Viral Spread and Organ Invasion of Virus
The local spread of the infection within the epithelium happens when the virus is released and infects adjacent cells. The infections are typically controlled by the physical limitations of the tissue, and are managed by the inherent immune and innate defenses.
Viral Transport Media (VTM) - Definition, Principle, Preparation, Application
A viral transport medium (VTM) is an essential nutrient that is used to transport and sustain the viability of samples (viruses) to an laboratory for analysis and identification of the specimen.
Viroids Definition, Infection, Structure, Examples, Diagnostic, Origin, Disease.
Viroids Definition Viroids Structure: Replication of Viroids or Infection of Viroids Viroid RNA replicates autonomously and spreads within the host by recruiting host proteins. There are three enzymes that help in RNA replication such as RNA pol. II, RNAase and RNA ligase. Viroid RNA don’t code for any plant protein and they lack AUG initiation ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Virus - Structure, Origin, Replication, Classification, and Example
What are Viruses? Origins of Viruses Viruses have likely existed since the earliest life forms and have evolved alongside cellular organisms. Due to their lack of fossil records, the origins of viruses remain unclear, and scientists use molecular biology techniques to explore their evolutionary history. Three primary hypotheses attempt to explain how viruses may have ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Virus Cultivation - Definition, Methods, Importance
A virus is a form of microscopic infectious agent that can only replicate within the cells of a living organism. Viruses are capable of infecting all forms of life, including animals, vegetation, and even bacteria. They are comprised of a minute piece of genetic material, either DNA or RNA, encased in a protein shell known ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Visualisation of animal and plant cells Under Microscope
What are animal and plant cells? Animal and plant cells serve as the building blocks of life for animals and plants, respectively. Both are eukaryotic cells, meaning they contain a true nucleus and specialized organelles, but they also display significant structural and functional differences. Animal Cells Animal cells are generally smaller and have a flexible, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Vitamin A - Structure, Functions, Properties, Source and deficiency
The retinoids, a group of molecules related to the dietary retinol (vitamin A) , are essential for vision and reproduction, growth and the maintenance of epithelial tissue. They also play an essential part in the immune system. Retinoic acid, which is derived by oxidation of retinol plays a major role in the action of the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Vitamin B1 (Thiamine) - Structure, Properties, Functions, Deficiency
What is Vitamin B1 (Thiamine)? Definition of Vitamin B1 (Thiamine) Vitamin B1, also known as thiamine, is a water-soluble vitamin essential for the metabolism of glucose and amino acids in the body. It plays a critical role in energy production and is vital for the proper function of the nervous system. Thiamine is naturally found ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Vitamin B12 Production
What is Vitamin B12? Microorganisms used for B12 Productions Streptomyces griseus, S. olivaceus, Bacillus megaterium, B. coagulans, Pseudomonas denitrificans, Propionibacterium freudenreichi, P. shermani, and a mixed fermentation of a Proteus spp. and a Pseudomonas spp. may be used in the industrial manufacture of vitamin B12. Typically, Vitamin By is produced via the submerged-culture method. The ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Vitamin C (Ascorbic Acid) - Structure, Properties, Functions, Deficiency
What is Vitamin C (Ascorbic Acid)? Definition of Vitamin C (Ascorbic Acid) Vitamin C, also known as ascorbic acid, is a water-soluble essential nutrient found in various foods, primarily in citrus fruits. It plays a crucial role in tissue repair, collagen synthesis, and acts as an antioxidant, protecting cells from damage. Humans must obtain it ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Vitamin D - Structure, Functions, Synthesis, Mechanism, Deficiency
What is Vitamin D? Definition of Vitamin D Vitamin D is a fat-soluble secosteroid that plays a crucial role in calcium absorption in the gut, promoting bone health and regulating various other biological functions. It can be naturally obtained from sunlight exposure, certain foods, and supplements. Once ingested or synthesized in the skin, it undergoes ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Vitamin E - Structure, Functions, Synthesis, Deficiency
What is Vitamin E? Definition of Vitamin E Vitamin E is a fat-soluble antioxidant essential for human health that protects cell membranes from damage by reactive oxygen species and plays a role in immune function, skin health, and vision. It encompasses a group of eight compounds, including four tocopherols and four tocotrienols. Chemical structures of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Vitamin K - Structure, Properties, Biological roles and Deficiency
What is Vitamin K? Definition of Vitamin K Vitamin K is a fat-soluble vitamin essential for the synthesis of proteins involved in blood coagulation and bone health. It is naturally found in green leafy vegetables, certain animal foods, and is also produced by gut bacteria. Properties of vitamin K Different forms of vitamin K Vitamin ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Vitamins - Classification, Source, Importance, Example
What are Vitamins? Definition of Vitamins Vitamins are organic molecules essential in small amounts for an organism’s proper metabolic function, which are typically obtained through the diet as they cannot be synthesized by the organism in sufficient quantities. History and nomenclature of Vitamins The history and nomenclature of vitamins have their roots in the early ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Voges Proskauer (VP) Test - Principle, Procedure, Results
In 1898, Voges as well as Proskauer (16)characterized the process of fermentation of sugars by a variety of bacteria. They demonstrated that the gas that was produced during the process was a mixture of H2 and CO2 that when they added KOH to the cultures been grown in glucose peptone medium to allow for a prolonged period of incubation in presence of oxygen certain organisms developed a red fluorescent color. While the exact nature of the color was not known in the early days, this technique was suggested to differentiate between the bacterial strains that produced it and ones that didn't. in 1906 Arthur Harden analyzed the fermentation products of Enterobacter aerogenes. He discovered that when it was surrounded by glucose, the organism made two compounds, acetoin as well as 2,3-butanedio.
Volumetric Pipette - Principle, Parts, Procedure, Applications
Volumetric pipette is a slender laboratory glass or plastic pipette used to measure and transfer one fixed volume of liquid with high accuracy. It is also called bulb pipette or belly pipette. It is mainly used when an exact volume is required in analytical works. It has a long narrow tube with an expanded bulb ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Volvox - Definition, Characterisitcs, Structure, Reproduction
What Is Volvox? Definition of Volvox Volvox is a polyphyletic genus of chlorophyte green algae that forms spherical colonies composed of thousands of cells and inhabits various freshwater environments. Discovery of Volvox: Unveiling a Microscopic Marvel The origins of Volvox, a captivating microorganism, are steeped in mystery, intertwining with the annals of scientific exploration. Over ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Volvox Under Microscope
What are Volvox? The taxonomic genus Volvox, a member of the family Vovlocacae, constitutes a distinctive assemblage of green algae that manifests itself as a singular spherical colony composed of a remarkable aggregation of over 50,000 cells. The ubiquity of Volvox within freshwater ecosystems, encompassing diverse habitats such as ponds, puddles, and ditches, accentuates its ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Vortex Mixer - Definition, Principle, Parts, Uses
Definition of Vortex Mixer A vortex mixer is a laboratory device that uses rapid circular oscillations to create a swirling motion, or vortex, in small volumes of liquid samples for efficient mixing and blending. Principle of Vortex Mixer Parts of Vortex Mixer Operating Procedure of Vortex Mixer To operate a vortex mixer, follow these steps: ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
VRBA(Violet Red Bile Agar) - Composition, Principle, Preparation, Results, Uses
Coliforms are all facultative and aerobic rod-shaped, gram-negative, non-spore-forming bacteria that produce lactose by fermentation with gas and acid production within 48 hours, at temperatures of 35 degrees Celsius. Methods to identify, enumerate and presumedly identify coliforms are utilized in the testing of dairy and food products. One method of performing the presumptive test to identify coliforms employs the Violet Red Bile Agar (VRBA). The Violet Red Bile Aggar (VRBA) is an selec-tive medium that can be used to detect and quantify lactose-fermenting coliform microorganisms.
Waste Source, Definition, Types, Impacts
What is waste? Types of Waste Based on its physical properties On the basis of their physical features, trash can be classified as solid waste (such as garbage), liquid waste (such as wastewater), and gaseous waste. Based on pattern of use Based on the pattern of use, it can be classified into Based on source ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Water bath - Principle, Types, Parts, Operating Procedure, Uses
Laboratory Water Bath is a temperature controlled laboratory instrument that is used to heat and incubate samples at constant temperature for long time. It consists of a container or reservoir filled with heated water. The water acts as a heat medium and gives uniform heating to the sample. It is mainly used when direct flame ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Water Distiller - Working Principle, Parts, Types, Uses
Water Distiller is a device which is used for purification of water by distillation process. It gives clean water by heating the water and then cooling the steam. It is based on evaporation and condensation of water. In water distiller, the raw water is taken in a boiling chamber. The water is heated until it ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Water Transport Mechanism In Plants
Water is indispensable for all forms of life, and its role in the plant kingdom is particularly crucial. The relationship between water and plants is prominently illustrated in lush environments where vegetation flourishes, contrasting sharply with arid regions that suffer from water scarcity. Among the various environmental factors influencing plant growth—light, temperature, soil, and water—it ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Watson and Crick DNA Model
In 1953, James Watson and Francis Crick made a groundbreaking contribution to the understanding of DNA structure. By combining physical and chemical data, they proposed a model for DNA as a double helix, a twisted molecule consisting of two complementary strands held together by hydrogen bonds. This model revolutionized our knowledge of genetics and unlocked ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Wave Bioreactor - Principle, Parts, Types, Uses
Wave Bioreactor is a single-use cultivation system that is used for growing cells in a sterile flexible plastic bag. It is also known as rocking bioreactor. In this bioreactor, the culture medium and cells are placed inside a partially filled disposable bag which is kept on a heated motorized platform. The platform moves back and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
West Nile Virus (WNV) - Structure, Genome, Replication, Pathogenesis, Treatment
West Nile virus (WNV) is the most prevalent disease transmitted by mosquitoes in the continental United States. It is often transmitted to humans through the bite of an infected mosquito. Cases of West Nile virus arise during the summer and fall mosquito season. There are no vaccinations or drugs to prevent or treat WNV in ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Western Blot - Steps, Principle, Result, Applications
In molecular biology Western blotting is a rapid and sensitive assay for detection and characterization of proteins. This technique exploits the inherent specificity of antigen-antibody interaction to identify specific antigens by polyclonal or monoclonal antibodies.
What are bacteria? - Structure, Metabolism, Size, Shape, Examples
What are bacteria? Definition of Bacteria Bacteria are microscopic, single-celled prokaryotic organisms lacking a nucleus and membrane-bound organelles, found in diverse environments, and essential for ecological processes, industrial applications, and human health. Origin and Early Evolution of Bacteria Bacteria represent some of the earliest life forms on Earth, with origins dating back approximately 4 billion ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
What are Immune Booster Foods?
In the wake of the COVID-19 outbreak this pandemic has raised questions regarding the effectiveness of the body's capability to fight off illnesses. Naturally the body fights diseases by activating its immune response that trigger a series of mechanisms within the body to remove the pathogen from the body.
What are Lichens? - Characteristics, Types, Structure, Reproduction
What is a Lichen? Habit and Habitat of Lichens General Characteristics of Lichens Types of Lichens Lichens, fascinating organisms formed by the symbiotic relationship between fungi and algae, display a variety of forms and structures. These types are primarily categorized based on their morphology and growth forms. Classification of Lichens based on different factors Lichens, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
What are Telomeres and Telomerases?
A ribonucleoprotein known as telomerase, terminal transferase adds a repeat sequence of telomeres to the 3′ end of chromosomes, the length of which varies depending on species. In most eukaryotic organisms, the chromosomal ends are capped by a repeating sequence known as a telomere. Telomeres prevent DNA damage and chromosomal fusion at the chromosome’s end. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
What are the Branches of zoology?
Zoology is the biological discipline devoted to the study of animals and the animal kingdom. Also referred to as animal biology. Zoology is the study of the connection between the animal kingdom and their environments, including taxonomy, habits, structure, embryology, distribution, evolution, and extinct species. Zoology is the branch of biology concerned with animal life. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
What are the Pathotypes of E. coli? - ETEC, EPEC, EHEC, EAEC, EIEC, DAEC
Escherichia coli, commonly referred to as E. coli, is a type of Gram-negative bacterium. It is facultative anaerobic, meaning it can survive in environments with or without oxygen, and has a rod-shaped morphology. E. coli is predominantly found in the lower intestine of warm-blooded organisms, including humans (endotherms). Human strains of E. coli can be ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
What are Toxigenic Algae And Algal Food Poisoning?
Toxins produced by some notable Algae Dinoflagellates Dinoflagellates produce potent neurotoxins, which affect nervous system of animals and humans, and are often implicated in shellfish poisoning. Brevetoxins are made by Karenia brevis and bind to voltage-gated sodium channels, causing neurotoxic shellfish poisoning (NSP). Saxitoxins (and related paralytic shellfish toxins, PSTs) are produced by Alexandrium and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
What is Algae? Characteristics, Structure, Classes, Reproduction, Importance
What is Algae? Characteristics of Algae Habitat of Algae The Habitat of algae is described as highly diverse, because algae are of universal occurrence and are found in water, land, snow, hot springs, inside plants/animals, and even in extreme saline or aerial conditions. The Aquatic algae are predominant in occurrence, and they are present in ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
What is bacteria? Types, Structure, Shapes, Morphology, Nutrition, Growth, Habitat, Reproduction, Examples.
What is bacteria? Bacteria is an essential part of the environment. They are considered as the first life forms to appear on Earth. Biologists estimated that the first forms of life appeared on Earth about 4 billion years ago, which was a unicellular microorganism, the modern name is bacteria. It is estimated that one gram ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
What is Continuing Evolution? - AP Biology Notes
What is Continuing Evolution? Evolution as an Ongoing Process Evolution is a continuous phenomenon, where populations of organisms undergo various changes over time due to numerous biological processes. Understanding these processes is crucial for both students and educators, as they illustrate the dynamic nature of life on Earth. Below are key components that highlight the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
What is Developmental Biology?
What is Developmental Biology? Developmental biology is a branch of biology that studies the processes and mechanisms by which multicellular organisms grow, develop, and reach their final form from a single fertilized egg or embryo. It examines how cells differentiate and specialize to form different tissues and organs, as well as how these structures are ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
What is Dihybrid Cross? Examples, Steps, Importance
A dihybrid crossing is a gene-cross between people who have homozygous or heterozygous genotypes that have two distinct characteristics or traits. Dihybrid crosses differ from the monohybrid crossing that only involves one genetic character or characteristic.
What is DNA Data Bank of Japan (DDBJ)?
The DNA Data Bank of Japan (DDBJ) is a pivotal resource in the realm of genomics and bioinformatics, playing a crucial role in advancing scientific research and collaboration. Established in 1987, DDBJ was created to support the growing need for accessible, comprehensive genomic data. Its mission is to collect, maintain, and disseminate DNA sequence data, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
What is DNA Replication? - Steps, Enzymes, Mechanism, Applications
What is DNA Replication? Definition of DNA Replication DNA replication is the biological process by which a cell duplicates its DNA molecule, producing two identical copies from one original DNA strand, ensuring the transmission of genetic information during cell division. DNA Replication Enzymes and Proteins DNA replication is a fundamental biological process, relying on various ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
What is EMBL Nucleotide Sequence Database (EMBL-Bank)?
The EMBL Nucleotide Sequence Database, commonly referred to as EMBL-Bank, is a pivotal resource in the realm of molecular biology. As an extensive repository of nucleotide sequences, EMBL-Bank plays a crucial role in biological research by providing a comprehensive and up-to-date collection of DNA sequences from a diverse range of organisms. This database is invaluable ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
What is Entropy?
Entropy is among the most important concepts that students should be able to comprehend clearly when learning Chemistry as well as Physics. In addition, entropy may be described in a variety of ways, which means it can be used in a variety of stages or scenarios, like the thermodynamics stage, in cosmic cosmology, or even ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
What is Ergonomic Pipetting?
What is Ergonomic Pipetting? Ergonomic pipetting is the design and use of laboratory pipettes in a way that reduces the risk of injury or strain to the hands and wrists of the user. Pipetting is a repetitive task that, if not done properly, can lead to discomfort and even injury over time. Ergonomic pipetting involves ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
What is Gene Expression? - Definition, Stages, Importance
What is gene expression? Gene expression definition Gene expression is the process by which the genetic information encoded in a gene is used to produce a functional product, typically a protein or a specific RNA molecule. Stages in Gene Expression 1. Transcription 2. Translation What is gene expression profiling? Methods or Steps of gene expression ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
What is Genomics?
A revolutionary discipline has emerged in the ever-evolving field of biology, promising to reveal the mysteries of life itself. Genomics, the study of an organism’s entire DNA sequence, contains the key to understanding the complex genetic code that shapes and regulates all living things. Genomics has transcended the boundaries of traditional biology, providing profound insights ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
What is Induced Fit Model? - Mechanism, Advantages, Limitations
What is Induced Fit Model? Evidences Supporting Induced Fit Model The Induced Fit Model has garnered significant attention in the realm of biochemistry, and various pieces of evidence support its validity. This model posits that proteins, including enzymes, are not static or rigid structures. Instead, they exhibit dynamic properties, allowing them to adapt and change ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
What is Lock and Key Model? - Mechanism, Advantages, Limitations
What is Lock and Key Model? The Lock and Key Model Concept The “Lock and Key Model” is a fundamental concept in enzymology, introduced by Emil Fischer in 1899. This model provides an analogy to explain the specificity exhibited by enzymes during their interactions with substrates. In this analogy, the enzyme is likened to a ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
What is Non-Mendelian Inheritance?
What is Non-Mendelian Inheritance? Types of Non-Mendelian Inheritance Non-Mendelian inheritance patterns reveal a range of genetic mechanisms that extend beyond Mendel’s classical laws of inheritance. These patterns involve complex interactions between genes and their expression. The following are key types of non-Mendelian inheritance:
What is Phycology?
In some places, phycology is also called algology. It is the study of algae, which are part of the plant kingdom.
What is Phytogeography? - Principle, Branches, Importance
What is Phytogeography? What is the Meaning of Phytogeography? Phytogeography, combining the Greek words for “plant” (phytón) and “geography” (geographía), refers to the study of the geographic distribution of plant species. This field investigates where plants are found across the earth’s surface and examines the environmental and ecological factors influencing their distribution. Phytogeography encompasses all ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
What is Plant Taxonomy? - Identification, Classification and Nomenclature
What is Plant Taxonomy? Plant taxonomy is the scientific discipline dedicated to finding, identifying, describing, classifying, and naming plants. Known also as systematic botany, it plays a crucial role in organizing the vast diversity of plant life on Earth. This field, a branch of biology, focuses on the similarities and differences among species to facilitate ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
What is Plant Water Relation?
What are Plant-water Relations? Importance of water to plants Properties of Water Property Value and Units Cohesive Strength >25 MPa Surface Tension 0.073 N m⁻¹ at 20°C Viscosity 0.0018 Pa s at 0°C 0.0010 Pa s at 20°C Diffusion Coefficient of Small Solutes ∼1×10⁻⁹ m² s⁻¹ Molar Volume (Pure Water at 20°C) 1.81×10⁻⁵ m³ mol⁻¹ ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
What is Protein Information Resource (PIR) Database?
Proteins are fundamental to virtually all biological processes, serving as the building blocks of cells, enzymes catalyzing biochemical reactions, and key regulators of cellular functions. Understanding protein structures, functions, and interactions is essential for advancing biological research, drug development, and medical diagnostics. The sheer complexity and diversity of proteins, however, pose significant challenges for researchers ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
What is Semiconductor Sequencing? - Principle, procedure, uses
What is Semiconductor Sequencing? Semiconductor sequencing is the integration of microchip technology with DNA sequencing where electrical signals replace the detection of light. This sequencing method is unique because it uses complementary metal-oxide semiconductor chips associated with sequencing by synthesis chemistry; so, in this respect, it opens up opportunities to make DNA analysis quicker and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
What is the Difference Between Basidiomycetes and Deuteromycetes
What is Basidiomycetes? Basidiomycetes, belonging to the Basidiomycota division, represent a significant group within the fungi kingdom. Characterized by their unique reproductive structures, basidiomycetes are commonly known as club fungi, a name derived from the club-like shape of their spore-bearing cells, the basidia. These basidia are the defining feature of basidiomycetes, typically found on the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
What is the Difference Between Cloaca and Anus?
What is Cloaca? Characteristics Features of Cloaca The cloaca is a multifunctional anatomical feature present in various vertebrate animals, characterized by several distinct characteristics: What is Anus? Characteristics Features of Anus The cloaca is a distinctive anatomical structure found in various vertebrate species, encompassing several key characteristics: Difference Between Cloaca and Anus The cloaca and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
What is the Difference Between Ebola and Zika
What is Ebola ? Ebola is a virus that causes a severe and often fatal disease in humans and nonhuman primates (such as monkeys, gorillas, and chimpanzees). The virus is named after the Ebola River in the Democratic Republic of Congo (formerly Zaire), where it was first identified in 1976. Ebola is a viral hemorrhagic ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
What is the Difference Between Holobasidium and Phragmobasidium?
What is Holobasidium? What is Basidium? What is Phragmobasidium? Difference Between Holobasidium and Phragmobasidium Holobasidium and Phragmobasidium are two distinct types of basidia, which are reproductive structures found in fungi belonging to the division Basidiomycota. These structures play a crucial role in the life cycle of these fungi, particularly in spore production and dispersal. Understanding ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
What is the Difference Between Neisseria Gonorrhoeae and Neisseria Meningitidis
What is Neisseria Gonorrhoeae? Neisseria gonorrhoeae is a bacterium that can cause the sexually transmitted infection (STI) called gonorrhea. It is transmitted through sexual contact and can infect the genital tract, anus, and throat. Symptoms of gonorrhea can include painful urination, discharge from the genitals, and painful or swollen testicles in men, and abnormal vaginal ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
What is the Difference between YAC and BAC Vectors?
When it comes to molecular cloning and genetic engineering, vectors play a crucial role. These vectors act as carriers, transporting foreign genetic material into host cells, allowing for replication and expression. In this article, we will explore the different types of vectors, such as plasmids, viral vectors, cosmids, and artificial chromosomes, and their various applications. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
What is the Importance of Microbiology in Nursing?
Microbiology in nursing is the scientific study of microscopic organisms such as bacteria, virus, fungi and protozoa that impact human health in clinical and community care. it deals with how these microbes grow, spread, and survive, also how nurses can prevent or control infections. this knowledge is used daily in patient care, wound dressing, vaccination ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
What is Viral Immunology?
Viruses are extremely immunegenic and cause two kinds of immune responses: the humoral and the cellular.
The range of specificities of B and T cells is derived from changes in the somatic genome and rearrangements.
T B cells and T typically recognise the exact epitopes within the exact virus. B cells recognize the free proteins unaltered in their original 3-D configuration while T cells typically view Ag in a denatured form. Ag in a denatured state together in conjunction with MHC molecules.
The features of an immune reaction for the exact virus can be different for different individuals based on their genetic makeup.
It is responsible for preventing infection by this virus (neutralization).
The IgG and IgM class are particularly relevant. IgM as well as the IgG class are especially important to protect against viral infections, which are often accompanied by viraemia. The antibodies from IgA class are particularly relevant for defense against viraemia. IgA class are essential for infections contracted through the mucosa. (the nose and the intestinal tract)
However, the immune system kills the infected cells that express viruses' proteins onto their surface including glycoproteins that envelope viruses have and occasionally the essential proteins of these viruses.
What is Visceral Arches?
What is Visceral Arches? Evolution of Visceral Arches Cyclostomes Elasmobranchs Bony fishes Amphibia Reptiles Birds Mammals Mammals, a diverse group of warm-blooded vertebrates, exhibit specific modifications in their skull, ear ossicles, and laryngeal structures that are distinct from other vertebrate groups. In mammals, the pterygoquadrate bone breaks into two parts: the alisphenoid, which becomes part ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
What's the difference between liverworts and hornworts?
What is Hepaticopsida (Liver Worts)? Hepaticopsida, commonly known as liverworts, are a class of bryophytes characterized by their liver-shaped thallus, which is a simple plant body. This group of plants possesses unique structural and reproductive features that distinguish them from other bryophytes. Plant Body Structure Sporophyte Dependence Reproductive Structures Examples of Liverworts What is Hepaticopsida ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Wheat - Morphology, Types, Grades, Harvesting, Products
What are Cereals? Cereals are among the most vital sources of plant-based food for humans and animals. They have held this significance since ancient times, with their cultivation dating back so far that their wild ancestors are no longer recognizable. Over centuries, numerous species and varieties have been developed, even before recorded history. The ancient ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Wheatley Trichrome Staining - Principle, Procedure, Uses
Wheatley Trichrome Staining is the permanent staining method used in parasitology for detecting intestinal protozoans from stool samples, and it is mainly applied when cysts and trophozoites is to be identified in a fixed smear. It is the process in which three dyes are used so that the parasite structures get a clear differential colour ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Which Factors affects Immunogenicity? - Factors affecting Immunogenicity
What is Immunogenicity? A. Properties of Immunogen 1. Foreignness 2. Molecular Size 3. Chemical Nature and Heterogeneity 4. Physical form 5. Susceptibility to antigen processing and presentation B. Biological System of Host FAQ
White Blood Cell (Leukocytes) - Definition, Types, Structure, Functions
What is White Blood Cell (Leukocytes)? Dfinition of White Blood Cell (Leukocytes) White blood cells, or leukocytes, are immune system cells responsible for defending the body against infections, pathogens, and foreign invaders. They originate from the bone marrow and can be categorized into various subtypes based on their functions and characteristics. Formation of White Blood ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Whittaker's Five Kingdom Classification - Criteria, Advantages and Limitations
Whittaker’s Five Kingdom Classification brings evolutionary changes in classification system of organisms. Since the centuries, biologists are trying to classify organisms in different ways. Even, Greek philosopher and polymath Aristotle tried to classify organisms on the basis of their habitats, such as whether they lived on land, water, or air. Then Carolus Linnaeus proposed a ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Whole Genome Sequencing - Principle, Types, Steps, Applications
What is Whole Genome Sequencing? Principle of Whole Genome Sequencing The principle of whole genome sequencing (WGS) revolves around the complete sequencing of an organism’s DNA, encompassing both coding and non-coding regions. This method provides a thorough understanding of the genome, detailing the genes, regulatory elements, and variations present. WGS begins with the extraction of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Widal Test - Principle, Procedure, Result, Advantages, Limitation
The Widal test is an agglutination test that determines any antibodies present in the patient's serum that are generated against the causal agents of the enteric febrile illness (Salmonella Typhi, and Salmonella paratyphi B, A as well as C).
Wine Production
Types of Wine Depending on the type of grape, yeast strain, fermentation process, etc., there are a variety of wines. There are so many differences amongst them that it becomes impossible to classify them accurately. However, the following are notable wine varieties: 1. Red wines 2. Dry wines 3. Sweet wines 4. Sparkling wines 5. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Wood - Axial and Ray parenchyma, Annual ring, Ring porous, Tylosis, Sapwood and Heartwood, Reaction wood
Wood, or secondary xylem, is a complex tissue derived from the vascular cambium, primarily found in the stems and roots of both gymnosperm and angiosperm-dicotyledonous plants. The study of wood through microscopic observation is termed xylotomy. This narrative explores the intricate structure and classification of wood, detailing its components and their functions. Ray parenchyma Ray ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Working Distance - Definition, Measurement, Types, Importance
What is Working Distance? Working distance is defined as the distance that is maintained between the “objective lens” and the specimen, during focusing; it is measured along the optical axis of the microscope. It is considered critical, because it determines the space available for manipulating the specimen, adding reagents, or using tools; a short working ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Wright Giemsa Stain - Protocol, Principle, Result
This stain was discovered by German chemist Gustav Giemsa, that’s why its called Wright Giemsa Stain.
Wuchereria bancrofti - Morphology, Life Cycle, Epidemiology, Pathogenicity, Diagnosis, Prophylaxis and Treatment
Lymphatic filariasis is a parasitic disease caused by three microscopic, thread-like worms, called Wuchereria bancrofti, Brugia malayi and Brugia timori. These worms infect the lymphatic system and cause Lymphatic filariasis. The adult worm can be found in the human lymph system, this system helps to maintain the body’s fluid balance and fights against infections.
X and V factor Test - Principle, Purpose, Procedure, Result
Some bacteria make substances that other bacteria need to grow. The X factor and the V factor are two such substances. The heat-stable X-factor can be protoporphyrin IX, hemin, or other iron-containing porphyrins. It can be found in red blood cells and outside of them in the blood. The heat-sensitive V-factor may be nicotinamide adenine dinucleotide (NAD) or nicotinamide adenine dinucleotide phosphate (NADP), and it is mostly found inside red blood cells. The X and V factor test or a disc test can be used to find out if a bacterium depends on its X factor or its V factor. The results can help identify the bacteria.
X-Ray Crystallography - Principle, Parts, Applications
X-Ray Crystallography is an experimental technique used to know the three dimensional arrangement of atoms and molecules inside a crystal. It is used for studying the exact position of atoms. It also shows the chemical bonds and the total molecular structure present in the crystal. In this method, a focused beam of X-rays is passed ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
X-Ray Spectroscopy - Principle, Instrumentation, Steps and Applications
X-Ray Spectroscopy is a technique used for study of interaction between X-rays and matter. It is mainly used for determination of elemental composition and chemical state of a sample. It also gives information about physical properties of materials. It is based on emission and absorption of X-rays by atoms. When a material is excited by ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Xanthophyta - General characteristics, thallus organization, Occurrence, morphology and life-cycle of Vaucheria.
What is Xanthophyta? Characteristics of Xanthophyceae Xanthophyceae, commonly known as yellow-green algae, is a diverse group that primarily inhabits freshwater environments, although some species can be found in marine and terrestrial habitats. This group exhibits a variety of morphological and physiological characteristics that distinguish it from other algal divisions. Below is a structured overview of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Xanthoproteic test - Principle, Procedure, Result, Application
Proteins are polymers of amino acids. They are complex organic compounds containing nitrogen, hydrogen, carbon and oxygen. Proteins are abundant in our everyday food e.g. egg, soya bean, pulses, fish, milk etc. The presence of proteins can be confirmed qualitatively by usign several tests, Xanthoproteic test is one of them. Due to the presence of characteristic side chains in them, certain amino acids exhibit typical color reactions that form the basis for their identification.
Xenopsylla cheopis - Morphology, Life cycle, Control
What is xenopsylla cheopis? Classification of xenopsylla cheopis Scientific Name: Xenopsylla cheopis (Rothschild, 1903) Kingdom: Animalia Phylum: Arthropoda Class: Insecta Order: Siphonaptera Family: Pulicidae Genus: Xenopsylla Habitat of xenopsylla cheopis Xenopsylla cheopis, commonly known as the Oriental rat flea, primarily inhabits tropical and subtropical environments, although it can also be found in temperate regions. This flea ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Xylem Parenchyma - Definition, Structure, Types, Functions
What is Xylem Parenchyma? Plant Tissues Plant tissues can be categorized based on their structure and the functions they perform. Understanding the classification of plant tissues is fundamental for students and educators in botany and plant biology. The two primary categories of plant tissues are meristematic tissues and permanent tissues. Xylem Xylem, derived from the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Xylose Lysine Deoxycholate (XLD) Agar - Composition, Preparation, Principle, Uses
Xylose Lysine Deoxycholate agar (XLD) is a selective medium that allows for the isolation and growth of Salmonella and Shigella species using clinical samples or food. Taylor developed XLD Agar to aid in the differentiation, isolation and identification of enteric disease agents and support the growth more specialized enteric organisms. XLD Agar is a well-proven medium that allows the growth of Shigella species. It is also an excellent medium to isolate Salmonella species. It has a pH value of 7.4, giving it a bright pink to red color due to the indicator phenol.
Yeast - Structure, Reproduction, Life Cycle and Uses
What is Yeast? Definition of Yeast Cell A yeast cell is a single-celled, eukaryotic microorganism belonging to the fungus kingdom, characterized by its ability to ferment sugars into alcohol and carbon dioxide. It is widely used in baking, brewing, and biotechnological industries. Yeast cells vary in size and shape, reproduce mainly asexually through budding, and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Yeast Artificial Chromosomes (YACs) - Definition, Structure, Construction, Uses
What is Yeast Artificial Chromosomes (YACs)? Yeast artificial chromosomes (YACs) are the result of a recombinant DNA cloning technique used to isolate and propagate extremely large DNA segments in a yeast host. The YAC cloning system enables the replication of exogenous DNA segments as linear molecules on a significantly larger scale than is possible with ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Yeast Under the Microscope
What is Yeast? Yeast are tiny, single-celled fungi that play a crucial role in creating everyday delights like bread, beer, and wine through a process called fermentation. These minuscule organisms have an impressive ability to multiply and adapt, making them essential for various culinary and scientific applications. These unicellular organisms, belonging to the Fungus Kingdom, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Yeasts Starter Cultures
Yeasts are eukaryotic, unicellular microorganisms that belong to the kingdom of fungi. The first yeast appeared hundreds of millions of years ago, and there are approximately 1,500 known kinds. Yeasts are unicellular organisms that developed from multicellular predecessors, with certain species able to acquire multicellular traits by generating pseudohyphae, which are strings of connected budding ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
YEPD Agar - Composition, Principle, Preparation, Results, Uses
Yeasts, unicellular eukaryotes, are a well-studied model organism in molecular genomics. They are chemoorganotrophs because they use organic compounds for energy. Yeast extract peptone, or YEPD), Growth Agar is used to maintain and propagate yeasts. YPD is a complete medium that allows for yeast growth.
Yersinia enterocolitica Food Poisoning - Yersiniosis
What is Yersinia enterocolitica? Characteristics of Yersinia enterocolitica Yersinia enterocolitica possesses several characteristic features: These characteristics collectively contribute to the identification and classification of Y. enterocolitica within the Yersinia genus and aid in understanding its behavior and survival in various environments. Contamination Source of Yersinia enterocolitica Food Poisoning Signs and Symptoms Yersinia enterocolitica Food Poisoning Pathogenic Mechanism Yersinia enterocolitica ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Yersinia Pestis - Definition, Structure, Genome, Transmission, Pathogenesis, Treatment
What is Yersinia Pestis? Yersinia Pestis Definition Yersinia pestis is a gram-negative coccobacillus bacterium responsible for causing the disease known as the plague, historically linked to significant pandemics such as the Black Death. This facultative anaerobic organism is an obligate parasite, primarily transmitted to humans through the bite of infected fleas. General characteristics of Yersinia ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Yersinia Selective Agar - Composition, Principle, Preparation, Results, Uses
Schiemann first described Yersinia selective agar as an alternative to MacConkey agar and other media commonly used for isolating Yersinia Enterocolitica, a causative organism of gastroenteritis. Yersinia Enterocolitica, a major food- or waterborne enteric pathogen, has been reported to cause epizootic outbreaks in animals such as diarrhea, lymphadenopathy and pneumonia. Yersinia Selective Agar, a selective and differentiated medium that supports the growth of Y. Enterocolitica and other Yersinia spp.
Ziehl-Neelsen Staining (ZN Staining) - Principle and Procedure, Result
Ziehl Neelsen stinging method is used to differentiate between the acid-fast and non-acid fast bacteria.
Zika Virus (ZIKV) - Definition, Structure, Genome, Replication, Transmission
Zika Virus (ZIKV) Characteristics of Zika Virus (ZIKV) Structure of Zika Virus Genome Structure of Zika Virus Zika Virus Replication Viruses cannot replicate until they infect and “reprogram” appropriate host cells to become virus-producing factories. The epidermis and dermis of the host skin contain fibroblast, keratinocytes, and immature dendritic cells where the Zika virus replicates. In ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Zonation - Definition, Types, Importance, Example
What is Zonation? Definition of Zonation Zonation is the spatial arrangement of distinct ecological communities based on predominant flora and fauna across a gradient, influenced by both biotic and abiotic factors. How Does Zonation Works? Zonation in ecological contexts refers to the distinct stratification or partitioning of habitats or ecosystems into zones, each characterized by ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Zoogeographical Realms - Definition, Meaning and Types
What is Zoogeographical Realms? Types of Zoogeographical Realms 1. Palaearctic Realm 2. Nearctic Realm 3. Neo-tropical Realm 4. Ethiopian Realm 5. Oriental Realm 6. Australian Realm FAQ
Zoogeography - Plate tectonic and Continental drift theory
Continental Drift Theory Different Stages of Continental Drift Theory Different Forces Responsible for Continental Drift Note: It is important to mention that these factors were later found to be insufficient to fully explain continent drifting, which led to criticism of Wegener’s theory. Evidence Supporting Continental Drift Theory Evidence Supporting Continental Drift Theory: Criticisms of Continental ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Zoogeography - Realms, Theories pertaining to distribution of animals
What is Zoogeography? What is Zoogeographical realms? Zoogeographical realms, also known as biogeographical realms or ecozones, are large geographic regions characterized by distinctive combinations of animal species. These realms are defined based on similarities in the composition and distribution of animal taxa within their boundaries. Here are the main zoogeographical realms recognized by biogeographers: These ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Zooplankton - Definition, Characteristics, Types, Importance
What is Zooplankton? What exactly are Zooplanktons? Zooplankton, a subset of the broader planktonic community, are heterotrophic organisms that inhabit both freshwater and marine environments. The term “plankton” encompasses a diverse array of organisms that float or drift within aquatic realms. Among these, zooplankton are distinguished by their heterotrophic nature, signifying their reliance on external ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Zwitterion - Definition, Structure, Examples
What is Zwitterion? Zwitterion Definition A zwitterion is a molecule that contains both positively and negatively charged functional groups, resulting in an overall neutral charge. Properties of Zwitterion Zwitterions exhibit several distinct properties due to their unique structure and combination of positively and negatively charged ions. Here are some key properties of zwitterions: Zwitterion Structure ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Zygomycosis (Mucormycosis) - Causative Agent, Symptoms, Prevention, Treatment
Causative Agent Habitat Transmission Risk factors Types of mucormycosis (Zygomycosis) Symptoms of Zygomycosis (Mucormycosis) The symptoms of mucormycosis vary on where the fungus is growing in the body. 1,4 Contact your healthcare practitioner if you believe you have mucormycosis-related symptoms. The following are symptoms of rhinocerebral (sinus and brain) mucormycosis: The following are symptoms of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>
Zygomycota Overview
Zygomycota or zygote Zygomycota, also known as zygote is a previous division or phylum belonging to the kingdom of Fungi.
Zygote - Definition, Formation, Development, Example
What is a Zygote? A zygote is a crucial concept in biology, representing the very first stage of a new organism’s development following the fertilization event. The term “zygote” (pronounced /ˈzaɪˌɡoʊt/) originates from the Ancient Greek word ζυγωτός (zygōtós), meaning ‘joined’ or ‘yoked,’ derived from ζυγοῦν (zygoun), which means ‘to join’ or ‘to yoke’. This ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>