All Biology Study Notes

Under the lens of a microscope lies a world of wonder, and one of the fascinating creatures to observe is the humble worm. These ancient beings have been roaming the earth for hundreds of millions of years, evolving into the diverse forms we see today. In 2018, an article published in National Geographic unveiled the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Microbiology Terms Starting With A Microbiology Terms Starting With B Microbiology Terms Starting With C Microbiology Terms Starting With D Microbiology Terms Starting With E Microbiology Terms Starting With F Microbiology Terms Starting With G Microbiology Terms Starting With H Microbiology Terms Starting With I Microbiology Terms Starting With J Microbiology Terms Starting With K ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Botany Terms Starting With A Botany Terms Starting With B Botany Terms Starting With C Botany Terms Starting With D Botany Terms Starting With E Botany Terms Starting With F Botany Terms Starting With G Botany Terms Starting With H Botany Terms Starting With I Botany Terms Starting With J Botany Terms Starting With K ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Zoology Terms Starting With A Zoology Terms Starting With B Zoology Terms Starting With C Zoology Terms Starting With D Zoology Terms Starting With E Zoology Terms Starting With F Zoology Terms Starting With G Zoology Terms Starting With H Zoology Terms Starting With I Zoology Terms Starting With J Zoology Terms Starting With K ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Abiotic Factors? Definition of Abiotic Factors Abiotic factors refer to the non-living physical and chemical elements in an ecosystem that influence and shape the conditions within which living organisms thrive and interact. Types of Abiotic Factors Here is the list of abiotic factors: Abiotic Factor Description Air A mixture of gases essential for ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Plant Stress? Acclimation and Adaptation Acclimation and adaptation are fundamental concepts in plant biology that describe how individual plants and entire populations respond to environmental stressors. These responses play crucial roles in enhancing survival and reproduction, allowing plants to thrive in challenging conditions. Environmental Factors and Their Associates Biological Impacts on Plants Environmental ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Water absorption is a critical physiological process in plants, essential for their growth and various metabolic activities. In lower plants, such as algae and mosses, water absorption occurs across the entire plant surface through the process of osmosis. However, in higher plants, this function is specialized and occurs primarily through the root hairs. The primary ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Test Name Acetamide utilization Test Purpose Differentiate microorganisms according to their capacity to utilise acetamide as their only carbon source. Microorganisms Tested Isolated colonies of Gram-negative, non-glucose-fermenting rods that emit a luminous pigment and are suggestive of P. aeruginosa. Result Positive: The slant shows growth, and its colour changes from green to intense blue.Negative: There ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Test Name Acetate Utilization Test Detection Differentiate species based on ability to utilise acetate as the sole source of carbon. Typically used to distinguish Shigella spp. from Escherichia coli. Test organism It is best to use an acetate utilisation test to tell Shigella spp. from Escherichia coli. Test isolates are Gram-negative rods that don’t ferment ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Acetic Acid? Properties of  Acetic acid-CH3COOH CH3COOH Acetic Acid Molecular weight/molar mass of CH3COOH 60.052 g/mol Density of Acetamide 1.05 g/cm³ Boiling Point of Acetamide 118 °C Melting Point of Acetamide 16.6 °C Structure of Acetic acid Ethanoic acid is the second-simplest carboxylic acid structurally (the simplest being formic acid, HCOOH), and is ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Acid Fast Stain? Objective of Acid Fast Stain Principle of Acid Fast Stain The principle of the Acid Fast Stain revolves around the unique characteristics of certain bacterial cells, particularly their resistance to conventional staining methods due to the presence of mycolic acid in their outer membrane. This expository explanation aims to elucidate ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Acridine Orange contains metachromatic properties, that’s why it is employed in fluorescence microscopy and flow cytometry study of cellular physiology and cell cycle state, including the fluorescent microscopic examination of microorganisms.

What are Actinomycetes? Actinomycetes are a diverse group of Gram-positive, catalase-positive, nonmotile bacilli that exhibit characteristics bridging bacteria and fungi. Structurally, they resemble bacteria due to their cell walls containing muramic acid and prokaryotic nuclei, making them susceptible to antibiotics. However, their filamentous growth pattern, forming structures known as hyphae, is reminiscent of fungi. These ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Action Potential? Definition of action potential An action potential is defined as a rapid, transient change in the electrical membrane potential of a neuron, characterized by a brief depolarization followed by repolarization. This process allows neurons to transmit signals over long distances. It occurs when the membrane potential reaches a critical threshold, leading ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Active Immunity? Definition of Active Immunity  Active immunity refers to the immunity that is acquired when the body’s own immune system produces antibodies in response to exposure to a foreign antigen, such as a pathogen or vaccine. It provides long-lasting protection against specific antigens. Characteristics of Active Immunity Active immunity possesses several key ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Active Immunization? Definition of Active Immunization Active immunization refers to the process of inducing immunity in an individual by administering a vaccine or exposing them to a specific pathogen, triggering an immune response and the development of lasting protection against future infections. Mechanism of Active Immunization Active immunization works by stimulating the immune ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Active Site of an Enzyme? Definition of Enzyme’s Active Site The active site of an enzyme is a small region within the enzyme where substrate molecules bind and undergo a chemical reaction, leading to the formation of products. What is Binding site? Features that Determine Active Site Specificity The specificity of the active ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Ever wondered how the cells in your body get the nutrients they need to function? It’s not like they have a mini grocery store to pop into whenever they run low on sugars or amino acids, right? Welcome to the fascinating world of Active Transport.  “Active Transport – the unsung hero of cellular operations, ensuring that ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Adaptation? Definition of Adaptation Adaptation is the process by which an organism adjusts to its environment through changes in behavior, physiology, or structure, enhancing its chances of survival and reproduction. Types of Adaptations Adaptations are the features and behaviors that help organisms survive in their environments. These adaptations can be physical, behavioral, or ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Colouration Colouration in fish is a prominent and diverse characteristic that plays a critical role in their survival and interaction within aquatic ecosystems. The variety of colours and patterns found among different species of fish is typically linked to their habitats, behaviors, and ecological roles. Understanding the mechanisms behind fish coloration not only provides insight ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Features Adaptive (Acquired) Immunity Types of acquired immunity An acquired immunity against a microorganism may be produced through the host’s response to the bacterium or by the transfer of particular antibodies or lymphocytes. There are two types of immunity: active and passive. 1. Active immunity Types of Active immunity There are two varieties of active ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Adaptations? Adaptations in hydrophytes Morphological Adaptations in Hydrophytes Hydrophytes, or aquatic plants, exhibit a wide range of morphological adaptations that allow them to thrive in water-rich environments. These adaptations vary depending on whether the plants are free-floating, submerged, or emergent. Below are the key structural adaptations of hydrophytes that aid in their survival: ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Because the body is complex, energy is required to ensure proper functioning. Adenosine triphosphate, or ATP, is the energy source for use and storage at cellular level. ATP’s structure is a nucleoside triophosphate. It consists of a ribose glucose, a nitrogenous base (adenine) and three serially bonded phosphate group. ATP is often referred to by ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Adrenal Gland? Definition of Adrenal Gland The adrenal glands, or suprarenal glands, are small, triangular-shaped endocrine glands located on top of each kidney. They consist of two main parts: the adrenal cortex, which produces steroid hormones such as cortisol and aldosterone, and the adrenal medulla, which produces catecholamines like adrenaline. These hormones play ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Afferent Neuron? What is Efferent Neuron? Similarities Between Afferent and Efferent Difference Between Afferent and Efferent – afferent vs efferent S.No Afferent Neuron Efferent Neuron 1. Afferent Neuron is a types of neurons that carry sensory impulses towards the central nervous system (CNS). Efferent Neuron is a types of neurons that carry motor ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

One of those methods you could find in biochemistry or biotech laboratories, particularly when someone has to separate a particular molecule from a complicated mixture, is affinity chromatography. Imagine attempting to locate a single buddy among throngs at a concert without a torch or means of communication. Working with proteins, enzymes, or antibodies in a ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Agarose gel electrophoresis (AGE) is an approach that is used to distinguish DNA from RNA based on their molecular sizes. The separation of RNA and DNA molecules is accomplished when nucleic acids that are negatively charged travel through an agarose structure under an influence of an electrical fields (electrophoresis).

What is Ageing? Different Types of Aging Aging is a complex process that can be categorized into different types based on various perspectives. Understanding these different types of aging can provide a comprehensive view of the aging process. Here are five common classifications: Overall, aging is a multifaceted process that encompasses various dimensions. By considering ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

In 1896, two bacteriologists, Herbert Edward Durham and Max von Gruber, independently discovered specific agglutination. In honour of the discoverers, this reaction was given the name GruberDurham reaction. Later, Gruber designated as “agglutinin” any chemical that induced an agglutination reaction (from the Latin). Fernand Widal (1862–1929) employed agglutination to diagnose typhoid disease in the same ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

In this article we will learn about Agglutination test definition, Types, Uses, Advantages, Disadvantages, Aim of Agglutination Test, Specimen collection, application of Agglutination test and finally Examples of Agglutination test. Agglutination Test Agglutination Test is a clinical assay used for the detection of Antibody or Antigen in body fluids such as saliva, urine, cerebrospinal fluid, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Agnatha are a primitive group of jawless fish that have existed for hundreds of millions of years. Creatures like lampreys and hagfish fall into this category. Unlike typical fish, they lack jaws, paired fins, and bony skeletons, relying on flexible cartilage for support. Lampreys often attach to other fish to feed on their bodily fluids, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Agrobacterium? Agrobacterium-mediated Gene Transfer Factors affecting Agrobacterium-mediated Gene Transfer Agrobacterium-mediated gene transfer is a widely used technique for introducing foreign DNA into plants. However, successful gene transfer depends on several factors, including: Why transform plants using Agrobacterium? Agrobacterium-mediated gene transfer is a preferred method for transforming plants for several reasons: Overall, Agrobacterium-mediated gene transfer is a ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Agrobacterium-Mediated Gene Transfer? Agrobacterium-mediated Gene Transfer Principle Agrobacterium-mediated gene transfer is a sophisticated process that enables the genetic modification of plants through the natural infection mechanisms of the bacterium Agrobacterium tumefaciens. The underlying principle of this transformation hinges on the transfer of a segment of DNA, referred to as T-DNA, from the bacterium ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Agrochemical? Types of Agrochemicals Agrochemicals play a significant role in modern agriculture and animal husbandry practices. Let’s explore the different types and uses of agrochemicals: While agrochemicals have contributed to increased crop yields and improved agricultural practices, their use can also have negative impacts on the environment and human health. Therefore, it is ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

An air displacement pipette (also known as a “volumetric pipette” or “mechanical pipette”) is a type of liquid handling tool commonly used in laboratory settings. It uses air displacement to draw a specific volume of liquid into the pipette’s barrel. The volume of liquid is determined by the calibrated volume markings on the barrel of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Air microbiology Indoor air microbiology  1. Aeromicrospora of Pharmacy 2. Aeromicroflora of Hospitals 3. Other Houses 4. Aeromicroflora of Storage Materials A number of important goods are held in houses, and staff members are assigned to protect them. However, aeromicroflora degrade these substances. Several instances are provided below: (i) Library (ii) Wall Paintings Outdoor air ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Different stains have been developed over time to distinguish bacteria species, separating them morphologically and the specific characteristics they possess. The most popular stain is Gram staining, acid-fast staining, and endospore staining. Each stain aims at identifying and defining bacteria according to their forms and morphologies.

What is Alcohol burner? Definition of Alcohol burner An alcohol burner is a small, portable laboratory device that uses denatured alcohol as fuel to produce a controlled flame for heating, sterilization, and experimental purposes. Working Principle of Alcohol burner Factors that affect the working principle of an alcohol burner Several factors can influence the working ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Alcohol fermentation, also known as ethanol fermentation, is a sophisticated biotechnological procedure wherein specific sugars, namely glucose, fructose, and sucrose, undergo a transformation into ethyl alcohol (ethanol) and carbon dioxide. This transformation is facilitated by certain microorganisms, predominantly the yeast species Saccharomyces cerevisiae, as well as specific bacterial strains. Central to the realm of biotechnology, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Algae Reproduction Overview Algae uses different types of reproduction methods such as; Different Modes of Algae Reproduction 1. Vegetative Methods The vegetative reproduction is accomplished by different methods such as; (i). Budding In this method, the vesicles are started to enlarged and then detach from the parent body and form a new thallus. Example: Protosiphon ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The Algae Bioreactor is a closed system that treats wastewater and produces biofuels using algae. The earliest commercial applications of algae bioreactors occurred in the 1960s for wastewater treatment. With the increasing global demand for alternative energy sources, the usage of algae bioreactors for biofuel production has risen to prominence in the 21st century. The ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Algae? Requirement for observation of Algae Under Microscope Algae Sample Collection Procedure Algae sample collection is a crucial step in studying these diverse organisms. To ensure a successful and accurate collection, follow this unique procedure: Tips: Safety Precautions: Storage: Processing: Identification: Following this comprehensive algae sample collection procedure ensures the acquisition of reliable ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Clinical materials containing small numbers of Vibrio should be inoculated into an enrichment medium prior to plating onto a selective medium, such as TCBS Agar (M189). Alkaline Peptone Water is a suitable enrichment broth for this purpose. 

Alkaline Phosphatase (ALP) is an enzyme that is naturally found within all the raw milks that is utilized to determine the quality of pasteurization of milk. A complete pasteurization process can deactivate the enzyme below levels that can be detected by traditional methods. Because the stability of the heat of ALP is higher than the stability of pathogens that could be found in milk, it serves as a metric of security. However, failure for detection of ALP activity is not a mean an item is safe from pathogens.

What is Allele? Definition of Allele An allele is a specific variant of a gene that occupies a particular position (locus) on a chromosome, and different alleles can result in variations of a trait. Each individual inherits two alleles for each gene, one from each parent. Features of Alleles Types of Alleles There are different ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Alternaria alternata is a fungus that causes leaf spots, rots, blights, and other plant maladies. It is an opportunistic pathogen that affects over 380 plant species. Additionally, it can cause upper respiratory tract infections and asthma in immunocompromised humans. Classification of Alternaria alternata Kingdom Fungi Phylum Ascomycota Class Euascomycetes Order Pleosporales Family Pleosporaceae Genus Alternaria Habitat ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Alternative pathway of the complement system ? Activators of the alternative pathway Activators of the alternative pathway of complement activation include  Steps of activation of alternative pathway Four serum proteins comprise the initial component of the alternative pathway: C3b, factor B, factor D, and properdin. 1. C3bB complex Formation 2. C3bB Cleavage 3. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Altitudinal Zonation? Definition of Altitudinal Zonation Altitudinal zonation refers to the stratification of ecosystems in mountainous regions due to varying environmental conditions at different elevations, leading to distinct habitats that support specific vegetation and animal species. Factors of Altitudinal zonation Altitudinal zonation in mountainous regions is shaped by a myriad of environmental determinants. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Altruism? Evolution of Altruism The evolution of altruism has been a subject of fascination for socio-biologists, as seemingly selfless behavior can be observed in various animals, including humans. Over the past two decades, researchers have put forth three explanations to shed light on the evolution of altruistic behavior. The first explanation revolves around ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Amensalism (Antagonism)? Amensalism is a sort of biological interaction in which one species harms another without incurring any costs or gaining any advantages. It is a form of interaction or competitive behaviour between organisms. Modes of Amensalism or Types of Amensalism 1. Competition Example 2. Antibiosis Example Examples of Amensalism In the Ocean, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Ames Test? Definition of Ames Test The Ames test is a biological assay developed by Bruce Ames, used to assess the mutagenic potential of chemical compounds by observing their ability to induce mutations in specific strains of bacteria, primarily Salmonella typhimurium. A positive result indicates that the chemical may be mutagenic and potentially ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Amies Transport Medium, which contains charcoal to increase the viability and longevity of pathogenic organisms, is an improved transport medium. It is semisolid media that can be used in qualitative procedures to transport clinical swab specimens from the hospital to the laboratory. This modified Stuart's Transport Medium is made by adding charcoal to the medium and replacing the glycerophosphate. This modified medium produced a higher percentage positive results than Stuart's transport medium.

What is Amino Acid Formula? Amino Acid Formula Structure Amino acids are essential building blocks of proteins, and understanding their molecular structure is crucial in comprehending the functioning of biological systems. The amino acid formula and structure provide valuable insights into the composition and properties of these fundamental units. The molecular formula of an amino ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Amino Acids? Definition of Amino Acids Amino acids are organic compounds that serve as the building blocks of proteins. They consist of carbon, hydrogen, and nitrogen atoms and play essential roles in the proper functioning of living organisms. List of 20 Amino acids with the chemical formula Alanine C3H7NO2 Leucine C6H13NO2 Aspartic Acid ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Codon? Molecular biologists define a codon as three nucleotides of DNA or RNA. Such is said to code for some particular amino acid, but it may also work as a signal in the course of regulation during the synthesis of protein. In brief, life proceeds generation after generation due to complex steps that ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Amniocentesis? (Amniotic Fluid Test) Sample for Amniotic fluid Examination (Amniocentesis) The purpose of the test Amniocentesis, the examination of amniotic fluid, serves various purposes in prenatal diagnosis and assessment. The test provides valuable information about the fetus, allowing healthcare providers to make informed decisions regarding the health and well-being of both the mother ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

In this article, we will learn about the Habitat, structure, nutrition, characteristics, reproduction, locomotion of the Amoeba cell with diagram. Domain Eukaryota Phylum Amoebozoa Class Tubulinea Order Euamoebida Family Amoebidae Genus Amoeba Amoeba cell also known as the ameba or amoeboid. Amoeba is a unicellular eukaryotic organism which can alter their shape by extending and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Amoeba (less often spelled ameba, or amoeba, plural am(o)ebas or am(o)ebae) is often referred to as an amoeboid, is kind of unicellular organism that has the capability of changing its form, mostly by retracting and expanding pseudopods. Amoebae do not belong to a single taxonomic class, They are found in all major lineages of the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Amoeba? Amoeba of Structure Amoebas, as eukaryotic organisms, possess a cellular structure that sets them apart in the microscopic world. Under the microscope, the architectural marvels of these single-celled wonders come to life, particularly when observed after staining. Their eukaryotic nature is characterized by a well-defined cell membrane encompassing their cytoplasm, housing the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Entamoeba Histolytica? Definition of Entamoeba Histolytica Entamoeba histolytica is a single-celled, anaerobic parasitic organism that causes amoebiasis, a disease characterized by intestinal and sometimes extraintestinal infections. It exists in both active (trophozoite) and dormant (cyst) forms, the latter being responsible for environmental survival and transmission of the infection, particularly in tropical regions. The ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Amphibian? Scientific Classification of Amphibian Category Classification Kingdom Animalia Phylum Chordata Clade Batrachomorpha Class Amphibia Order Anura, Caudata, Gymnophiona Amphibians are believed to have evolved from a population of osteolepid fishes during the later part of the Devonian period. These fishes began spending more time on land, moving from one pool to another. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Anabaena? Definition of Anabaena Anabaena is a filamentous cyanobacteria genus known for its nitrogen-fixing abilities and symbiotic relationships with certain plants, while also producing neurotoxins harmful to various organisms. History of Anabaena In the ancient annals of Earth’s story, the history of Anabaena and its fellow cyanobacteria weaves a tapestry that stretches back ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Anabaena? Requirement for Observation of Anabaena Under Microscope Procedure for observation of Anabaena Under Microscope This procedure outlines the steps for creating a wet mount slide and observing the prokaryotic alga Anabaena under a microscope. Structured Inquiry Step 1: Estimating Field of View Begin by placing a clear millimeter ruler on the microscope ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Anabolism? Definition of Anabolism Anabolism is the metabolic process in which complex molecules are synthesized from simpler ones, typically requiring an input of energy. Stages of Anabolism Anabolism, a fundamental metabolic pathway, involves the synthesis of intricate molecules from simpler precursors. This process is central to the growth and maintenance of cells and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Anabolism? Anabolism Definition Anabolism is the metabolic process in which simpler molecules are synthesized into more complex ones, requiring energy input. Examples of Anabolic Reactions 1. Photosynthesis: Photosynthesis exemplifies an anabolic reaction quintessential to autotrophic organisms. Within the chloroplasts of plants, a sequence of biochemical transformations ensues, culminating in the conversion of carbon ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Anaerobic blood agar is a solid media that can be used in qualitative methods for the isolation and cultivation anaerobic organisms. V.R. Dowell and T.M. Hawkins, Centers for Disease Control and Prevention Atlanta, Georgia. Anaerobic blood agar supports the growth of anaerobes with typical pigmentation, both fastidious and slow-growing, and other anaerobes that are of clinical significance.

Anaerobic Culture Media used in anaerobic bacteriology may be prepared in a fresh manner or bought from commercial vendors. Media for anaerobic fermentation that is created in the laboratory should be used within two weeks after the time of preparation, as prolonged storage can degrade the quality of the medium due to peroxide accumulation and dehydration.

What is Analytical Balance? Principle of Analytical Balance – Weighing balance principle Types of analytical balance 1. Two pan or equal arm analytical balance 2. Single pan or unequal arm mechanical balance 3. Electronic single pan balance 4. Microbalance Parts of Analytical Balance with Functions Important Parts of a Analytical Balance Procedure for Operating Analytical ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are xerophytes? Morphological characteristics of xerophytes Xerophytes, adapted to arid environments, exhibit several distinctive morphological features to enhance their survival under water-scarce conditions. These adaptations are crucial for minimizing water loss and maximizing water use efficiency. The key morphological characteristics of xerophytes include: Types of Xerophytes Xerophytes, plants adapted to survive in arid environments, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Anatomical Barriers? Anatomical barriers serve as the first line of defense against invading microbes or parasites, preventing them from entering the body and causing infection. These barriers consist of physical structures that organisms must attach to and penetrate before gaining entrance into the body. Microbes or parasites can enter the body through active ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Ancylostoma duodenale? Characteristics of Ancylostoma duodenale Roundworms, belonging to the phylum Nematoda, encompass a diverse group of organisms with varied lifestyles. Among them, Ancylostoma duodenale stands out as a significant parasitic nematode, commonly known as the Old World hookworm. This species primarily infects the small intestine of its hosts, including humans, and is ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Anesthetic Solution (Buffered MS222) is commonly used to temporarily immobilize fish and amphibians.

What are Angiosperms? Definition of Angiosperms Angiosperms are flowering plants that produce seeds enclosed within an ovary, typically forming a fruit. They have a well-developed vascular system for transporting water and nutrients and make up about 80% of all plant species, thriving in a wide range of environments. Characteristics of Angiosperms Classification of Angiosperms Angiosperms, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Animal cell are considered to be the fundamental living species belonging to the kingdom Animalia. They are eukaryotic cells which means they possess an actual nucleus as well as organelles, which are special structures which perform various functions. Animal cells don't have specific organelles for plants, such as cell walls that support the plant cell or the chloroplasts, an organelle that is responsible for photosynthesis.

Tissue Culture is the term used to describe the process of removing tissues, cells or organs from either a plant or animal and their subsequent transfer into an artificial environment that encourages development.

Animal models of autoimmune illnesses have provided invaluable insights into the mechanism of autoimmunity, human autoimmunity, and prospective therapies. Certain inbred animal breeds develop autoimmunity naturally, and autoimmunity can also be caused by certain experimental procedures. Autoimmunity Can Develop Spontaneously in Animals Autoimmunity Can Be Induced Experimentally in Animals

What is Anion Exchange Chromatography? Principle of Anion Exchange Chromatography The principle of anion exchange chromatography is based on the net surface charge of proteins, which changes with the pH and is determined by their isoelectric point (pI). The pI of a protein is the pH at which it carries no net charge. Below the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Anomer? Definition of Anomers Anomers are a pair of stereoisomers or diastereomers that differ at the anomeric carbon, the carbon atom carrying the aldehyde or ketone functional group in the cyclic form of a sugar. Nomenclature of Anomers What is Anomerization? Mechanism of anomerization The mechanism of anomerization involves the interconversion between the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Anomer of glucose? Overview of Anomer Of Glucose Structure of Glucose Anomeric Carbon of Glucose Alpha-D-glucopyranose and beta-D-glucopyranose Significance The significance of the anomers of glucose lies in their impact on the chemical, physical, and biological properties of glucose. Here are some key points highlighting the significance of the anomers: In summary, the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Anther? Definition of Anther The anther is the part of a flower’s stamen that produces and releases pollen grains, which contain the male gametes necessary for fertilization. Types of Anther Anthers exhibit considerable variation in structure and attachment, which influences their function and appearance in different plant species. Here, we outline the primary ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Antibiotic resistance or Drug resistance to bacteria is a modern enemy of the new generation. Before we know about antibiotic resistance, we must first know what bacteria are? Bacteria is a type of germs, which is found inside or outside of human or animal bodies. Most of the bacteria are harmless, and some of them ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Medicinal folklore was the primary treatment procedure for infections before the early 20th century. Over 2,000 years ago, a mixture of different antimicrobial properties was used to treat infections.  The ancient Egyptians and ancient Greeks, and other ancient cultures used selected mold and plant materials for the treatment of infections. After the discovery of synthetic ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Antibodies are not found in a specific location, but anytime our immune system encounters antigen or a disease, B cells are activated and antibodies are quickly released into the bloodstream. These immunoglobulins undergo mitosis, resulting in cell division, and manufacture antibodies continually as a result of the production of additional cells. These antibodies linger in ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is an Anticodon? Anticodons play a crucial role in protein production by ensuring that the correct amino acids are incorporated in the appropriate positions. These sequences of nucleotides are found within transfer RNA (tRNA) molecules. tRNAs act as carriers, bringing the specific amino acids that match the instructions encoded in the messenger RNA (mRNA) ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Treatment of an antifungal disease is quite difficult than a bacterial infection. The reason is quite clear that most of the eukaryotic fungal cells have a lot in common with human cells, so antifungal drugs can also damage the host body cells. Also, some fungi have detoxification properties that can modify antifungal drugs and as ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Antigen? Antigen Definition An antigen is a foreign molecule or substance that triggers an immune response in the body, leading to the production of antibodies. or An antigen is a substance that can stimulate an immune response in the body. It can be a molecule or a part of a molecule, such as ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Antigen Presentation Definition Antigen-Presenting Cells Definition Types of Antigen-Presenting Cells Antigen-presenting cells fall into two categories:  Antigen-presenting cells that contain MHC class II molecules, co-stimulatory molecules, and pattern recognition receptors are often referred to be “professional.” Non-professional APCs express molecules of MHC class I. 1. Professional Antigen-Presenting Cells a. Macrophages Activation of Macrophages For macrophages ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Antigen Processing and Presentation Types of Antigen Processing and Presenting Pathway Endogenous Antigens: Cytosolic Pathway 1. Peptides for Presentation Are Generated by Protease Complexes Called Proteasomes 2. Peptides Are Transported from the Cytosol to the Rough Endoplasmic Reticulum  3. Peptides Assemble with Class I MHC Aided by Chaperone Molecules Exogenous Antigens: Endocytic Pathway  1. Peptides ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Antigen Processing, And Presentation? Major histocompatibility complex Major histocompatibility complex I (MHC Class I) Structure of MHC Class I Major histocompatibility complex II (MHC Class II) Structure of MHC Class II Major Histocompatibility Class III (MHC Class III) Antigen Processing and Presentation 1. Cytosolic pathway – Endogenous antigen 2. Endocytic Pathway – Exogenous ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Antigen-Antibody (Ag-Ab) Interaction refers to the biochemical reaction that occurs between antibodies and specific antigens when they come into close proximity, typically within a distance of several nanometers. This interaction plays a critical role in the immune response against foreign substances and pathogens in the body. The binding of antibodies to specific antigens is facilitated ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Definition of Antimicrobial Agent Antimicrobial agent refers to those chemical or physical agents which are used to kill microorganisms or prevent their growth. There are present several types of microorganism which are responsible for infection or disease in animal or human body such as fungi, bacteria, virus, etc. Similarly, there are present different types of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Antimicrobial Susceptibility Testing (AST) Techniques of Antimicrobial Susceptibility test Antimicrobial susceptibility tests in the laboratory can be done by using: Dilution susceptibility tests Disc diffusion susceptibility tests Kirby-Bauer NCCLS modified disc diffusion technique Stokes disc diffusion technique Disadvantages of antimicrobial susceptibility tests Susceptibility tests determine the antimicrobial effect against bacteria in conditions of laboratory (in ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Vaccines have so far held the center position in efforts to stop viruses. They are inexpensive and secure, and the protection can last for a long time. But some viruses because of a number of reasons, aren't compatible with this method like retroviruses, influenza as well as rhinoviruses and arboviruses.

Antiviral drug referred to those drugs or chemical agents that are used for the treatment of viral infection. There are present several types of antiviral drugs that are used for the treatment of viral infections such as Amantadine, Acyclovir, Azidothymidine, Ganciclovir, Abacavir. Each of these antiviral drugs follows a different mechanism. The variation in their ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is API (Analytical Profile Index) 20E Test? Principle of APT Test for Bacteria API 20E Test Kit API 20E is a specialized kit designed for bacterial identification, consisting of 20 distinct tests. These tests aid in characterizing various metabolic activities and enzymatic reactions of the organisms being examined. Each test provides valuable information to ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Apomixis? Definition of Apomixis Apomixis is a form of asexual reproduction in plants where seeds or embryos are produced without fertilization, resulting in offspring that are genetic clones of the parent plant. Characteristics of Apomixis Here is the Characteristics of Apomixis; Types of Apomixis  Apomixis encompasses several distinct types of asexual reproduction in ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Learn all about the apoptosis pathway: its definition, functions, mechanism, and examples in this comprehensive guide. Apoptosis, also known as programmed cell death, is a crucial process for maintaining healthy cell turnover and eliminating damaged or abnormal cells. Understanding the various components and steps involved in the apoptosis pathway can provide valuable insights into diseases ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Multicellular organisms experience a variety of cell development and death processes. Cellular death is crucial for the survival and development of all organisms. Our body is made up of several cell types situated in diverse body sections. There are two distinct methods by which a cell dies. Either the organism is exposed to an unfavourable ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Biotechnology? Biotechnology is a broad field that involves the use of living organisms, cells, and biological systems to develop products and technologies that improve human life and the environment. It integrates knowledge from various scientific disciplines, including biology, chemistry, genetics, and engineering, to manipulate biological materials for specific applications. Here are some key ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Fluorescence spectroscopy is an analytical technique used to examine the characteristics and interactions of molecules. It is founded on the idea that when a molecule absorbs a photon of light and becomes excited, it emits light at a longer wavelength, a phenomenon known as fluorescence. This emitted light can be collected and studied in order ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Genetically engineered crops Genetically engineered crops have emerged as a transformative component of modern agriculture, driven by advances in plant biotechnology. This innovative field enables the transfer of specific genes from various organisms into plants, leading to the development of crops with enhanced traits. The process of genetic engineering offers solutions to many agricultural challenges, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Phycology? Phycology, also known as algology, is the scientific study of algae. This branch of biology focuses on various aspects of algae, including their classification, physiology, ecology, and distribution. Here are some key points regarding phycology: Role of algae in the environment Algae play a crucial role in the environment, contributing to various ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Aquaculture? Definition of Aquaculture Aquaculture is the farming of aquatic organisms, such as fish, shellfish, and aquatic plants, under controlled conditions to increase production for food, industry, and environmental restoration. Characteristics of Aquaculture Aquaculture is a highly productive practice with diverse benefits for agriculture, the environment, and the economy. Below are its key ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is the Aquatic Ecosystem? Features of Aquatic Ecosystem  Detailed characteristics of the aquatic ecosystem are depicted in the graphic below — Types of Aquatic Ecosystem There are two types of Aquatic Ecosystems, including; 1. Freshwater Aquatic Ecosystem a. Lotic Ecosystems b. Lentic Ecosystems c. Wetlands 2. Marine Aquatic Ecosystem a. Ocean Ecosystems b. Coastal ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Arabinose Operon? Structure of L-arabinose operon The linear structure of the arabinose operon consists of four unique genes and a catabolic active site. Structural genes Function of Structural genes Inducer Gene Regulatory gene Catabolic Active Site Operator Gene Promoter Gene In Summary Regulation of Arabinose Operon Negative regulation of araBAD Positive regulation of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Archaea? Definition of Archaea Archaea are a domain of single-celled prokaryotic organisms distinct from bacteria, characterized by unique genetic, metabolic, and cellular features, and often found in extreme environments. Habitat of Archaea The habitat of Archaea is remarkably diverse, spanning from some of the most extreme environments on Earth to more common and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Archaea? Examples of Archaea What is Bacteria? Examples of Bacteria Archaea vs Bacteria – Differences Between Archaea and Bacteria Bacteria and Archaea, both belonging to the prokaryotic realm, are single-celled microorganisms that lack a defined nucleus and other membrane-bound organelles. Despite these similarities, they exhibit distinct characteristics that set them apart in terms ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Archaea? Characteristics of Archaea Archaea are single-celled microorganisms that belong to the prokaryotic domain of life and share some characteristics with bacteria. However, they also possess unique features that distinguish them from bacteria. The main characteristics of Archaea include: These characteristics make Archaea unique and important microorganisms in the study of the evolution ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Archaebacteria? Definition of Archaebacteria Archaebacteria, also known as Archaea, are a group of single-celled microorganisms that belong to one of the three domains of life. They are distinct from bacteria and eukaryotes in terms of their genetic, biochemical, and physiological characteristics. Archaebacteria are known for thriving in extreme environments such as hot springs, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Archaeopteryx? Discovery of Archaeopteryx Authenticity: Description of Archaeopteryx How Archaeopteryx is a connecting link Between Reptiles and Birds (Aves)? Archaeopteryx is considered a connecting link between reptiles and birds (Aves) due to its combination of characteristics from both groups. Here’s a description of how Archaeopteryx exhibits features that bridge the gap between reptiles ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Archegoniate? Definition of Archegoniate Archegoniate refers to a group of primitive plants that possess archegonia, which are multicellular, often flask-shaped structures that produce and house egg cells. This group includes mosses, liverworts, ferns, and most gymnosperms. Unifying features of archegoniates Archegoniates exhibit several key characteristics that unify them across various groups of plants. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Viruses? Definition of Viruses Viruses are submicroscopic infectious agents that can only replicate within the living cells of a host organism, capable of infecting all forms of life. They consist of genetic material (DNA or RNA) encased in a protein coat and, in some cases, an external lipid envelope. Are Viruses Living or ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The Arneth Count determines the percentage distribution of various types of neutrophils based on their nuclear lobes. It isn’t used often in modern medicine. Joseph Arneth divided neutrophils into five types. Stage Nuclear lobes Diagram Normal Range Stage 1 (N1) Nucleus is unilobed.The nucleus is C or U shaped. 2-5% Stage 2 (N2) Nucleus is ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Artificial Selection? Definition of Artificial Selection Artificial selection, or selective breeding, is the human-driven process of breeding plants or animals to promote desirable traits in offspring by selecting specific individuals with those traits to reproduce. Darwin’s Experiments With Artificial Selection Darwin’s experiments with artificial selection were pivotal in the development of his theories ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Ascaris lumbricoides? History and Distribution of Ascaris lumbricoides Ascaris lumbricoides has a long and complex history, having been recognized since ancient times. Its resemblance to the earthworm led to frequent confusion, contributing to its nomenclature. The specific name “lumbricoides” derives from the Latin word Lumbricus, meaning earthworm, highlighting this physical similarity. The following points ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Asexual Reproduction? Definition of Asexual Reproduction Asexual reproduction is a biological process in which a single organism produces offspring without the fusion of gametes, resulting in genetically identical progeny. Characteristics of Asexual Reproduction Asexual reproduction is a mode of reproduction that involves only one parent and does not require the fusion of male ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Asexual Reproduction? There are animals that are born with two parents. Some animals can come from a single parent. For instance, the Komodo dragon, as an instance is the only one with one mother and reproduces through parthenogenesis. Sexual reproduction is the process of generating offspring from only one parent. Are there male ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The type of reproduction that doesn’t require the union of female and male gametes, and creates individuals who have genetically identical traits to their parent is referred to as Asexual reproduction.  In the article below we will be able to learn about the asexual reproduction of plants, the types of it techniques. Therefore, let’s start ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Ashdown's medium can be described as a selective culture medium that allows for the identification and characterisation of Burkholderia pseudomallei (the bacteria which causes the disease melioidosis). The Ashdown's Medium was initially identified by LR Ashdown in 1979.

Aspergillus species are responsible for a wide variety of diseases in humans, ranging from direct invasion to hypersensitivity reactions. The majority of human diseases are caused by Aspergillus fumigatus and Aspergillus niger, and less frequently by Aspergillus flavus and Aspergillus clavatus. Aspergillus, the mould (a type of fungus) that causes aspergillosis, is prevalent both inside ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Habitat of Aspergillus clavatus Morphology of Aspergillus clavatus Aspergillus clavatus is a filamentous fungus that belongs to the Ascomycota division. Its morphology is characterized by the following features: Cultural Characteristics of Aspergillus clavatus Culture media used for the growth of Aspergillus clavatus Many different culture media can be used to grow Aspergillus clavatus, however the most popular ones ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Aspergillus flavus is a type of fungus that is widely distributed all over the world. It is a saprotrophic and pathogenic species that mainly colonizes cereal grains, legumes, and tree nuts. Typically, postharvest rot develops during harvest, storage, and/or transit. Its name flavus comes from the Latin word meaning yellow because of the color of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Kingdom: Fungi Division: Ascomycota Class: Eurotiomycetes Order: Eurotiales Family: Trichocomaceae Genus: Aspergillus Species: A. fumigatus Aspergillus fumigatus General Characteristics of Aspergillus spp Aspergillus spp. is a group of fungi that belong to the Ascomycota phylum. There are over 200 species of Aspergillus, and they are ubiquitous in nature, being found in soil, decaying organic matter, and on food ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Kingdom: Fungi Division: Ascomycota Class: Eurotiomycetes Order: Eurotiales Family: Trichocomaceae Genus: Aspergillus Species: A. niger History of Aspergillus niger Aspergillus niger is a filamentous fungus that belongs to the Aspergillus genus. It is commonly found in soil and decaying plant matter and has been known to humans for centuries. Here is a brief history of Aspergillus niger: ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Wha do you mean by Assisted Reproductive Technology? Assisted Reproductive Technology (ART) refers to a range of medical procedures and techniques used to help individuals or couples conceive a child when they are facing fertility challenges. ART methods involve the manipulation of human eggs, sperm, or embryos in a laboratory setting to facilitate conception. There ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Atomic Absorption Spectrophotometer? Definition of Atomic Absorption Spectrophotometer The Atomic Absorption Spectrophotometer (AAS) is a scientific instrument used to quantitatively determine the presence and concentration of specific chemical elements in a sample by measuring the absorbed wavelengths of light by free metallic ions in their gaseous state. Principle of Atomic Absorption Spectrophotometer The ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The AFM, also known as the atomic force microscope (AFM) is a sort scanner probe. Its principal functions include measuring characteristics like height, magnetism and friction.

What is ATP Synthase? ATP synthase is an essential enzyme complex responsible for the production of adenosine triphosphate (ATP), the primary energy currency in living cells. Often referred to as Complex V in the oxidative phosphorylation pathway, ATP synthase plays a critical role in cellular respiration and photosynthesis, utilizing the proton gradient generated by the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Auramine- Rhodamine Staining? Principle of Auramine- Rhodamine Staining Auramine and Rhodamine are nonspecific fluorochrome dyes that are attracted to acid-fast microorganisms. In the case of Mycobacteria, the dyes can selectively bind to the mycolic acid present in the cell wall, allowing the stain to penetrate. This compound is resistant to acid-alcohol decolorizer solutions. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is an autoclave? An autoclave is a device which finds applications in numerous scientific and medical institutions. Its work principle lies in using the pressure of steam for the cleansing of equipment and materials. During the autoclaving process, the following kinds of germs are killed: bacteria, viruses, and spores. The basic idea of autoclave ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is an Autoclave Bag? Autoclave bags are made of specific materials that can withstand high temperatures and pressures. Autoclave bags, usually filled with polypropylene, are used in medical/laboratory environments and procedures to sterilize contaminated waste for proper and safe disposal. Autoclave bags are designed to contain biohazard waste and make them biohazard safe. These ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Why we need to Validate an Autoclave? Validating an autoclave is crucial for ensuring the sterilization process is effective and reliable. Here’s why validation is necessary: Methods for Autoclave Validation Autoclave validation is a critical process in ensuring that sterilization procedures are effective and reliable. This is particularly important in the pharmaceutical industry, where sterility ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Autoimmune Disease? Signs and symptoms of Autoimmune Disease The signs and symptoms of autoimmune diseases can vary depending on the specific type of disease and the affected body part. While some autoimmune diseases may share similar symptoms, others have distinct manifestations. It is also possible for an individual to have multiple autoimmune diseases ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Autoimmunity? General Features Of Immunologic Tolerance Autoimmunity, encompassing more than 80 different conditions, affects approximately 5% of the population. While each autoimmune disease may have unique characteristics, there are several common features shared among them: Autoimmune diseases can be classified into two broad categories based on the nature of the targeted self-antigens: organ-specific ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

An Automated Cell Counter is a machine or device that is used to count the number of cells in a biological sample. It uses various technologies such as image analysis, impedance measurement, or fluorescence to accurately determine the number of cells present. The importance of cell counting lies in its widespread applications in the fields ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Autonomic nervous system? Definition of Autonomic nervous system The autonomic nervous system (ANS) is a division of the nervous system responsible for regulating involuntary bodily functions such as heart rate, digestion, respiration, and sexual arousal. It consists of the sympathetic, parasympathetic, and enteric divisions, which work together to maintain homeostasis and respond to ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is An Autotroph? Definition of Autotroph An autotroph is an organism that can produce its own complex organic compounds (like carbohydrates) using simple substances such as carbon dioxide, typically through processes like photosynthesis or chemosynthesis, without relying on external sources for carbon or energy. Types of Autotrophs Autotrophs, which are organisms that make their ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Characteristics of Aves Aves, the class of birds, possesses numerous distinctive characteristics that set them apart from other animals. Here is a compilation of their key traits: These characteristics collectively make birds a unique and diverse group of animals, well-adapted to various environments and exhibiting a fascinating array of biological features. Flight Adaptations in Class ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Axon? Definition of Axon An axon is a long, slender projection of a nerve cell (neuron) that transmits electrical impulses, known as action potentials, away from the neuron’s cell body to other neurons, muscles, or glands, facilitating communication within the nervous system. Characteristics features of Axon Axons are vital structures in the nervous ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are B cells or B lymphocytes? Definition of B cell (B lymphocyte) A B cell, or B lymphocyte, is a type of white blood cell that produces antibodies and plays a crucial role in the immune response against infections. Morphology of B cell (B lymphocyte)  Structure of B cell (B lymphocyte) Stage-specific Markers Antigen-binding ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Structure of B. Sc. Honours Microbiology under CBCS Core Course C-1: Introduction to Microbiology and Microbial DiversityC-2: BacteriologyC-3: BiochemistryC-4: VirologyC-5: Microbial Physiology and MetabolismC-6: Cell BiologyC-7: Molecular BiologyC-8: Microbial Genetics and GenomicsC-9: Environmental MicrobiologyC-10: Food and Dairy MicrobiologyC-11: Industrial MicrobiologyC-12: ImmunologyC-13: Medical MicrobiologyC-14: Recombinant DNA Technology Discipline Centric Elective (Any Four) DSE-1: BioinformaticsDSE-2: Microbial BiotechnologyDSE-3: ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Domain: Bacteria Phylum: “Firmicutes” Class: Bacilli Order: Bacillales Family: Bacillaceae Genus: Bacillus Species: B. cereus Definition of Bacillus cereus Bacillus cereus is a gram-positive, rod-shaped bacterium that produces toxins leading to foodborne illnesses. It can cause two main types of gastrointestinal disorders: emetic (vomiting) syndrome and diarrheal syndrome. This bacterium is commonly found in soil ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The Bacitracin susceptibility test is one of the antimicrobial disc tests used to distinguish between group A and other -hemolytic Streptococci.

What is Backcross Method? Definition of Backcross Method The backcross method is a breeding technique where a hybrid or progeny is repeatedly crossed with one of its original parent plants to transfer specific traits from the donor parent to the recipient parent while preserving the recipient’s original characteristics. Requirements of a backcross programme To effectively ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The bacterial capsule is considered as the most important virulence factor among all factors that are present within the bacteria.  Some examples of a capsulated strain are Neisseria meningitidis, Streptococcus pneumoniae, Klebsiella pneumoniae, Haemophilus influenzae, Escherichia coli, and group B streptococci al of them are virulent. While the Nonencapsulated mutated strain of these organisms is ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Cell Wall? Definition of Cell Wall A cell wall is a rigid, protective layer that surrounds the cell membrane in plants, fungi, algae, and some prokaryotes, providing structural support, shape, and protection. Bacterial Cell Wall Types Based on the result of gram staining it is stated that there are two types of cell ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Bacterial Conjugation? Bacterial Conjugation Definition Bacterial conjugation is a process of genetic exchange where DNA is transferred from a donor cell to a recipient cell through direct contact, typically mediated by a pilus. It is a key mechanism of horizontal gene transfer, often involving plasmids, and contributes to genetic diversity and the spread ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Bacterial Culture Media? Ingredients of Bacterial Culture Media The formulation of bacterial culture media is a precise science that involves combining various ingredients to create an environment conducive for the growth and study of bacteria. These ingredients serve specific purposes, from providing essential nutrients to enabling the differentiation of bacterial species. Understanding these ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Microbiological cultures, also known as Microbial culture is the technique of generating microbial species by the process of letting them reproduce in a conditions in a monitored laboratory conditions. Microbiological cultures are fundamental and essential diagnostic methods that are employed as research tools within molecular biology. The term “culture” could be used to describe the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

In 1930, Leifson introduced a simple flagella stain, using this stain he observed that mutations leading to nonflagellated from flagellated bacteria were common, as well as mutation leading to loss of motility without loss of the flagellum itself.

Facts of Bacterial Food Poisoning What is Bacterial Food Poisoning? Causes of Bacterial Food Poisoning Bacterial food poisoning mainly occurs by eating contaminated foods. the contamination of food with the bacterial toxin or chemicals can be occurred by; Symptoms of Bacterial Food Poisoning If you have bacterial food poisoning, you probably won’t go unnoticed. Symptoms ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Environmental Factors Affect Bacterial Growth In addition to knowing the proper nutrients for the cultivation of bacteria, it is also necessary to know the physical environment in which the organisms will grow best. Just as bacteria vary greatly in their nutritional requirements, so do they exhibit diverse responses to physical conditions such as temperature, gaseous ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Bacterial Growth Curve? Definition of Bacterial Growth Curve The bacterial growth curve is a graphical representation of the different phases of bacterial growth over time, including the lag phase, log phase, stationary phase, and death phase. Binary Fission of Bacteria – Understand the Bacterial Growth Requirements for Bacterial Growth Chemical or Nutrient Requirement ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Bacterial Growth Curve? The bacterial growth curve is a graphical representation of the growth of a population of bacteria in a closed system over time. It typically consists of four phases: The shape and duration of each phase can vary depending on the bacterial species, the nutrients available, and other environmental factors. Understanding ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Bacterial Secretion Systems? Definition of Bacterial Secretion Systems Bacterial secretion systems are specialized protein complexes in bacterial cell membranes that transport substances, primarily proteins, from the bacterial cell to its environment or into host cells, facilitating processes such as pathogenesis and environmental adaptation. Classes of bacterial protein secretion systems Bacterial protein secretion systems ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

A bacterial smear is a thin layer of bacterial cell/culture which is placed on a clean, grease-free microscopic slide to observe a clear image under a microscope.

When a microorganism starts to synthesize toxin, they are called microbial toxins, such as bacteria and fungi. There are few bacteria that can produce the most potent natural toxins such as Botulinum neurotoxins. However, the bacterial toxin has some medical importance that is why they are used in medical science and research. What Is Toxin? ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Transduction refers to the transfer of a part of DNA between two bacteriums via a bacteriaophage. Transduction is mediated by viruses.

What Is Bacterial Transformation? Bacterial Transformation Definition Bacterial transformation is the process by which a bacterium takes up free DNA from its environment and incorporates it into its genome, potentially expressing new traits. Principle of Bacterial Transformation Types of Bacterial Transformation Bacterial transformation can occur naturally or be induced artificially. Both forms allow bacteria to ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Bacterial transformation is a process wherein bacteria naturally modify their genetic makeup by incorporating foreign genetic material into their own genome. This phenomena has significant ramifications for health care, agriculture, and environmental science and has evolved into a fundamental genetic engineering tool. Scientists can create life-saving medications, alter crops for improved features, and speed up ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Human pathogenic bacteria transmitted via the fecal-oral route, i.e., primarily intestinal pathogens, constitute one component of drinkable water quality analysis. Screening water for faecal contamination by testing for the presence of an indicator microbe is more practicable than doing thorough routine examinations for the presence of every type of disease. If you want to know ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Viruses that infect bacteria are known as phages or bacteriophages. Twort (19l5) described a degenerative alteration in staphylococcal colonies isolated from calf lymph that was transmissible serially via application of culture filtrates from the original growth. d’Herelle (1917) observed that the filtrates of dysentery patient faeces cultures produced transmissible lysis of a dysentery bacillus broth ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Baird Parker Agar was created by Baird Parker using the Tellurite–glycine formulation of Zebovitz et al. It allows for a good differentiation between coagulase positive strains.

The virus uses the host’s complete system for protein translation because they lack translational machinery. Hence, the Baltimore classification system is based on this machinery how viruses use the host mechanism. Messenger RNA (mRNA) is the main focus of this classification system. In the beginning, there were six classes of viruses in Baltimore classification system ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Baran Pipette Column? Principle of Baran Pipette Column Principles of adsorption chromatography are used in the Baran pipette column. In this technique, the separation of compounds is achieved through their differential interactions with two key phases: in the stationary phase and the mobile phase. The pasteur pipette is packed with a stationary phase, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Basidiomycetes are harmful as well as useful. Their attack foods and ornamental plants, cause many different diseases including seedling diseases, wood rots, root and stem rots, seed diseases (smuts), and rusts, on the other hand, it used as humans foods.

Basophils are an immunological cell type that release enzyme-containing granules during allergic responses and asthma crises. Basophil is a type of white blood cell that, together with neutrophils and eosinophils, belongs to the granulocytes category. They contain several chemicals, including histamine and heparin. As part of the body’s immune response, basophils degranulate (split open) to ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Bath Solution Preparation To prepare 1L of Bath Solution (Ca2+/Mg2+ Free) the following components are required; Component Amount Concentration KOH (mw: 56.11 g/mol) 7.854 g 0.14 M HEPES (mw: 238.3 g/mol) 4.766 g 0.02 M KCl (mw: 74.55 g/mol) 149 mg 0.002 M EGTA (mw: 380.35 g/mol) 1.902 g 0.005 M Methanesulfonic acid (mw: 96.11 ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

In 1978, Feeley et al developed a medium for isolating Legionella species. They later modified it by replacing casein hydrolysate with beef extract and starch with activated carbon and naming it Charcoal Yeast extract (CYE) Agar. A further modification was made by Pasculle et al in 1980 by the addition of ACES (N-2-acetamido-2-aminoethane sulfonic acid) buffer in order to maintain the proper pH for optimal growth designated as BCYE for Buffered Charcoal Yeast Extract. Edelstein et al modified the medium in 1981 by adding potassium salt to alpha-ketoglutaric acids, which increased the medium's sensitivity. It is used in primary isolation and cultivation of Legionella species. It is recommended to be used in the cultivation and primary isolation of Legionella spp.

What Is a Bead Mill Homogenizer (Bead Homogenizer)? Principle of Bead Mill Homogenizer Parts of Bead Mill Homogenizer A bead mill homogenizer, also known as a bead mill or a bead agitator, typically consists of the following parts: Operating Procedure of Bead Mill Homogenizer Advantages of Bead Mill Homogenizer Limitations of Bead Mill Homogenizer

What is a Beaker? Features of Beaker Types of Beakers Beakers are basic pieces of lab glass that are used to hold, mix, and heat liquids. There are different kinds, and each one is made to do a certain job in science studies. Here are some types of beakers that are often used: How to ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Health Benefits of Beer Beer provides numerous health benefits when drank in moderation. Among these fascinating health advantages are the following: 1. Anti-cancer properties  2. Reduced risk of cardiovascular diseases  3. Diabetes  4. Prevention of anemia  5. Hypertension  6. Anti-aging properties  7. Gallstones  8. Prevention of dementia and coronary disease 9. Aids digestive system  10. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The Beer-Lambert Law is a handy principle used to understand how light interacts with substances, like liquids or gases. Imagine shining a flashlight through a glass of colored water—some of the light gets absorbed, right? This law basically says that the amount of light absorbed depends on three things: how thick the glass is (path ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Bench top centrifuge? Types of Benchtop Centrifuges There are several types of benchtop centrifuges, including: Types of Rotors used in Centrifuges A centrifuge can make use of a variety of rotors, including: Principle of Benchtop Centrifuges Parts of Benchtop Centrifuges Though the particular model will affect the elements of a benchtop centrifuge, most ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Benedict's test is a chemical test that is used to test for the presence of reduced sugars within an analytical test. Thus, simple carbohydrates that contain an aldehyde or free ketone functional group are detected using this test. The test is basing itself upon Benedict's Reagent (also called Benedict's solution) which is a complex mix of sodium carbonate, sodium citrate, and the pentahydrate of copper(II) Sulfate.

Top Selling Books for Microbial Genetics and Molecular Biology

If you are searching for best Books for BHU PET Applied Microbiology, than here is the list; 1. Prescott’s Microbiology by Joanne Willey, Linda Sherwood Adjunt Professor Lecturer, Christopher J. Woolverton Professor The author team of Prescott’s Microbiology continues the tradition of past editions by providing a balanced, comprehensive introduction to all major areas of microbiology. This ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Hey, if you are searching for best books to prepare for csir net life sciences, then here it is. This article contains a list of best-recommended books for CSIR NET Life Science. You can directly click on the book name and buy it from the Amazon store. Topic Wise Books for CSIR NET Life Science ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

In this article we will discuss about top and best books for Medical Microbiology and Immunology. 1. Ananthanarayan and Paniker’s Textbook of Microbiology Rating: 4.5/5 stars Ananthanarayan and Paniker’s Textbook of Microbiology has firmly established itself as a cornerstone in the field of medical microbiology since its first publication in 1978. With the release of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

In this article, I will share the list of top and best microbiology books for B.sc 2nd semester and biochemistry. All these books are recommended by CBCS. In B.sc 2nd semester of microbiology, you will study about Bioenergetics, Carbohydrates, Lipids, Proteins, Enzymes, Vitamins. All these topics you will find in these listed books. Here is ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Hey, here I am sharing the best microbiology books for B.Sc 1st Year Students. All of these books are necessary for first-year students. I also followed these books during my B.Sc and also follow to write my articles. Many of you think that microbiology is a boring memorization subject, but believe me, it’s a very ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Many bacteria produce a group of enzymes known as beta-lactamases that are mediated through genes in plasmids or the chromosomes. Beta-lactamase can be a constant process or it may be triggered through contact with antimicrobials. Beta-lactamases hydrolyze (and consequently inhibit) the beta-lactam ring of many Cephalosporins as well as penicillins. Beta-Lactamase Test is a rapid test to determine the presence of beta-lactamase , an enzyme that is produced by the strains from Staphylococcus aureus Neisseria gonorrhoeae, Branhamella catarrhalis as well as Haemophilus influenzae. 

What is Beta-oxidation? Definition of Beta-oxidation Beta-oxidation is the metabolic process in cells where fatty acids are broken down into smaller units called acetyl-CoA, generating energy in the form of ATP. Location of Beta-Oxidation Beta-oxidation, a crucial metabolic pathway for the breakdown of fatty acids, occurs in specific cellular locations depending on the organism’s type. In ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Bial’s test? Bial’s Test is a type of chemical test which is used to determine the existence of pentoses. It was named in honor of Manfred Bial, a German doctor. The ingredients are orcinol, hydrochloric acid and ferric chloride. If Pentose is present it will dehydrated to form furfural that is then reacted ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Bile Esculin Agar (BEA)? Bile Esculin Agar (BEA) Composition Bile Esculin Agar (BEA) contains the following ingredients per liter of the medium: The final pH of the medium, when measured at 25°C, is approximately 6.6±0.2. These specific components and their concentrations are carefully selected to create a medium that is selective and differential ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Bile Esculin test The Bile Esculin test is a biological test that is used to distinguish Enterococci from Group D Streptococci from non-group D viridans group Streptococci by their capacity to hydrolyze esculin. A variety of organisms are capable hydrolyzing esculin. But only a handful of them can do it when they are surrounded by ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Bile Solubility Test? Definition of Bile Solubility Test The bile solubility test is a biochemical assay used to differentiate Streptococcus pneumoniae from other alpha-hemolytic Streptococci based on the lysis of bacterial cells in the presence of specific bile salts. Objectives of Bile Solubility Test In essence, the bile solubility test is a pivotal ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is a Bilobed Anther? Structure of a Bilobed Anther The structure of a bilobed anther is essential to understanding its role in plant reproduction. Here’s a detailed breakdown of its components: Transverse cross-section of a Bilobed Anther A transverse cross-section of a bilobed anther provides a detailed view of its internal structure, revealing multiple ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Definition of binary fission (What is binary fission?) Binary fission can be described as a kind of sexual reproduction in which one living cell, or organelle expands twice its size, and then splits into two identical cells, which means that each of the daughter cells can be expected to grow to what size as the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Binomial nomenclature means a system that is used to provide a unique name to organisms, including plants, animals, microorganisms, and other living things. This naming system makes it easier to understand them better and also separates each species from others. Therefore a universally accepted naming system is essential. Binomial nomenclature definition Binomial nomenclature is a ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Bioaccumulation? Definitions of Bioaccumulation Bioaccumulation (increase in chemical concentration) is the process of chemical accumulation in an organism over time. Bioaccumulation, as defined by the International Union of Pure and Applied Chemistry, is the accumulation of a chemical in an organism due to direct uptake from the environmental matrix (bioconcentration) and uptake from ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Bioaerosol? Types of bioaerosols 1. Fungi 2. Bacteria 3. Viruses 4. Pollen Collection Methods of Bioaerosol/Deposition of Bioaerosol Bioaerosols are primarily collected via collection plates, electrostatic collectors, mass spectrometers, and impactors. Other experimental approaches are also utilised. In comparison to other PC filter alternatives, Polycarbonate (PC) filters have produced the most accurate bacterial ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Biochemical Test of Providencia stuartii Basic Characteristics Properties (Providencia stuartii) Capsule Non-Capsulated Catalase Positive (+ve) Citrate Positive (+ve) Flagella Flagellated Gas from glucose Negative (-ve) Gelatin Hydrolysis Negative (-ve) Gram Staining Negative (-ve) Growth in KCN Positive (+ve) H2S Negative (-ve) Indole Positive (+ve) Motility Positive (+ve) MR (Methyl Red) Positive (+ve) Nitrate Reduction Positive (+ve) ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Biochemistry is the branch of science that explores the chemical processes and substances that occur within living organisms. It combines principles from both biology and chemistry to study biomolecules like proteins, nucleic acids, carbohydrates, and lipids. Biochemists investigate how these molecules interact, how they contribute to the structure and function of cells, and how metabolic ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Biodegradation? Definition of Biodegradation Biodegradation is the natural process by which microorganisms break down organic matter into simpler substances, such as carbon dioxide, water, and minerals. Examples of Some biodegradable pollutants Biodegradable pollutants encompass a range of highly toxic synthetic compounds that have been introduced into the environment over time. Some examples of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Biodiversity is a term that might sound complicated, but it’s actually a simple and really important idea. Imagine you’re walking through a forest. You see different types of trees, hear various birds singing, and spot all sorts of insects and animals. All these different forms of life, including the plants, animals, and microorganisms, as well ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Biodiversity hotspots are regions packed with an extraordinary variety of plant and animal life found nowhere else on Earth—but they’re also in serious trouble. To qualify as a hotspot, an area must have at least 1,500 unique plant species and have already lost over 70% of its original natural habitat due to human activities like ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Biogeny (Formation of Primitive Life)? 1. Formation of nucleic acids and nucleoproteins 2. Formation of Coacervates 3. Formation of Primary organism

What is Biogeochemical Cycle? Definition of Biogeochemical Cycle A biogeochemical cycle is the movement and transformation of chemical elements and compounds between living organisms, the atmosphere, and the Earth’s crust, involving the cycling and recycling of nutrients and elements essential for life. Types of Biogeochemical Cycles Biogeochemical cycles are classified into two main types: gaseous cycles ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Bioinformatics? Definition of Bioinformatics Bioinformatics is the interdisciplinary field that combines biology, computer science, and mathematics to store, analyze, and interpret large-scale biological data, such as DNA, RNA, and protein sequences, through the development of computational tools and algorithms. History of Bioinformatics Aim of Bioinformatics The primary goals of bioinformatics are outlined as ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Biological Clocks? Types of biological clocks There are several types of biological clocks found in living organisms. Here are some of the major types: It’s important to note that different organisms may have different types of biological clocks or variations of these clocks based on their specific ecological and physiological requirements. The study ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The Membrane-Attack Complex Can Lyse a Broad Spectrum of Cells Cleavage Products of Complement Components Mediate Inflammation C3b and C4b Binding Facilitates Opsonization The Complement System Also Neutralizes Viral Infectivity The Complement System Clears Immune Complexes from Circulation Complement Deficiencies  C1q, C1r, C1s, C4, and C2 Deficiencies  C3 deficiencies Homozygous deficiencies Congenital deficiencies  The majority ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Biological Fitness? Definition of Biological Fitness Biological fitness is the ability of an organism to survive, reproduce, and pass on its genes in a specific environment. It reflects how well an organism’s traits help it adapt to environmental conditions, ensuring the continuation of its genetic material across generations. Distinguishing Biological Fitness from Exercise ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Biological Macromolecules? Definition of Biological Macromolecules Biological macromolecules are large, complex molecules essential for life, typically classified into four main categories: carbohydrates, proteins, nucleic acids, and lipids. They are composed of smaller units called monomers, which are linked together to form polymers. These macromolecules play crucial roles in biological processes, including energy storage, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Biological Magnification/Biomagnification? Biomagnification or biological magnification is the process by which certain chemicals accumulate in living organisms to a greater concentration than in the non-living environment. Causes of Biological Magnification/Biomagnification The principal causes of biomagnification are as follows: 1. Agriculture 2. Organic Contaminants 3. Industrial Activities 4. Mining Activities in the Ocean Process ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Membranes are thin, flexible layers that act like barriers or filters, separating different spaces or substances while allowing certain things to pass through. Think of them as sheets or films—some natural, others human-made. In living things, cell membranes are crucial. They wrap around cells, controlling what enters or exits, like nutrients in and waste out. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What do you mean by Biological Organization? The Historical Origins of Biological Organization The concept of biological organization has deep roots in the history of philosophy and science. From ancient Greek thought to the rise of modern biology, the idea of hierarchy in nature has evolved significantly. Early frameworks, such as Aristotle’s grading of living ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Biological oxygen demand refers to the amount of oxygen required by bacteria and other microorganisms to decompose organic matter under aerobic (oxygen present) conditions at a certain temperature (BOD). The greater the concentration of organic contaminants in the water, the greater the oxygen demand of the bacteria. Consequently, the level of contamination in a body ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Explore the fascinating world of biochemistry with our interactive word search game! Find and highlight key terms related to the study of chemical processes within living organisms. Challenge yourself with words like “enzyme,” “protein,” and “nucleotide” as you dive into the essential building blocks of life. Perfect for students and enthusiasts alike, this game is ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Biometrics? What is Numerical Taxonomy? Principle of Numerical Taxonomy The principle of numerical taxonomy, as articulated by Sneath and Sokal (1963), comprises several key tenets that guide its application in classifying and analyzing organisms. These principles emphasize a systematic and empirical approach to taxonomy, leveraging mathematical methods to ensure objectivity and accuracy. These ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Biomolecules? Definition of Biomolecule A biomolecule is any organic molecule that is essential for life and is involved in the structure, function, and regulation of the cells and tissues in living organisms. Common types of biomolecules include carbohydrates, lipids, proteins, and nucleic acids. Types of Biomolecules – Four Major Types of Biomolecules Biomolecules ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Bioprocess engineering involves the design of, operation, management, and optimizing biochemical processes that involve different biological pathways, or reactions that are mediated through living cells from plants, animals and microorganisms as well as enzymes in controlled conditions to facilitate the efficient biotransformation process of raw materials into a variety of goods at the appropriate scale.

What is a Bioreactor? Definition of Bioreactor A bioreactor is a device or system used to cultivate and grow biological cells, tissues, or organisms under controlled conditions. Principle of Bioreactor An ideal Bioreactor Should Have Following Qualities  An ideal bioreactor should possess the following qualities: Bioreactor Design Important factors need to be consider in designing ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Bioremediation? Bioremediation is a process used to clean up and detoxify polluted sites by utilizing microorganisms, plants, or their enzymes to break down and degrade environmental contaminants. It involves the natural or deliberate introduction of these biological agents to enhance the rate of degradation and transformation of pollutants. The concept of bioremediation includes ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Biosafety Cabinet? A biosafety cabinet (BSC), also known as a biological safety cabinet or microbiological safety cabinet, is a specialized laboratory workspace designed to handle materials contaminated with or potentially contaminated with pathogens requiring a specific biosafety level. The primary purpose of a biosafety cabinet is to provide a safe working environment for ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Biosafety guidelines provide guidelines, policies, and procedures that must be observed by all personnel who work in facilities handling microbiological agents, such as bacteria, viruses and parasites, fungi and prions. These guidelines are required for all institutions, including clinical and microbiological labs, biomedical research laboratories, teaching and training laboratories, and other healthcare institutions (e.g. hospitals, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Biosafety refers to the practices and precautions taken to prevent harmful biological agents—like viruses, bacteria, or toxins—from accidentally harming people, animals, or the environment. Think of it as a set of rules and tools scientists use to stay safe while working with dangerous germs. To organize these safety measures, experts created biosafety levels (BSL), which range ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Biosensors? Definition of Biosensors A biosensor is a device that detects biological changes and converts them into an electrical signal, typically by combining a biological sensing element with a transducer for applications like medical diagnostics or environmental monitoring. Components of Biosensors Biosensors consist of several key components that work together to detect biological ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Biotechnology is a broad field of science that involves using living organisms, cells, or biological systems to develop products, processes, or technologies that benefit humanity. It combines principles of biology, chemistry, physics, engineering, and computer science to solve problems in various industries, such as healthcare, agriculture, and environmental protection. Constructed by biologynotesonline.com with the free ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Definition of Biotic Factor  Biotic factors are the living components or variables that have an effect on an ecosystem or other species residing in that ecosystem. Biology definition A biotic factor is a factor produced by a live organism or any living component in its surroundings as a result of the organism’s actions. Biotic factors ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Biotic Factor? A biotic factor is a living component that affects another organism or shapes the ecosystem. These can be animals, plants, fungi, and microorganisms. They relate to the living things in an ecosystem and are essential for the survival and growth of organisms within their environment. Biotic factors determine the types and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Biotic interaction? Types of Biotic Interactions Based on the nature of these effects, biotic interactions can be categorized into three main types: positive, neutral, and negative. Below are the types of interactions, along with detailed descriptions: A. Positive Interactions 1. Mutualism Mutualism is a type of biotic interaction where two species engage in ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Bird Seed Agar Bird Seed Agar is an effective solid medium to isolate selectively and differentially of Cryptococcus Neoformans from clinical specimens. It is utilized for the specific isolation from Cryptococcus neoformans as well as C. Gattii. C. Neoformans typically grows as yeast (unicellular) and reproduces via budding. Cryptococcus Neoformans is an enclosed yeast, which makes the enzyme phenoloxidase an enzyme that is essential to melanin production. 

Salmonellae are the most complex taxonomically diverse group of bacteria in Enterobacteriaceae. Salmonella infections in humans are usually caused by the consumption of food, milk, and water contaminated with animal or human excreta. S. Typhi is only found in humans.

Proteins are polymers of amino acids. They are complex organic compounds containing nitrogen, hydrogen, carbon, and oxygen. Proteins are abundant in our everyday food e.g. egg, soya bean, pulses, fish, milk etc.

What is BLAST? BLAST, which stands for Basic Local Alignment Search Tool, is a widely used bioinformatics program and algorithm. It is designed to compare and analyze biological sequences such as DNA, RNA, and protein sequences. BLAST helps in identifying regions of similarity between different sequences, which can provide insights into their functional and evolutionary ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Kingdom: Fungi Division: Ascomycota Class: Eurotiomycetes Order: Onygenales Family: Ajellomycetaceae Genus: Blastomyces Species: B. dermatitidis Morphology of Blastomyces dermatitidis Blastomyces dermatitidis is a dimorphic fungus that causes blastomycosis, a fungal infection in humans and animals. The fungus exists in two different morphological forms, the yeast phase, and the mold phase. Overall, the morphology of Blastomyces dermatitidis ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

production of blood agar after the addition of liquid blood.

What are Blood Cells? Blood Cells Definitions Red blood cells (erythrocytes): Blood cells responsible for transporting oxygen from the lungs to the body’s tissues and removing carbon dioxide. White blood cells (leukocytes): Blood cells involved in the body’s immune response, defending against infections and diseases. Platelets (thrombocytes): Blood cells essential for blood clotting, preventing excessive ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Blood Collection Tubes? Components of Blood Collection Tube Components of Blood Collection Tubes: Order of Draw in Blood Collection Tube Step by Step Guide to the Order of Draw Color of the Cap and Its Purpose As discussed previously, the colour of the tube’s cap indicates its function and anticoagulant content. The colour ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Cross Match is a laboratory test, performed prior to a blood transfusion to determine whether donor blood is compatible (or incompatible) with recipient blood.

The concept of Blood grouping was first discovered by Karl Landsteiner in 1901, who was an Austrian-American immunologist and pathologist. He received Nobel Prize in Physiology or Medicine in 1930 for this discovery.

What is Blood Pressure? Definition of Blood Pressure Blood pressure is the force exerted by circulating blood against the walls of the arteries, measured in terms of systolic and diastolic pressures during the cardiac cycle. Types of Blood Pressure Blood pressure, a critical physiological parameter, is the force exerted by circulating blood against the walls ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Blood pressure? Factors Regulating Blood Pressure The regulation of blood pressure is a complex and dynamic process that involves multiple systems working together to maintain homeostasis. Even under normal physiological conditions, arterial blood pressure can exhibit variability. However, the body employs four primary regulatory systems to ensure that blood pressure remains within acceptable ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

In molecular biology and genetics, blotting is an analysis technique used for the detection of specific biomolecules (proteins, DNA or RNA) in samples of complex composition by transferring them onto a carrier such as a nitrocellulose, polyvinylidene fluoride or nylon membrane.

What is BOD Incubator? BOD incubator Definition The BOD (Biological Oxygen Demand) Incubator is a specialized laboratory instrument designed to provide a controlled temperature environment, typically around 20 degrees centigrade, for microbial and biochemical studies, particularly for assessing the oxygen demand of microorganisms in water samples. BOD incubator Principle Operating on a well engineered mechanism, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Objectives of BOD Test Principle of BOD Test Under alkaline circumstances (by adding Alkaline-iodide-azide), manganese sulphate precipitates manganese hydroxide as a white precipitate. This combines with the sample’s dissolved oxygen to generate a brown precipitation. On an acidic environment, manganese changes to its divalent form and releases iodine. This released iodine is titrated using starch ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Body Lines of Defense? Defense Systems – Innate and Acquired Defense Systems When the body encounters invaders, it deploys two distinct types of responses: the Innate (Natural/Non-specific) response and the Acquired (Adaptive/Specific) response. These responses form the body’s defense systems against foreign particles. The Innate response remains consistent regardless of the number of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Bombardment (Biolistics) Method? Principle of Bombardment (Biolistics) Method Materials Required for Bombardment (Biolistics) Method Protocol for Bombardment (Biolistics) Method The bombardment method, also known as biolistics, is a sophisticated technique employed for introducing foreign DNA into plant cells. This protocol outlines the essential steps for preparing plant cells and DNA-coated microcarriers, executing the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Bone? Definition of Bone Bone is a rigid connective tissue that forms the framework of the skeletal system in humans and other vertebrates. It provides structural support, protects internal organs, enables movement, produces blood cells, stores minerals, and maintains overall body rigidity. Features of Bone Bones possess several notable features that contribute to ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Bone Marrow? Definition of Bone Marrow Bone marrow is the soft tissue found within the cavities of bones that produces various types of blood cells, including red blood cells, white blood cells, and platelets. Location of Bone Marrow The location of bone marrow within the human body is widely distributed, but it undergoes changes ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Bordetella pertussis? Scientific classification of Bordetella pertussis Domain: Bacteria Phylum: Pseudomonadota Class: Betaproteobacteria Order: Burkholderiales Family: Alcaligenaceae Genus: Bordetella Species: B. pertussis Geographical Distribution and Habitat of B. pertussis Bordetella pertussis, the causative agent of whooping cough, is a major concern worldwide. The disease it causes is predominantly seen in children, and its spread ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Borrelia recurrentis? Scientific classification of Borrelia recurrentis Domain: Bacteria Phylum: Spirochaetota Class: Spirochaetia Order: Spirochaetales Family: Borreliaceae Genus: Borrelia Species: B. recurrentis Geographical Distribution and Habitat of Borrelia recurrentis Borrelia recurrentis is the cause of relapsing fever, with distinct patterns of prevalence based on hygiene, environmental factors, and the vectors involved. Morphology of Borrelia ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Botanical nomenclature? Importance of scientific names Scientific names are crucial for accurately identifying and classifying plants and organisms. Here are key reasons why they are essential: Common name and its problems Common names, while widely used, present several issues that complicate plant identification and communication. These problems arise from their variability, lack of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Botulism Food Poisoning? Botulism food poisoning is a severe and potentially life-threatening illness caused by the consumption of food contaminated with botulinum neurotoxins (BoNTs). Here are the key points about botulism food poisoning: Preventing botulism food poisoning involves proper food handling and storage practices, such as ensuring adequate heat treatment during cooking, avoiding ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Bovine spongiform encephalopathy? Sources and causes of contamination of Bovine Spongiform Encephalopathy (BSE) Pathogenic mechanism of Bovine Spongiform Encephalopathy (BSE) Signs and symptoms of Bovine Spongiform Encephalopathy (BSE) Epidemiology of Bovine Spongiform Encephalopathy (BSE) Diagnosis of Bovine Spongiform Encephalopathy (BSE) Treatment and Vaccination Prevention and control measures of Bovine Spongiform Encephalopathy (BSE) Prevention ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

This solution is mainly used to determine the concentration of proteins in solution.

Rosenow developed a medium that could be used to cultivate streptococci using a dextrose broth and brain tissue in 1919. Hayden modified Rosenow's formula and found that crushed marble promoted the growth of dental pathogens. The current formulation uses infusions from calf brain instead of brain tissue, and disodiumphosphate has been replaced by calcium carbonate.

In the previous article, I have already discussed What is Microbiology?  And History Of Microbiology. In this article, we will discuss Different branches of Microbiology and their purpose. What is Microbiology? Microbiology is an advanced biology course that studies unicellular (single cell), multicellular (cell colony), or acellular (lacking cells) microorganisms, including bacteria, archaea, algae, fungi, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

In this article we will discuss about the different methods for Breeding Cross-pollinated species What are Cross-pollinated species? Cross-pollinated species are plants that require pollen from a different individual of the same species to achieve fertilization and produce seeds. This process contrasts with self-pollinated species, where a single plant can fertilize itself. Cross-pollination is essential ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Introduction of Industrial microbiology History and Development in industrial microbiology The history of the evolution of industrial microbiology can be neatly categorised into three time periods: Since antiquity, many of man’s domestic processes have relied on fermentative changes. For instance, the first bread was made circa 4000 B.C. Moreover, wine was made from grapes, and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Bright Field Microscope? Bright Field Microscope Definition The Brightfield Microscope, often termed the Compound Light Microscope, is an optical instrument that utilizes light rays to produce a dark image against a bright background, primarily used in biological studies to observe stained specimens. Principle of Brightfield Microscope The Brightfield Microscope operates on a foundational ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

As a primary plating medium, Brilliant Green Agar medium should be used to isolate Salmonella species. Kristensen and colleagues first described it as a selective isolation medium to Salmonella species. Kristensen et al. first described it as a selective isolation medium for Salmonella species. Kauffmann modified the formula to make it a highly selective plating media for the isolation and identification from salmonellae in feces, other pathological material, food and dairy products. Brilliant Green Agar should always be used in conjunction with other selective plating media like Deoxycholate Citrate Agar and Hektoen Enteric Agar. Salmonella Typhi is treated with Bismuth Sulphite.

What is Broodstock Management? Objective of Broodstock Management Broodstock management is essential for optimizing fish breeding practices, particularly in aquaculture systems. The objectives of effective broodstock management encompass several key areas, all aimed at enhancing fish production and ensuring sustainability. The following points detail these objectives: Selection procedure of brood fish The selection procedure for ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Brucella? Scientific classification of Brucella Domain: Bacteria Phylum: Pseudomonadota Class: Alphaproteobacteria Order: Hyphomicrobiales Family: Brucellaceae Genus: BrucellaMeyer and Shaw 1920 (Approved Lists 1980) Geographical Distribution and Habitat of Brucellosis Brucellosis is a globally distributed infection with varying prevalence depending on the region. Its geographic reach spans multiple continents, with certain areas being more ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Brucella is an intracellular parasite which causes epizootic abortions for animals, and septicemic febrile disease or localized infections of tissues, bones or organ systems of humans. Brucella species are very meticulous and require a rich nutrient environment to develop. Additionally, Brucella species are highly infectious, and therefore extreme caution should be exercised when handling.

What are Bryophytes? Bryophytes definition Bryophytes plants are plants that can be found growing in damp and shaded areas. These plants are unique because they can live on soil and bare rocks. They are an integral part of plant succession on bare rock. They exhibit alternation of generations and are known by a unique name. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Proposed syllabus and Scheme of Examination for B.Sc. (Honors) Microbiology. The B. Sc. Honours Microbiology program under the Choice Based Credit System (CBCS) is meticulously designed to provide students with a comprehensive understanding of microbiology. This program includes a mix of core courses, discipline-specific electives, generic electives, ability enhancement courses, and skill enhancement courses. Below ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is BT Cotton? What is BT? Bt, short for Bacillus thuringiensis, is a widely recognized soil bacterium known for its insecticidal properties. This gram-positive and spore-forming bacterium produces unique parasporal crystals during its stationary growth phase, which play a crucial role in pest management. Features of Bt Cotton The following points highlight the key ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Bt Crops? Definition of Bt Crops Bt crops, or Bacillus thuringiensis crops, are genetically modified plants that incorporate genes from the bacterium Bacillus thuringiensis. These crops produce specific proteins (Cry proteins) that are toxic to certain insect pests, providing built-in protection against infestations. Common examples include cotton, corn, and brinjal. Bt crops reduce ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Budding? Definition of Budding Budding is a form of asexual reproduction in which a new organism develops from an outgrowth or “bud” on the parent organism, eventually detaching to live independently. Types of Budding Budding is a form of asexual reproduction wherein a new organism develops from an outgrowth or “bud” on the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Bulk Method? Definition of Bulk Method The bulk method, developed by Nilsson-Ehle in 1908, is a plant breeding technique where large quantities of plants from the F1 generation and subsequent generations are grown in bulk. Individual plants are only selected and evaluated after a prolonged bulking period, distinguishing it from methods like the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is a Bunsen Burner? Definition of Bunsen Burner A Bunsen burner is a laboratory gas burner that produces a controlled flame for scientific experiments and research purposes. Principle of Bunsen burner The Bunsen burner, a staple in scientific laboratories, operates on foundational principles of combustion and gas mixing. Constructed predominantly from metal, the burner ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Burkholderia cepacia can be viewed as an opportunity-based bacterium that is associated with nosocomial illnesses caused by contamination of medical equipment and disinfectants. However, the highest risk group is CF patients. People with cystic fibrosis are at an increased risk of infection. those with the infection, if not treated are prone to rapid declines of lung functions, frequent bacteremia and even death due to lung dysfunction.

Overview of Butyrate Test Test Name Butyrate Disk Test Detection Enzyme butyrate esterase Uses This is a quick way to find out if Moraxella catarrhalis has the enzyme butyrate esterase. Result A blue colour development Require Bromochloro-indolyl butyrate and 4-methylumbelliferyl impregnated discs Test Organism Moraxella catarrhalis ATCC 25240: butyrate positive Butyrate Disk Test Purpose Principle ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Calcium Chloride Stock Solution Preparation Calcium chloride is a common calcium salt used in a variety of applications. To prepare 1L of Calcium Chloride Stock Solution the following components are required. Component Amount Concentration CaCl2 (mw: 110.98 g/mol) 58 g 0.5226 M Preparation procedure Prepare 800 mL of distilled water in a suitable container. Add ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

In 1961, Darken reported the uptake of calcofluor white, a fluorescent brightener, by actively growing yeasts and higher fungi. Hageage and Harrington outlined the application of calcofluor white (CFW) to demonstrate hyphae and yeasts in clinical specimens. Monheit et al. utilised this dye for intraoperative identification of fungal infection on frozen sections of lung and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Calvin Cycle? The Calvin Cycle, also known as the C3 cycle or Calvin-Benson cycle, is a critical biochemical process in photosynthesis that enables plants to convert carbon dioxide into organic compounds, primarily glucose. Named after Melvin Calvin, who discovered the pathway in the 1950s, this cycle occurs in the stroma of chloroplasts in ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

CAMP Test was first discovered by four researchers Christie, Atkins, Munch, and Peterson in 1944, that’s why this test is also known as Christie–Atkins–Munch-Peterson test.

Campylobacter blood agar (CVA), is a selective medium that allows for the primary isolation from stool specimens of Campylobacter Jejuni. Dekeyser et al. Dekeyser et al. reported that Campylobacter jejuni was isolated from patients suffering from diarrhea and acute gastroenteritis using a filtration method and a selective media with antimicrobials. Skirrow, however, reported that a select medium containing three antimicrobics was used for isolation. Blaser and colleagues reported that they were able to isolate C. jejuni from feces using a selective medium that contained four antimicrobials: amphotericin (vancomycin), polymyxin B and trimethoprim. Reller et al. in 1983 also introduced a better selective medium containing cefoperazone and Vancomycin. This combination of antimicrobials allowed for better suppression of normal fecal bacteria, thereby allowing for better isolation of C.jejuni from the fecal specimen.

What is Campylobacteriosis? Campylobacteriosis is a common bacterial infection that primarily affects the gastrointestinal tract, leading to gastroenteritis. Here is some information about campylobacteriosis: Efforts to prevent campylobacteriosis focus on ensuring food safety, particularly in relation to poultry products, by implementing good hygiene practices during production, processing, and preparation. Public awareness campaigns about safe food ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The water circulation system of sponges, also known as canal system, is the defining property of the phylum Porifera. The system of canals is also known as the auriferous system. The sponge canal system aids in food uptake, respiratory gas exchange, and excretion. Many pores on the body surface of sponges allow for the admission ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Cancer Cell? Definition of Cancer Cell A cancer cell is an abnormal cell that divides uncontrollably, ignores natural growth regulation, and can invade surrounding tissues or spread to other parts of the body. Characteristics of Cancer Cells Characteristics of Cancer Cells Cancer cells are fundamentally different from normal cells in ways that make ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Cancer Immunotherapy? Manipulation of Co-Stimulatory Signals Can Enhance Immunity Enhancement of APC Activity Can Modulate Tumor Immunity Cytokine Therapy Can Augment Immune Responses to Tumors Interferons Tumor Necrosis Factors  In Vitro–Activated LAK And TIL Cells  Treatment with Monoclonal Antibodies Key Facts

What is Candida albicans? Kingdom: Fungi Division: Ascomycota Class: Saccharomycetes Order: Saccharomycetales Family: Saccharomycetaceae Genus: Candida Species: C. albicans Habitat of Candida albicans Candida albicans is a form of yeast commonly found as part of the human body’s normal microbial flora. It is known to inhabit various body segments, particularly mucous membranes and moist regions. Here are ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Kingdom: Fungi Division: Ascomycota Class: Saccharomycetes Order: Saccharomycetales Family: Saccharomycetaceae Genus: Candida Species: C. glabrata What is Candida glabrata? Habitat of Candida glabrata Candida glabrata is a common yeast found in a variety of habitats, including human hosts and the environment. Here are the principal environments in which Candida glabrata is found: Morphology of Candida glabrata Candida glabrata ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Kingdom: Fungi Division: Ascomycota Class: Saccharomycetes Order: Saccharomycetales Family: Saccharomycetaceae Genus: Candida Species: C. parapsilosis What is Candida parapsilosis? Taxonomy of Candida parapsilosis The taxonomy of Candida parapsilosis is as follows: Candida parapsilosis belongs to the kingdom Fungi and the phylum Ascomycota, which includes a diverse group of fungi. It falls under the class Saccharomycetes, which ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Kingdom: Fungi Division: Ascomycota Class: Saccharomycetes Order: Saccharomycetales Family: Saccharomycetaceae Genus: Candida Species: C. tropicalis Habitat of Candida tropicalis Candida tropicalis is a yeast species that inhabits a variety of natural environments and the human body. Here are some typical environments where Candida tropicalis is found: Morphological features of Candida tropicalis Candida tropicalis is a yeast species with ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Candidiasis, also known as a yeast infection, is a fungal infection caused by a group of yeasts called Candida. Candida is a normal part of the human microbiota and is commonly found in the mouth, gut, and female genital tract. However, when there is an overgrowth of Candida, it can cause infection. Candidiasis can occur ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Candidiasis Properties Pathogenesis and Immunity  Candida spp. are typically present as part of the normal flora on the oral cavity, gastrointestinal system, and vaginal mucosa. Candida exhibits colonisation at these sites in over 80% of healthy individuals. However, the organism is rarely seen on the surface of normal human skin, with the exception of the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Capillary Electrophoresis (CE) is a type of electrophoresis technique that uses a narrow capillary to separate charged molecules (ions) based on their migration towards electrodes under the influence of an electric field. It is a high-resolution and fast method for the analysis of small molecules, DNA, and proteins. The importance of CE lies in its ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Capsule staining is a differential staining method, where two different stains are used such as the primary stain and the counterstain.

Carbenicillin is an ampicillin analog with structure related to benzyl penicillin. It is effective against Gram-negative bacteria and exhibits limited activity against Gram-positive bacteria. Carbenicillin binds and inhibits the enzymes involved in the synthesis of bacterial cell wall. Since carbenicillin is less sensitive to β-lactamases than ampicillin, it is effective against ampicillin-resistant bacteria. It has ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The carbohydrate fermentation test can be used to determine if bacteria are able to ferment a certain carbohydrate. It is a test to determine any presence of acids or gas resulting from carbohydrate fermentation.

What are carbohydrates? Types of carbohydrates Carbohydrates can be broadly categorized into three primary types: monosaccharides, disaccharides and oligosaccharides, and polysaccharides. What Is Sucrose? Sucrose is the most prevalent disaccharide found in nature and serves as a principal product of photosynthesis in plants. This sugar is classified as a non-reducing sugar, which limits its chemical ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Carbohydrates? Definition of Carbohydrates Carbohydrates are organic molecules made of carbon, hydrogen, and oxygen that serve as a major source of energy in living organisms. They include sugars, starches, and fibers and are classified into monosaccharides, disaccharides, oligosaccharides, and polysaccharides. Carbohydrates play key roles in energy storage, structural support, and various biological processes. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Carbohydrate? Definition of Carbohydrates Carbohydrates are carbon-based compounds that serve as a source of energy and play important roles in the structure and function of living organisms. Structure of Carbohydrates Monosaccharides Monosaccharides are fundamental units of carbohydrates and are often referred to as simple sugars. They play essential roles in various biological processes ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Carbon cycle Definition Carbon cycle is the process by which carbon compounds move between the earth’s atmosphere, biosphere, geosphere, pedosphere, and hydrosphere. Properties of Carbon Physical Properties of Carbon Chemical Properties of Carbon Steps of Carbon Cycle  1. Carbon in the Atmosphere 2. Producers Absorb Carbon 3. Producers are Eaten 4. Decomposers Release Carbon 5. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Carbon Fixation? Carbon Fixation Definition Carbon fixation is a biological process where atmospheric carbon dioxide (CO2) is converted into organic compounds, primarily by plants, algae, and certain bacteria. This process is a key component of photosynthesis, enabling the incorporation of inorganic carbon from the atmosphere into organic molecules like carbohydrates, thereby playing a ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Carbon Monoxide Poisoning? Pathophysiology of Carbon Monoxide Poisoning The pathophysiology of carbon monoxide (CO) poisoning involves complex interactions within the body that result in severe physiological disturbances. The following points summarize the key aspects of how carbon monoxide affects human health: Toxicokinetics of Carbon Monoxide Poisoning The toxicokinetics of carbon monoxide (CO) poisoning ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Heart Conduction System? Components of Heart Conduction System The heart conduction system is a specialized network that plays a critical role in maintaining the heart’s rhythm and ensuring effective blood circulation throughout the body. This system consists of various components, each with unique functions that contribute to the synchronized contraction of the heart ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Cardiac Cycle? Cardiac Cycle Phases The cardiac cycle refers to the sequence of events that occurs from the beginning of one heartbeat to the beginning of the next. This cycle consists of two primary phases: ventricular contraction, known as systole, and ventricular relaxation, referred to as diastole. Each of these phases can be ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Cardiac Output? What is Cardiac Index? Cardiac Index (CI) is a crucial measure in cardiovascular physiology that expresses cardiac output in relation to the individual’s body surface area (BSA). This index provides a more accurate understanding of heart function by accounting for the size of the person, making it a more individualized and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Career In Microbiology, Microbiology has generated a whole lot of buzz from the previous few years resulting in a rush within the variety of college students who need to pursue this discipline as a profession. In easy phrases, microbiology is a broad self-discipline of biology with works with the perform, construction, makes use of, and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Carrier of microbiologists, Microorganisms together with their actions are essentially vital to all processes on earth. Micro-organisms are in us, on us, and around us. Because they have an effect on each facet of our lives- thus they matter. Microbiology includes the examination of all dwelling organisms which can be too minute to be seen ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Cartilage? Definition of Cartilage Cartilage is a semi-rigid and flexible connective tissue found in various parts of the body, such as joints, nose, and ears. It is tough, yet pliable, and provides structural support, cushioning, and smooth surfaces for joint movement. Location of Cartilage Characteristics of Cartilage Structure of Cartilage Cartilage consists of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Cary-Blair Transport Medium is simple, semi-solid, and non-nutritive medium that is used to collect and storage of samples of microbiological organisms. The low levels of nutrients in the medium aid in the life of the organisms, without multiplication. The semisolid consistency facilitates the ability to transport easily and the medium is able to be stored for up to a year after its preparation at temperatures of room temperature. Cary-Blair Transport Medium is a modification to Stuart's Medium which is comprised of a more effective buffering system that replaces sodium glycerophosphate by organic phosphates. This new formulation helps prevent the growth of Enterobacteriaceae and aids in the long-term conservation for Salmonella as well as Shigella for extended durations. It is employed for the transport of clinical specimens believed to have enteric pathogenssuch as Shigella, Salmonella, Vibrio Cholerae, and Escherichia Coli O157 H7.

Name  Cas9 endonuclease Alternative name spCas9/spyCas9 Organism  Streptococcus pyogenes serotype M1 Molecular weight ~163KDa Gene  cas9 Location on chromosome 0.85 to 0.86Mb Protein CRISPR-associated endonuclease Cas9/Csn1 Cofactor Mg2+ Biological processing  Interference- defense response to phage.Maintaining CRISPR repeat sequences Functions DNA and RNA bindingMetal ion binding3’-5’ exonuclease activityEndonuclease activity  What is Cas9 Protein? Structure of Cas9 HNH ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Test Name Casein Hydrolysis Test Detection Enzyme caseinase producing microorganisms Uses To show that some microorganisms can make enzymes outside of their cells that can break down the milk protein casein. Result A clear, transparent zone can be seen around the area where the colonies are growing, or sometimes under the area where the colonies ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The catalase test is a type of biochemical test which is used to detect the production of catalase enzymes in the organism.

What is Cation Exchange Chromatography? Cation Exchange Chromatography Principles The principles of cation exchange chromatography are based on the net surface charge of proteins and the concept of isoelectric point (pI). The net surface charge of a protein can change with the pH of the surrounding environment. The pI of a protein refers to the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is cDNA cloning? Definition of Complementary DNA or cDNA Complementary DNA (cDNA) is a form of DNA synthesized from a messenger RNA (mRNA) template through the action of the enzyme reverse transcriptase. It represents the coding sequence of genes and is commonly used in gene cloning and expression studies. cDNA Cloning Definition cDNA cloning ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is cDNA library? Principle of cDNA library Process involved in the construction of cDNA library 1. Extraction of mRNA from the eukaryotic cell 2. cDNA construction In the process of creating cDNAs, there’s different approaches. They are described as follows: a. The RNAse method Step I: Annealing: Step II: Replacing RNA strand with DNA ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is cDNA?  cDNA synthesis principle cDNA synthesis steps There are different steps for synthesis of cdna such as; cDNA synthesis protocol  1. Prepare sample 2. Remove genomic DNA 3. Select reverse transcriptase Common reverse transcriptases and their attributes.   AMV reverse transcriptase MMLV reverse transcriptase Engineered MMLV reverse transcriptase(e.g., Invitrogen SuperScript IV Reverse Transcriptase) RNase ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Cell? Definition of Cell A cell is the basic structural and functional unit of all living organisms, responsible for various life processes and containing essential biological molecules. Discovery of Cells – Who discovered cells? Origins of Cells The inception of cells is intrinsically linked to the genesis of life, marking the commencement of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is a Cell? Definition of Cell A cell is the smallest, basic unit of life that performs essential functions such as growth, reproduction, and energy processing, and serves as the structural and functional building block of all living organisms. Discovery of Cells The discovery of cells marked a turning point in biological science, revealing ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Cell biology is the study of cells, their physiological properties, structures, organelles, interactions, and behavior. It examines how cells function individually and in groups, including processes like cell division, communication, and metabolism. Cell biology is essential for understanding the fundamental unit of life and how cells contribute to the overall functioning of organisms. This field ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Cell Coat Definition Extracellular Materials Cell Coat Function In addition to safeguarding the plasma membrane, the cell coat serves the following essential purposes: (i) Filtration (ii) Maintenance of the micro-environment of the cell (iii) Enzymes (iv) Immunological properties of the extraneous coats (v) Histocompatibility

What is Cell Compartmentalization? Types of Cellular Compartments Cellular compartments are essential for maintaining the organization and efficiency of eukaryotic cells. These compartments are specialized regions that facilitate specific functions by maintaining unique internal environments. The primary types of compartments include: Major Cellular Compartments Cellular compartments, or organelles, play vital roles in maintaining the structure ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Cell Cycle? Definition of Cell Cycle The cell cycle is a series of sequential events that occur in a cell, leading to its growth, DNA replication, and division into two daughter cells. It consists of interphase, where the cell prepares for division, and the M phase, which includes mitosis and cytokinesis. This process ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Cell Differentiation? Definition of Cell Differentiation Cell differentiation is the process by which unspecialized cells, like stem cells, transform into specialized cells with distinct structures and functions, enabling the development and maintenance of complex tissues and organs in multicellular organisms. Factors Influencing Cell Differentiation In multicellular organisms, several key factors influence cell differentiation, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The term "cell disruption" refers to the method that allows intracellular fluid through methods that break the cell wall. The main goal of the process of cell disruption is gain intracellular fluid without altering its components. The method used can differ dependent on the type of cell as well as the structure of its cell wall.

What is Cell Division? Definition of Cell Division Cell division is the process by which a single cell divides to produce two or more new cells, essential for growth, repair, and reproduction in living organisms. Discovery of Cell Division The discovery of cell division is a fundamental aspect of cellular biology, providing insights into the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Cell Fusion? Types of Cell Fusion Cells can fuse in one of two ways. Both homotypic and heterotypic cell fusion fall into this category. 1. Homotypic cell fusion 2. Heterotypic cell fusion 3. Other types of cell fusion There are several different types of cell fusion that can occur in both plant and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Growth Definition Levels of Growth  There are two distinct stages of growth in living organisms: A. Cell growth B. Growth of multicellular organisms The growth of multicellular animals and plants in connection to the growth and multiplication of their individual cells can be divided into three distinct categories: (1) Auxetic growth (Auxesis = growth resulting ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Cell-Mediated Immunity Definition CMI is an unique sort of acquired immune response that is not mediated by antibodies but rather by sensitised T cells. This type of immunity is passed from donor to recipient without the need of antisera, but rather with intact lymphocytes; therefore, it is referred to as cell-mediated immune reaction. Contrary to ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Cell membrane or Plasma Membrane? Definition of Cell membrane or Plasma Membrane The cell membrane, also known as the plasma membrane, is a semi-permeable biological barrier that surrounds and protects the cell’s interior from the external environment, regulating the passage of molecules in and out of the cell. Cell Membrane Composition  The cell ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The cell membrane is a biological membrane which also termed a plasma membrane (PM) or cytoplasmic membrane. It divides the interior of the cell from the outside environment, thus protects the cell from environmental stress. The cell membrane is a lipid bilayer, contains cholesterols between phospholipids which maintain their fluidity at various temperatures. The membrane ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Your body is currently doing a lot of things simultaneously. Your body is sending electrical impulses, pumping blood and filtering urine.

What is Cell proliferation? What is Normal cell proliferation? The delicate balancing act between cell growth, division, differentiation, and death is what allows for normal cell proliferation, an essential function in the body. Diseases can be caused by disruptions in any of these systems, thus they’re all crucial. Proliferation and apoptosis are two processes that ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Cell Signaling? Three Stages of Cell Signaling Cell signalling can be defined simply as the creation of a “signal” by a single cell. The target cell then receives this signal. In actuality, signal transduction is stated to involve three phases: Types of Cell Signaling Pathways Cell signalling plays a crucial role in enabling ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

A cell is like the tiny building block that makes up all living things, from plants and animals to bacteria. Imagine it as a microscopic bag filled with stuff that keeps life going. Every cell has a thin outer layer called a membrane, which holds everything inside and controls what goes in or out. Inside, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Cell Theory? Definition of Cell Theory The cell theory is a fundamental principle in biology that states all living organisms are composed of cells, cells are the basic units of life, and all cells arise from pre-existing cells. 3 Parts Of Cell Theory – The three principles of cell theory The cell theory, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is a Cell Wall? Cell Wall Definition A cell wall is a rigid and protective outer layer found in plants, fungi, bacteria, and some protists, providing structural support and protection to the cell. Properties of Cell Wall The cell wall is a crucial component of many organisms, including plants, fungi, algae, and certain prokaryotes. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Adcrustation refers to a biological process where a substance grows from within, expanding the entire structure without any surface layers being added. Essentially, growth happens throughout the substance itself. A common example is the growth of fruits, where the increase in size and mass occurs internally as the entire structure expands, rather than by the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The composition of cell wall varies from species to species, it has been reported that the main constituents of cell wall is chitin, hemicellulose, and cellulose. In addition, prokaryotic cell wall contains peptidoglycan (also known as murein and mucopeptide). Peptidoglycan is mainly composed of sugar, amino acids (peptide; amino acids + glycan; sugar).

Archaeal Cell Wall Introduction One Membrane Archaea Double Membranes of Archaea  What is S-Layer? The S-layer, or surface layer, is a fundamental component of the cell envelope in many archaea and some bacteria. It represents one of the most common cell wall variations, particularly among Crenarchaea. This layer consists primarily of proteins that self-assemble into ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Cell wall synthesis inhibitors? Cell wall synthesis inhibitors encompass antibiotics like β-lactams and glycopeptides. These antibiotics play a crucial role in treating infections by targeting the bacterial cell wall, an essential structure for bacterial survival. Understanding the mechanisms and types of these inhibitors provides insight into their therapeutic applications. β-Lactam Antibiotics β-lactam antibiotics ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The immune system is a complex network of organs, tissues, and cells that work together to keep the body healthy and protect it against outside intruders. Among the numerous components of the immune system, immune system cells play an important role in identifying and removing dangerous chemicals. Primary lymphoid organs and secondary lymphoid organs are ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Cellular Junctions or Cell junction? Definition of Cellular Junctions or Cell junction Cellular junctions, or cell junctions, are specialized structures in eukaryotic cells that facilitate adhesion and communication between adjacent cells or between a cell and the extracellular matrix. These junctions are essential for maintaining the structural integrity of tissues and enable coordinated ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Cellular Respiration? Cellular respiration is a vital metabolic process that occurs within cells, enabling the conversion of energy stored in carbohydrates into energy carriers, most notably adenosine triphosphate (ATP). Cellular respiration can occur in the presence or absence of oxygen. When oxygen is available, it is referred to as aerobic respiration. This process ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

In this article, we will learn about the Cellular Structure of Algae with diagrams. Algae are photosynthetic plants that vary in size and shape. Their size ranges from microscopic to over 50 meters in length. Based on the structural variations there are present different phyla or divisions of algae. Cell Wall Plasma membrane The Protoplast ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Cellulose Acetate Electrophoresis (CAE) is a method of separating charged molecules, including proteins, based on their charge and size. It uses a cellulose acetate sheet as a medium for separation, and an electrical current to move the molecules through the medium. The charged molecules are separated based on their migration rate through the cellulose acetate ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

DNA is the full genetic information that determines the nature and function that an animal has. Proteins are made by the genetic code contained in DNA. Conversion of DNA encoded data to RNA is necessary to make proteins. So, in the majority of cells, genetic information is transferred from - DNA to RNA, and then to protein. The transfer of information is controlled by three different processes that help in the transfer of genetic information as well as its transformation into a different form:

What is Centrifugal force? Definition of Centrifugal force Centrifugal force is an outward fictitious force experienced by objects moving in a circular path, directed away from the center of rotation. Centrifugal force formula The centrifugal force can be calculated using different formulas depending on the available information. If the velocity (v) of the moving object ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Centrifugal Separators? Working Principle of Centrifugal Separator  What Can a Centrifugal Separator Separate? Instrumentation/Parts of Centrifugal Separators Centrifugal separators have these major parts: Types of Centrifugal Separators Operating Procedure of Centrifugal Separators Uses of Centrifugal Separator Advantages of Centrifugal Separators Limitations of Centrifugal Separators Areas of Application of Centrifugal Separators Tips to Improve ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Centrifugation of blood  The process of dividing whole blood into its components is known as blood separation. For research purposes, diagnostic and therapeutic reasons as well as research, whole blood may be separated. Scientists may employ several blood separation methods to achieve this. Blood separation machines that spin at high speeds exert a centripetal force, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Centrifuge? Definition of Centrifuge A centrifuge is a laboratory instrument that uses spinning and centrifugal force to separate mixtures based on their density. Who first invented the Centrifuge? Principle of a Centrifuge Sedimentation coefficient Factors Affecting Sedimentation coefficient Parts of a Centrifuge The main parts of a centrifuge include: A centrifuge is a ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are the components of blood? Blood is a fluid tissue that circulates throughout the body and performs a number of important functions. It is made up of several components, including cells and plasma. Cells: Plasma: Plasma is the liquid portion of the blood that carries the cells and other substances throughout the body. It ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is a Centrifuge tube? Characteristics of Centrifuge tube Composition material of Centrifuge tube Types of Centrifuge tube Centrifuge tube sizes Top centrifuge tubes Company There are many companies that manufacture and sell centrifuge tubes. Here are a few examples of well-known companies in the field: Applications of centrifuge tubes What to consider when choosing ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Centrioles? Definition of Centrioles Centrioles are cylindrical, microtubule-based structures found in most eukaryotic cells, playing a crucial role in cell division by aiding in the formation of the spindle apparatus and in cellular processes like the formation of cilia and flagella. They are typically composed of nine sets of microtubule triplets and lack ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

A centrosome is an organelle present in eukaryotic cells that serves as the main microtubule organizing center. It is composed of two centrioles, which are cylindrical structures made up of microtubules arranged in a nine-fold symmetry, and a matrix of proteins that surround and support the centrioles. The centrosome plays a critical role in various ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Classification of Cephalochordata Kingdom Animalia Superphylum Deuterostomia Phylum Chordata Subphylum Cephalochordata Characteristics of Cephalochordate Morphology of Cephalochordate Feeding of Cephalochordate Systematic Resume The systematic resume of the subphylum Cephalochordata provides an overview of the classification and distribution of the two genera within the family Brachiostomatidae. The subphylum Cephalochordata consists of a single family known as ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Cereals? Major cereal crops Cereal crops are pivotal in human nutrition and have been integral to civilizations throughout history. They are among the earliest plants to have been domesticated, with their cultivation closely associated with the development of agricultural societies. This narrative provides an overview of the major cereal crops, their significance, and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Cetrimide, a quaternary salt of ammonium, acts as a detergent that lowers the surface tension at the point-of-contact. It also has precipitant, complexing, and denaturing effects upon bacterial membrane proteins. It has inhibitory properties on many microorganisms, including Pseudomonas species that are not Pseudomonas. Lowburry was the first to develop cetrimide agar. It is a modified version of Tech Agar (developed in King et al. For the selective inhibition other than Pseudomonas, aeruginosa, 0.1% cetrimide (cetyltrimethyl ammonium bromide), was added. Cetrimide agar can be used to presumptive identify and selectively isolate Pseudomonas.aeruginosa species from both clinical and nonclinical specimens.

Cetrimide Selective Agar is a solid medium that is recommended for use in qualitative procedures for selective isolation and presumed identification of Pseudomonas aeruginosa and other nonfermenting, gram-negative bacilli.

The cGMP pathway, short for cyclic guanosine monophosphate pathway, is a crucial signaling mechanism in cells. It involves the synthesis of cGMP from GTP (guanosine triphosphate) through the action of the enzyme guanylate cyclase. cGMP acts as a secondary messenger, similar to cyclic AMP (cAMP), and plays a vital role in various physiological processes. One ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Channel Protein? Types of Channel Protein There are present 2 types of channel protein such as; 1. Non-gated Channel 2. Gated Channel Structure of Channel Protein  Function of Channel Protein  Channel Proteins and Carrier Proteins Example of Channel Protein Chloride channel Potassium channel Calcium channel Sodium channel References

Genetic code refers to the rules which the linear nucleotide sequence identifies what is the linear structure of the polypeptide. This means that they define what sequences of nucleotides in an mRNA transformed to the amino acid sequence in the polypeptide.

Muscle twitch, the brief and transient contraction of a muscle fiber, is a fundamental event in muscle physiology. Understanding the characteristics of muscle twitches provides insights into the intricate mechanisms that govern muscle function. This article delves into the key aspects of muscle twitch, focusing on motor units, summation, and tetanus. Muscle twitches are initiated ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

In this article, we will discuss some important characters of algae. Algae is a photosynthetic eukaryotic organisms. They can be found everywhere such as soil, water, rocks, sands, etc. But most of them grow in the aquatic environment. Here is the some General Characters of Algae – Characters of Algae 1. Occurrence 2. Thallus organization ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

In 1984, Bolton et al. Bolton et al. (1984) suggested that charcoal could be used to replace blood in a medium for the isolation of Campylobacter species. Endtz et al. Later, it was confirmed that Campylobacter isolates at a higher rate when using charcoal selective media.

What is Chargaff’s Rules? Definition of Chargaff’s Rules Chargaff’s Rules are two fundamental principles discovered by biochemist Erwin Chargaff, which dictate the base pairing in DNA. The first rule states that in DNA, the amount of adenine (A) is equal to thymine (T), and the amount of cytosine (C) is equal to guanine (G). The ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Charophyta? General Characteristics of Charophyta Below are the key characteristics that define Charophyta: Occurrence of Charophyta Charophyta, particularly the genus Chara, is prevalent in various aquatic environments, primarily thriving in freshwater ecosystems. Understanding the occurrence of charophytes provides insight into their ecological roles and adaptability to diverse habitats. The following points outline the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is a Checkpoint? The Cell Cycle Engine The cell cycle engine is a complex regulatory system that orchestrates the processes of cell growth and division in eukaryotic cells. This engine primarily consists of cyclin-dependent protein kinases (Cdks) and their regulatory subunits known as cyclins. These components play a pivotal role in controlling the progression ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Cheek cells, fascinating eukaryotic entities, grace the lining of our mouths. These microscopic wonders boast a distinct structure that encapsulates a world of biological marvels within their tiny boundaries. Thanks to their ease of shedding, acquiring them for observation has become a simple yet enlightening endeavor. Within the confines of these small entities, a realm ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Chemical Method of sterilization Characteristics of an ideal Chemical Antimicrobial agent or disinfectant A chemical antimicrobial agent should contain the following characteristics; How to Select An Ideal Chemical Agent for Practical Application? There are three major factors that need to be assessed in the process of selecting the most appropriate chemical agent for a specific ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Chemical oxygen demand, or COD, indicates the amount of oxygen that can be used by processes in a measured solution. It is often expressed as the mass of oxygen utilised per unit of solution volume, or milligrammes per litre (mg/L) in SI units. The most common application of COD is determining the quantity of oxidizable ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Chemogeny? 1. Origin of Earth’s Primitive Atmosphere 2. Formation of Simple Inorganic Molecules (Water, Ammonia and Methane) The formation of simple inorganic molecules, such as water, ammonia, and methane, played a significant role in the chemical evolution of the primitive Earth. During the early stages, when the surface temperature of the Earth was less ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Chemosynthesis involves the conversion of carbon compounds as well as others molecules to organic substances. In this biochemical process, methane, or an inorganic compound like hydrogen sulfide or gas, is converted into a form that can serve as an energy source. However, the photosynthesis process’s energy source (the series of reactions in which water and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Chi-square Test? Formula of chi-square The Chi-square test is symbolically represented as , and the formula for comparing variances is: Where: Similarly, when the Chi-square test is used as a non-parametric test for goodness of fit or testing independence, the following formula is applied: Where: Properties of the Chi-Square Test The Chi-Square test ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Chlamydia Human infections caused by Chlamydia species Bacteria Diseases Chlamydia trachomatis Lymphogranuloma venereum, ocular lymphogranuloma venereum, trachoma, adult inclusion conjunctivitis, neonatal conjunctivitis, infant pneumonia, and urogenital infections Chlamydophila pneumoniae Pharyngitis, sinusitis, bronchitis, and pneumonia Chlamydophila psittac Psittacosis General Properties  There are two morphologically distinct forms of chlamydiae: elementary body and reticulate body. Elementary body Reticulate ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Chlamydia? Distribution of Chlamydia species Chlamydia species have a wide distribution across the world, and their prevalence varies in different regions. The family Chlamydiaceae, which includes the genus Chlamydia, is believed to have originated from the Order Chlamydiales approximately seven million years ago. However, evidence of Chlamydia trachomatis infections has been found dating ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Chlamydomonas is a tiny, single-celled green algae you’d likely find in ponds, soil, or even damp tree bark. Imagine a microscopic organism shaped like a oval, sporting two whip-like tails called flagella that let it zip through water. What’s cool about it? Despite its simplicity, it’s a powerhouse in science. Researchers love studying it because ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Chlorophyta? Important features of Chlorophyta Below is a detailed breakdown of the key features of Chlorophyta: Cell structure of Chlorophyta Chlorophyta, or green algae, exhibit a wide range of structural features at the cellular level, which contribute to their adaptability and function in diverse environments. Below are key structural elements that define their ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The term "chloroplast" is derived of the Greek words chloros, which translates to green and also plastes which refers to "the one who forms". Chloroplasts are membrane-bound plastids which have membranes that are embedded in a liquid matrix.

It was originally used as an antimalarial compound. It kills the erythrocytic forms of malaria parasites at all stages of development but does not affect the sporozoites.

Chocolate Agar (CAP or CHOC) is a nonselective enhanced medium that is used to identify and isolate of pathogens that are fastidious.

Structure of B.Sc. Honours Botany under CBCS Course Category Courses Core Courses 1. Algae and Microbiology 2. Biomolecules and Cell Biology 3. Mycology and Phytopathology 4. Archegoniate 5. Morphology and Anatomy 6. Economic Botany 7. Genetics 8. Molecular Biology 9. Plant Ecology and Phytogeography 10. Plant Systematics 11. Reproductive Biology of Angiosperms 12. Plant Physiology ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

CORE COURSE CORE COURSE I – NON-CHORDATES I: PROTISTS TO PSEUDOCOELOMATES Unit 1: Protista, Parazoa, and Metazoa General characteristics and classification up to classes. Study of Euglena, Amoeba, and Paramecium. Life cycle and pathogenicity of Plasmodium vivax and Entamoeba histolytica. Locomotion and reproduction in Protista. Evolution of symmetry and segmentation in Metazoa. Unit 2: Porifera ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Kingdom Animalia Phylum Chordata Subphylum Vertebrata Division Gnathostomata Superclass Pisces Class Chondrichthyes Characteristics of Chondrichthyes Chondrichthyes, also known as Sharks, Skates, and Rays, exhibit a range of fascinating characteristics. Here are some key features of these jawed fishes: These characteristics contribute to the unique adaptations and biological traits of Chondrichthyes, making them a diverse and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

In 1979, Dr. A. Rambach invented and patented the first chromogenic medium for E.coli detection. This technology uses a color-based differentiation technique. It uses soluble colorless molecules, also known as chromogens. They are composed of a substrate that targets a specific enzyme activity and a chromophore. The chromophore can be released when the enzyme of the target organism cleaves the colorless, chromogenic conjugate. 

One of those methods you’ve most likely heard of in passing, particularly if you have ever dipped a toe into chemistry or seen a crime thriller where they examine unidentified drugs, is chromatography. Fundamentally, it’s a means of separating difficult combinations into their component elements. Imagine you want to know what’s really in there and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What do you mean by Chromoblastomycosis (Chromomycosis)? Chromoblastomycosis, also referred to as chromomycosis, is a chronic fungal infection of the epidermis and subcutaneous tissues. Multiple species of pigmented fungi, including Fonsecaea spp., Phialophora spp., Cladophialophora spp., and others, are responsible for this condition. The term “chromoblastomycosis” refers to the presence of pigmented chromoblasts, which are ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Chromosomal mutation? Definition of Chromosomal Mutation Chromosomal mutation refers to alterations in the structure or number of chromosomes within a cell, which can impact genetic information and potentially lead to various genetic disorders. Causes of Chromosomal Mutation Mechanism of Chromosomal Mutation Chromosomal mutations arise through various mechanisms that can be broadly categorized into ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Chromosome? What is Chromosomal Theory of Inheritance? Observations of Chromosomal Theory of Inheritance The Chromosomal Theory of Inheritance provided a clear link between the behavior of chromosomes and Mendel’s laws of inheritance. It was supported by a series of critical observations that connected chromosomal behavior during meiosis with the inheritance patterns Mendel described. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Chromosomes are a collection of tightly coiled DNA that are located in the nucleus of virtually every cell of our body. Humans possess 23 chromosome pairs.

A chromosome disorder, also known as Chromosome Abnormalities is caused by an alteration in the size or the structure of chromosomes.

What is Chromosome Mapping? Chromosome mapping is a pivotal technique in genetics that determines the relative positions of genes on a chromosome. This process involves creating maps that systematically organize and elucidate genetic information on chromosomes. These maps not only depict the positions of genes but also the distances between them, scaled to a specific ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Chronic granulomatous disease (CGD) Chronic granulomatous disease (CGD) is an uncommon inherited primary immunological weakness that affects particular white blood cells (neutrophils, monocytes, macrophages, eosinophils). The illness is characterised by a failure to resist certain bacterial and fungal infections and a propensity to develop persistent inflammation. Life-threatening recurrent fungal and bacterial infections affecting the skin, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Chytridiomycota is a sub-group of zoosporic organisms from the kingdom Fungi. They are also known as chytrids. Named after the Ancient Greek word khutridion, which means "little pot", it refers to the structure that contains unreleased zoospores. The earliest diverging fungal lineages are the Chytrids. Their membership in kingdom Fungi can be seen with chitin cell wall, posterior whiplash flagellum and absorptive nutrition. They also use glycogen to store energy and produce lysine through the a-amino acid (AAA).

Cilia Definition Characteristics of Cilium Structure of Cilium Cilia are extracellular protrusions that are membrane-bound, microtubule-containing, and formed from centrioles. They are structurally durable, as well as flexible and dynamic, having different mechanisms that regulate their composition and functions. On the basis of the patterns of microtubules found in the axonemes of the cilia, motile cilia ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Cilia as well as Flagella are complex cytoplasmic filamentous structures that protrude through the cell's wall. They are small, particularly distinct appendices to the cell. The flagella (singular meaning flagellum) are hairy, long structures that extend out from the plasma membrane. They can be utilized to move the entire cell.

What is Cimex lectularius? Classification of Cimex lectularius scientific name: Cimex lectularius Linnaeus (Insecta: Hemiptera: Cimicidae) Classification Level Classification Name Kingdom Animalia (Animals) Phylum Arthropoda (Arthropods) Subphylum Hexapoda (Hexapods) Class Insecta (Insects) Order Hemiptera (True Bugs, Cicadas, Hoppers, Aphids, and Allies) Suborder Heteroptera (True Bugs) Infraorder Cimicomorpha Superfamily Cimicoidea Family Cimicidae (Bed Bugs) Subfamily Cimicinae ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The circulatory system is a vital component of vertebrates, consisting of two interconnected systems: the blood vascular system and the lymphatic system. While both systems play crucial roles in maintaining the body’s overall function, the circulatory system primarily refers to the blood vascular system. In vertebrates, the blood vascular system is a closed system characterized ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Circulatory system of Earthworm The earthworm possesses a closed type of circulatory system, which plays a pivotal role in the transportation of nutrients, oxygen, and waste products throughout its body. This system is intricate and is composed of various components, each with its specific function. A. Blood Vessels behind 13th segments in Intestinal Region In the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Cis and Trans Isomers? What causes cis and trans isomerism? Cis and trans isomerism arise due to the restricted rotation around a double bond or in a ring structure. This restricted rotation locks the atoms or groups into specific spatial arrangements, leading to different isomeric forms. Let’s explore an example to understand the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Citric Acid? Properties of Citric Acid – C6H8O7 C6H8O7 Citric Acid Molecular Weight/ Molar Mass 192.124 g/mol Density 1.66 g/cm³ Boiling Point 310 °C Melting Point 153 °C Citric Acid structure – C6H8O7 Which Microorganism is used for Citric Acid Production? Numerous microorganisms are utilised in the production of citric acid. There are ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The classical pathway is a key immune system mechanism that plays an important role in defending the body from foreign invaders. It consists of a series of sequential interactions among complement components that result in the killing of target cells via a process known as cell lysis. The presence of an antibody attached to an antigen, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Little, single-celled creatures living practically everywhere are bacteria. They’re prokaryotic, meaning they lack a real nucleus. They differ from eukaryotic cells in that they lack membrane-bound organelles. Shapes vary; spherical (cocci), rod-like (bacilli), spiral (spirilla), or comma-shaped (vibrios). Their survival in hostile environments depends on this diversity. Some twist like corkscrews, designated as spirochaetes. There ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Fish? General description of fish Fish are fascinating aquatic vertebrates characterized by their unique adaptations for life in water. They are distinguished by the absence of limbs with digits, opting instead for fins that facilitate swimming. As anamniotes, fish embryos develop without an amniotic membrane, a trait that differentiates them from tetrapods such ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The fungi are classified based on the characteristics of the sexual spores and fruiting bodies present during the sexual stages of their life cycles. Therefore, based on characteristics of their sexual stages and morphology of their asexual spores and thalli they are classified into different groups.

Insects are a diverse group of arthropods belonging to the class Insecta, characterized by their three-part body structure, which includes the head, thorax, and abdomen. They typically have six legs, compound eyes, and one or two pairs of wings. Insects exhibit remarkable adaptability, inhabiting a wide range of environments from deserts to oceans. They undergo ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are lipids? Classification of Lipids Based on the Chemical Composition 1. Simple Lipids Simple lipids are fundamental components in the realm of biological molecules. They primarily consist of neutral fats and oils, as well as waxes. These lipids play crucial roles in various biological processes, especially in energy storage and insulation. 2. Compound Lipids ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Protein? Classification of protein On the Basis of Structure 1. Fibrous protein Fibrous proteins are a distinct category of proteins characterized by their elongated or fiber-like structure. These proteins are primarily found in animals and play specific roles in structural support. Therefore, understanding their nature, structure, and function is essential for a comprehensive ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Protozoa are defined as microscopic, acellular organisms that exist either singly or in colonies, characterized by a lack of tissues and organs and the presence of one or more nuclei. With approximately 50,000 known species within the Phylum Protozoa, these organisms exhibit a remarkable diversity and complexity despite their simple structure. Protozoa can be broadly ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is a Virus? Structure and Function of Viruses Properties of Viruses Classification of Viruses Classification of Viruses On the Basis of Genetic Material Present Viruses can be classified based on the type of genetic material they contain. There are two main types of genetic material that viruses can have: DNA (deoxyribonucleic acid) or RNA (ribonucleic ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is cleavage? Characteristics of cleavage Cleavage exhibits several distinct characteristics during the early stages of embryo development: Overall, cleavage is characterized by the rapid division of the fertilized egg, resulting in the generation of numerous blastomeres. These divisions lead to the formation of either a solid mass of cells (morula) or a hollow sphere ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Cystine-Lactose-Electrolyte-Deficient (CLED) medium, first described by Sandys and later modified by Mackey and Sandys, is generally used for diagnostic routine urinary bacteriology as a non-selective medium capable of supporting the growth of most urinary pathogens. CLED Agar, a differential medium for the isolation and counting of bacteria from urine, is used. It supports the growth all potential urinary pathogens. The medium also provides distinct colony morphology. It is suitable for the growth of all urinary pathogens, contaminants, and provides good colonial differentiation. However, it does not allow for the spread of Proteus species because of its low electrolytes.

What is climax community? Climax community means Characteristics of a climax commu­nity Nature of Climax Community 1. Poly-climax and Mono-climax 2. Pattern theory of Climax  Factors Affecting the Nature of Climax Community Transient and cyclic climax Theories of the Climax Community There are several ideas about what happens at the end: 1. Mono-climax Theory 2. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Cloning Vector? A cloning vector is a small portion of DNA that can be maintained in an organism and into which a foreign DNA fragment can be inserted for the purposes of cloning. The vector for cloning may consist of DNA extracted from a virus, the cell of a higher organism, or the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Types of Botulism  There are three primary forms of botulism: baby, wound, and foodborne. Additional clinical classifications include adult intestinal toxaemia and iatrogenic botulism. 1. Foodborne botulism 2. Infant botulism 3. Wound botulism 4. Adult intestinal toxemi 5. Iatrogenic botulism Morphology of Clostridium botulinum C. botulinum has the following characteristics: Habitat of Clostridium botulinum Geographical ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Clostridium perfringens? Scientific classification of Clostridium perfringens Domain: Bacteria Phylum: Bacillota Class: Clostridia Order: Eubacteriales Family: Clostridiaceae Genus: Clostridium Species: C. perfringens Geographical Distribution and Habitat of Clostridium perfringens Clostridium perfringens is found globally, with varying types responsible for different diseases in humans and animals. Morphology of Clostridium perfringens Clostridium perfringens is a Gram-positive ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Characteristics of Clostridium perfringens Factors Contributing to C. perfringens Type A Foodborne Disease Source of contamination of Clostridium perfringens Clostridium perfringens enterotoxins Epidemiology of Clostridium perfringens food poisoning Synthesis and Release of CPE Effects of CPE on the GI Tract  Pathogenesis of C. perfringens Food Poisoning  Source of Enterotoxigenic C. perfringens Strains in Food  Clinical Features of Clostridium perfringens ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Tetanus is caused by C. tetani, an obligate anaerobic Gram-positive bacillus. Tetanus is an infectious disease characterised by increased muscle tone and spasms caused by the release of tetanospasmin, a neurotoxin produced by C. tetani when it is inoculated into humans. Morphology of Clostridium tetani C. tetani demonstrates the following characteristics: Geographical distribution of Clostridium ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Clostridium? Morphology of Clostridium Gram Staining of Clostridium The bulk of Clostridium are Gram-positive rods. C. difficile, for example, is a Gram-positive Clostridium that will look dark blue/violet due to the retention of the main stain (crystal violet) in its thick peptidoglycan layer. Although these bacteria appear Gram-positive, under certain conditions, they can ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

It is a type of biochemical test, which is used to differentiate Staphylococcus aureus from coagulase-negative staphylococci. S.aureus produces two forms of coagulase (i.e., bound coagulase and free coagulase).

What is Fine Adjustment Knob? Particularly in high magnification levels, the fine adjustment knob is an essential part of a microscope as it helps to achieve exact and crisp focus. Particularly in the study of cells, microscopes are essential instruments in scientific inquiry as they let us view objects beyond our human sight. Under a ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Coccidioides is a genus of dimorphic fungi that exist as both mycelia and spherules. Mycelia and spherules are both asexual structures. Sexual coccidiosis has not been identified. The results of a molecular analysis indicate that Coccidioides is related to ascomycetes such as Histoplasma capsulatum and Blastomyces dermatitidis. There are two recognized taxa within the genus ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

After wastewater treatment, the chemical oxygen demand (COD) is used to determine the amount of contamination in the water. The higher value of chemical oxygen demand implies that the water sample has a greater amount of organic pollutants. The COD test measures only substances that can be chemically digested. The determination of COD requires less ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The Difference between a template and a coding strand is primarily based on two characteristics: directional polarity and function. The two distinct strands of double-stranded DNA are the template strand and the coding strand, with the former functioning as a base to transcribe mRNA and the latter determining the correct base sequence of the mRNA. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Codominance? Definition of Codominance Codominance is a genetic scenario where two different alleles at a locus are both fully expressed in a heterozygote, resulting in a phenotype that displays traits of both alleles simultaneously. What are the Symbolism for codominant alleles? Examples of Codominance Codominance in Animals Codominance in Humans Codominance in Plants ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Coelomates? Definition of Coelom The coelom is a fluid-filled body cavity located between the digestive tract and the body wall, completely lined by mesodermal tissue. It provides space for organ development, movement, and a hydrostatic skeleton in many animals. Characteristics Features of Coelom Below are the special features of the coelom that distinguish ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The animals that are cold-blooded are those who are incapable of controlling their body's temperature in accordance with temperatures of their environment.

What are Coliforms?  Introduction Classification of Coliforms Escherichia  Edwardsiella Citrobacter  Klebsiella  Klebsiella rhinoscleromatis Klebsiella ozaenae  Klebsiella oxytoca  Enterobacter Hafnia  Serratia  Proteus  Morganella  Providencia  Erwinia

What is Presence/Absence Test? Principle of Presence/Absence Test Objective of Presence/Absence Test PA Broth Preparation Composition Ingredients Gms / Litre Peptic digest of animal tissue 5.000 Tryptose 9.830 Beef extract 3.000 Lactose 7.460 Sodium chloride 2.460 Dipotassium phosphate 1.350 Monopotassium phosphate 1.350 Sodium lauryl sulphate 0.050 Bromo cresol purple 0.0085 Final pH ( at 25°C) ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Collagen? Definition of Collagen Collagen is the most abundant protein in the body, providing structural support to connective tissues such as skin, bones, tendons, and ligaments. It consists of a triple helix of amino acids, forming a framework that maintains the integrity and elasticity of various tissues. Collagen plays crucial roles in wound ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Collagen Hybridizing Peptide stain is a vital stain used for the detection of collagen degraded tissues, mainly used in Developmental Biology, Histology, and Histopathology.

What is Colony Counter? Definition of Colony Counter A colony counter is a device used in microbiology laboratories to count bacterial or microorganism colonies on a solid growth medium. It simplifies and accelerates the colony counting process, providing an accurate measurement of colony forming units (CFUs) in a given sample. Purpose of colony counting The ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Bacterial colonies are an essential element of microbiology that is relevant today and will likely remain the same. These colonies are utilized to conduct medical research, the development of pharmaceuticals, and use within the industry of food (the healthy ones, naturally) and many more. When a bacterial colony has been established, the first step to ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Color Spectrophotometer? A color spectrophotometer is a scientific instrument designed to measure and analyze the color properties of various samples. By shining light onto a sample and measuring the intensity of the reflected light across different wavelengths, it provides a detailed profile of the sample’s color. This tool is essential in industries like ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is a Colorimeter? Colorimeter Definition A colorimeter is a scientific instrument used to measure the absorbance of specific wavelengths of light by a solution, aiding in determining the concentration of a solute within that solution based on the Beer-Lambert law. Principle of Colorimeter – How does a colorimeter work? The principle of a colorimeter ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Colorimeter? A colorimeter is a sophisticated scientific instrument dedicated to the domain of colorimetry, the science of measuring the absorbance and transmittance characteristics of light as it propagates through a liquid medium. The underlying principle governing its operation is the renowned Beer-Lambert’s law, which correlates the light absorbed or transmitted by a sample ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Coltivirus is a virus genus (of the family Reoviridae) that infects both vertebrates and invertebrates. It contains the agent that causes Colorado Lyme fever. The Colorado tick fever virus can lead to fever, shivers, headache, photophobia, myalgia, arthralgia, and fatigue. Children are especially susceptible to developing a hemorrhagic disease. Leukopenia containing both lymphocytes and neutrophils ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Columbia Blood Agar Base? Principle of Columbia Blood Agar Base The principle of Columbia Blood Agar Base lies in its composition and functionality in supporting the growth and differentiation of various bacterial species. Here are the key principles of Columbia Blood Agar Base: Composition of Columbia Blood Agar Base Ingredients Gms/Litre Peptone special ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Columbia CNA Agar? Columbia CNA Agar with 5% Sheep Blood Composition of Columbia CNA Agar per Liter of Medium The composition of Columbia CNA Agar can be summarized as follows, considering the information provided: Ingredients: The base of Columbia CNA Agar is prepared using a nutritionally rich medium that includes different peptones to ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Chromatography? Chromatography is a powerful laboratory method used to separate, identify, and analyze the components of complex mixtures. Think of it as a molecular race where different substances travel at varying speeds based on their interactions with two key elements: a stationary phase (a solid or liquid-coated surface) and a mobile phase (a ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Commensalism? Along with mutualism, the term was coined in 1876 by Belgian palaeontologist and naturalist Pierre-Joseph van Beneden. Beneden first used the term to describe the behaviour of carrion-eating animals that followed predators in order to consume their leftover meal. The term commensalism is derived from the Latin word commensalis, which meaning “table ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Common Ancestry? The theory of common ancestry The theory of common ancestry posits that all life on Earth descends from a singular “universal common ancestor.” This foundational concept in evolutionary biology provides insight into the interconnectedness of all living organisms and how they have evolved over time through adaptation to their environments. Predictions ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

To ensure that clinical specimens are properly cultured, two types of media are required. The non-selective medium (e.g. Brain Heart Infusion Agar) should be used. Other media should be specific and tailored to isolate pathogenic fungi.

What is Communicable Disease? Types of Communicable Diseases Communicable diseases are illnesses caused by pathogens, which can spread from one person or animal to another. These diseases are typically transmitted through various means, such as direct contact, contaminated food or water, blood, or bodily fluids. Here’s a breakdown of the main types of communicable diseases. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Community in Ecology? Types of Community Types of community can be classified based on their size and self-regulatory capabilities. Here are the main types of communities: Communities can also be classified based on their openness or closedness: Understanding the types of communities helps ecologists study the dynamics, interactions, and adaptations within different ecological ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Characteristics of Community These characteristics collectively contribute to the unique structure, function, and dynamics of communities, highlighting the complex and interconnected nature of ecological systems. Understanding these characteristics helps ecologists study and conserve communities and the interactions that occur within them. 1. Trophic organization Trophic organization is a fundamental concept in ecology that describes the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The digestive tract of vertebrates The digestive tract of vertebrates consists of several distinct parts, each playing a crucial role in the overall process of digestion. From the mouth to the glands associated with digestion, this system is designed to break down food, absorb nutrients, and expel waste. Below is a detailed breakdown of the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Acid Fast bacteria resist the decolorizing by acid after staining. Non Acid Fast Bacteria readily resist the decolorizing by acid after staining.

Gram stain refers to a staining technique for the preliminary identification of bacteria, in which a violet dye is applied, followed by a decolorizing agent and then a red dye.

In Kinyoun stain method basic fuchsin is used as a primary stain.

What is Competition Interaction? Competition is defined as an interaction between two or more individuals of the same population or between two or more populations in which each adversely affects the other’s access to limited resource(s) (food, water, nesting sites, shelter, mates, etc.). Mutualism is defined as a population interaction that benefits both parties. Competitive ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Competitive ELISA? Principle of Competitive ELISA The principle of competitive ELISA is based on the competitive binding process that occurs between two specific antibodies and an antigen of interest. In this assay, two antibodies are utilized: one is conjugated with an enzyme, and the other is present in the test serum (if the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Complement? Functional categories of Complement Components Complement components can be classified into seven functional categories: 1. Initiator complement components 2. Enzymatic mediators 3. Membrane-binding components or opsonins 4. Inflammatory mediators 5. Membrane attack proteins 6. Complement receptor proteins 7. Regulatory complement components FAQ

What is Complement Fixation? Principle of Complement Fixation Test The principle of the complement fixation test is based on the interaction between antigens, antibodies, and complement proteins. When an antigen and antibody come into contact, they form an antigen-antibody (Ag-Ab) complex. This complex then interacts with complement proteins and becomes fixed with them. As a ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Complement System Definition The complement system, also known as the complement cascade, is a component of the immune system that boosts the ability of antibodies and phagocytic cells to eliminate germs and damaged cells from an organism, stimulate inflammation, and assault the cell membrane of a pathogen. Properties of Complement  Complement demonstrates the following attributes: ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Composite Fish Culture? Steps in Composite Fish Culture 1. Site selection Site selection is a critical aspect of aquaculture that significantly influences the success of fish farming operations. Choosing an appropriate site requires a comprehensive evaluation of various factors that can affect fish health, growth, and overall productivity. The process can be categorized ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Composting? Important ingredients required for function of Microorganisms Mechanism of Composting Organisms can decompose organic materials in compost if the proper mixture of water, oxygen, carbon, and nitrogen is present. There are two basic groups of decomposers: chemical decomposers, which execute chemical processes on organic waste, and physical decomposers, which reduce trash to ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

A compound microscope is a class of optical or light microscope. I have already discussed about basics of a microscope on my previous note “Parts of Microscope with their Functions and Working Principle”, you can check them to get an idea about from which class compound microscope belongs and what is a microscope, and more. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The concept of species has been a subject of ongoing debate and controversy among taxonomists and biologists. The task of defining and recognizing species is crucial for understanding the diversity and organization of life on Earth. Over time, various species concepts have been proposed to tackle this challenge, each with its own merits and limitations. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Overview of Heart Conduction The conduction system of the heart is a complex network that orchestrates the electrical signals required for heart muscle contraction. This system ensures that the heart beats in a coordinated manner, facilitating efficient blood circulation throughout the body. The process begins with the generation of an electrical signal, which propagates through ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Confocal microscopy offers some pretty cool perks compared to regular optical microscopes. For starters, it gives you a razor-thin focus depth, cuts out that annoying blurry background glow, and lets you snap crisp, detailed “slices” of thick samples—one after another. This makes it a go-to tool in biomedicine, especially for studying cells and tissues, whether ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Conical Flask or Erlenmeyer flask? Purposes of Conical Flask  Features of Conical Flask  Sizes Available of Conical Flask Maintenance of Conical Flask Uses of Conical flask  Types of Conical Flasks   Erlenmeyer flasks, or conical flasks, are developed for specialized laboratory uses. The main differences are: Advantages of Conical Flask Limitations of Conical Flask

What is Connective tissue? Definition of Connective tissue Connective tissue is a type of animal tissue that supports, connects, and protects various structures in the body. It consists of fibers, ground substance, and cells, and is found between other tissues and organs. It provides structural support, flexibility, and plays a role in the transportation of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Consumer? Consumer is a category that belongs inside an ecosystem’s food chain. It primarily refers to animals. Consumers cannot generate their own energy and must rely on the intake and digestion of producers, other consumers, or both in order to survive. Types of consumer 1. Primary consumers Examples of Primary consumers 2. Secondary ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The growing plants carry a common microbiome on their surfaces. They could be contaminated by external sources. Animals too have a normal surface flora, as well as an intestinal one. They also release organisms through excretions and secretions. They can are also contaminated by outside sources. Animals and plants with parasitic diseases, of course, carry the pathogen responsible for the illness. The healthy tissues that are inside both animals and plants nevertheless are found to have a small number of living microorganisms or none at all.

What is spoilage? Contamination of Cereals and Cereal Products Contamination source of cereal products Cereal products, such as grains and flour, can be susceptible to contamination from various sources throughout their production and supply chain. Understanding these potential sources is crucial for ensuring the safety and quality of these food items. Here are some common ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Continuous Culture Definition Continuous Culture is an ‘open’-culture system for the cultivation of microorganisms or cells in which fresh sterilized medium is introduced at a steady flow rate and from which the culture fluid emerges at the same rate. Continuous Culture Advantages System applied for Continuous Culture There are two systems used for Continuous Culture ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Who Was Louis Pasteur? Contribution of Louis Pasteur Louis Pasteur made several groundbreaking contributions to science, particularly in microbiology and chemistry. Here is a detailed overview of his major contributions: The Swan Necked Flask experiment of  Louis Pasteur Louis Pasteur’s experiment with the swan-necked flask was a landmark in disproving the theory of spontaneous generation ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

1. Ignaz Semmelweis Contribution 2. Hans Christian Gram Contribution 3. Charles Lavaran Contribution 4. Fanny Hesse Contribution 5. Marjory Stephenson Contribution 6. Kiyoshi Shiga Contribution  7. Emil von Behring Contribution Reference Contribution of Microbiologist: Ignaz Semmelweis, Hans Christian Gram, Charles Lavaran, Fanny Hesse, Marjory Stephenson, Kiyoshi Shiga, Emil von Behring.

1. Julius Wagner-Jauregg Contribution 2. Charles Nicolle Contribution 3. Gerhard Domagk Contribution 4. Howard Florey Contribution 5. Ernst Chain Contribution 6. Selman Waksman Contribution 7. Max Theiler Contribution Reference

Contribution of Microbiologists 1. Joseph Lister Contributions 2. Alexander Fleming Contribution In September 1928, during his research on Staphylococcus aureus, he left open a petri plate of Staphylococcus at his window. When he came back to his laboratory from a vacation with his family, he noticed that the plate in which he was left open ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Paul Ehrlich Paul Ehrlich was a Nobel prize-winning German physician and scientist. He mainly worked in the fields of hematology, immunology, and antimicrobial chemotherapy. He was born on 14 March 1854 in Strehlen, Lower Silesia, Prussia. Ehrlich received the Nobel Prize in Physiology or Medicine in 1908, for his contribution to immunology. Paul Ehrlich was ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

In this article we will learn about the contribution of Robert Koch in Microbiology and Koch’s Postulates. All this informations are only for students. Who was Robert Koch? Contribution of Robert Koch Robert Koch made pivotal contributions to the field of microbiology, which significantly advanced our understanding of infectious diseases. His work established foundational principles ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Who was Antonie van Leeuwenhoek? Anton Van Leeuwenhoek and Cell Theory Contribution of Antonie van Leeuwenhoek Antonie van Leeuwenhoek, a Dutch scientist and businessman, made several pioneering contributions to the field of microbiology, fundamentally altering our understanding of the microscopic world. His meticulous observations and discoveries laid the foundation for modern biology and greatly influenced ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Control Group? Definition of Control Group A control group is a set of subjects in a scientific experiment who do not receive the treatment or intervention being studied, serving as a benchmark for comparison against the treatment group to determine the effect of the variable under investigation. Importance of Control Group The control ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Controlled Experiment? Definition of Controlled Experiment A controlled experiment is a scientific investigation in which a researcher deliberately manipulates a specific variable, while keeping all other variables constant, to determine its effect on a system under study. How Does Controlled Experiment Works? A controlled experiment works by systematically testing a hypothesis through the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Key Takeaways Pond Aquaculture Types of ponds and their aquacrops The cultivation of aquatic crops in various types of ponds is primarily determined by the salinity of the water, which influences the selection of species that can thrive in these environments. Understanding the different types of ponds and the specific aquacrops associated with each is ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Coomb’s Test? Objectives of Coomb’s Test The objectives of Coomb’s test are to detect red blood cells that are sensitized with IgG alloantibodies, IgG autoantibodies, or complement components. This helps in determining blood group compatibility for transfusions, diagnosing autoimmune hemolytic anemia, and identifying immune-mediated reactions and conditions such as paroxysmal nocturnal hemoglobinuria. Overall, the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Copyright? Definition of Copyright Copyright is a legal right that grants creators exclusive control over the use, reproduction, distribution, and performance of their original works for a limited time. Exclusive Copyright Rights Exclusive copyright rights encompass a set of specific entitlements granted to the copyright owner. These rights enable the owner to control ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Coral Reefs? Structure of a coral polyp Coral polyps are fundamental building blocks of coral reefs, exhibiting a unique structure that facilitates their role in these vibrant ecosystems. Generally small, a typical coral polyp measures about 10 mm in length and 1 to 3 mm in diameter. Although some solitary polyps can reach ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is the Cori Cycle? Cori Cycle Definition The Cori Cycle is a metabolic pathway in which lactate produced by anaerobic glycolysis in muscles is transported to the liver, converted back into glucose, and then returned to the muscles for energy production. This cycle plays a crucial role in maintaining energy balance during periods of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Coronary circulation? Anatomy Of the coronary circulation The anatomy of the coronary circulation is crucial for understanding how the heart receives its blood supply. This system consists of the coronary arteries and veins, which work together to deliver oxygen-rich blood to the myocardium and return deoxygenated blood back to the heart. Coronary Arteries ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Coronavirus Characteristics of COVID-19 Structure of Coronavirus Genome of Coronavirus Epidemiology of Coronavirus The novel coronavirus SARS-CoV-2 is the cause of the 2019 coronavirus disease (COVID-19). The virus was identified for the first time in December 2019 in Wuhan, China, and has since spread worldwide, resulting in a pandemic. Here are some essential aspects of the epidemiology of COVID-19: Replication of Coronavirus ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Corynebacterium diphtheriae? Scientific classification of Corynebacterium diphtheriae Domain: Bacteria Phylum: Actinomycetota Class: Actinomycetia Order: Mycobacteriales Family: Corynebacteriaceae Genus: Corynebacterium Species: C. diphtheriae Geographical Distribution and Habitat of Corynebacterium diphtheriae Corynebacterium diphtheriae is the causative agent of diphtheria, and its distribution is heavily influenced by geographic, environmental, and immunization factors. Here’s a breakdown of where ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Counter current immunoelectrophoresis is a modification of immunoelectrophoresis in which antigen and antibody migrate towards opposite directions and form a visible white precipitate in the area between the wells. 

What is Cranial nerve? Definition of Cranial nerve Cranial nerves are a set of twelve pairs of nerves that emerge directly from the brain and are responsible for controlling various functions in the head, neck, and some organs in the chest and abdomen. These nerves transmit sensory information, such as sight, hearing, taste, and touch, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Cresol red is used as a tracking dye for DNA/RNA in agarose gel electrophoresis and protein in polyacrylamide gel electrophoresis.

Crimean-Congo Hemorrhagic Fever (CCHF) is a viral disease that is transmitted to humans by ticks. It is a highly infectious and severe disease that can be fatal in up to 50% of cases. The virus is found in many parts of the world, including Africa, Asia, and Europe. CCHF is caused by a virus in ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is gene/genome editing? Gene or genome editing refers to the deliberate and precise modification of an organism’s genetic material. This advanced biotechnological process allows for the targeted alteration of DNA sequences within a genome, facilitating the correction of genetic anomalies or the introduction of specific traits. Historically, the concept of gene editing traces its ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Crossing over? Definition of Crossing over Crossing over is the exchange of genetic material between non-sister chromatids of homologous chromosomes during prophase I of meiosis, resulting in new combinations of genes. Characteristics of Crossing over At which stage Crossing over occurs? Types of Crossing over Crossing over can be categorized based on its ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is cryo-EM? Principle of cryo EM Types of cryo EM Cryo-electron microscopy (cryo-EM) is a collection of special methods. These are broadly categorized into two types, mainly cryo-transmission electron microscopy (cryo-TEM) and cryo-scanning electron microscopy (cryo-SEM). Each has its own advantage in the analysis of biological samples in their native state, frozen by cryo-preparation. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Characteristics of Cryptococcus neoformans Habitat of Cryptococcus neoformans Morphology of Cryptococcus neoformans Cultural characteristics of Cryptococcus neoformans Life Cycle of Cryptococcus neoformans Virulence Factors of Cryptococcus neoformans Cryptococcus neoformans is a fungal pathogen that causes life-threatening infections, primarily in immunocompromised individuals. Some of the virulence factors of Cryptococcus neoformans are: These virulence factors enable Cryptococcus neoformans to evade host ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Download CSIR NET-JRF Life Sciences Previous Year Question Papers (2011-2023) Prepare effectively for the CSIR NET-JRF Life Sciences exam with our comprehensive collection of previous year question papers from 2011 to 2023. Access a curated archive of past exams to enhance your study strategy and familiarize yourself with the exam pattern. These question papers are ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Number of tests Once in a year Participating Universities More than 140 Central and Participating universities 142 Subject/Programme Life Sciences, Microbiology, Biochemistry, Biotechnology,Bioinformatics, Zoology, Botany, Human Genetics,Molecular Medicine, Genomic Science and Nutrition Biology Organized by NTA Medium of examination Hindi and English Mode of examination Computer based test (CBT) Time duration 2 Hours (120 minutes) ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Anaerobic bacteria? Characteristics of Anaerobic Bacteria Cultivation of Anaerobic Bacteria Cultivation of Anaerobic Bacteria. Stringent anaerobes can be grown only by taking special precautions to exclude all atmospheric oxygen from the medium. Such an environment can be established by using one of the following methods: Cultivation of Anaerobic Bacteria using Prereduced media Procedure ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Bacteria constitute a vital element in the ecology. They are essential to our health as well as the environmental health, play an essential role in the production of food, and offer bioengineers the tools to harness their abilities and produce compounds. However, they could also be harmful, causing harm and diseases. The capacity to cultivate ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

When it comes to culturing bacteria, it is crucial to create the same environmental and nutritional conditions as those found in the natural environment. The majority of culture mediums contain water, which is a major source of carbon and energy and nitrogen. It also contains trace elements, as well as some growth factors. In addition, the pH as well as oxygen tension and Osmolarity must also be considered. Some of the components of media for culture include: Although tap water is appropriate for the use of culture media, it shouldn't be used in the event that it contains a significant amounts of minerals. In these instances the use of demineralised or distillated water is recommended.

Culture Media Examples Components/Comments Primary Purpose Bile esculin agar (BEA) Nutrient agar base with ferric citrate. Hydrolysis of esculin by group D streptococci imparts a brown color to medium; sodium deoxycholate inhibits many bacteria. Differential isolation and presumptive identification of group D streptococci and enterococci Bile esculin azide agar with vancomycin Contains azide to inhibit ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Culture medium refers to the nutrient-rich substance that is used in labs to culture microorganisms such as bacteria and fungi. These materials, whether liquid or solid, provide the microbes with needed nutrients, minerals and other factors for growth and reproduction according to step-by-step reports from authoritative sources around the world. The late 19th century was ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The food supply upon which microorganisms thrive in laboratories is termed as a culture medium or culture media. Culture Medium Definition The nutrient preparation on or in which a culture (microorganism) is grown in the laboratory is known as culture medium or culture media. Classification of culture media/Types of Culture Medium Many special-purpose media are ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

General Principles of Culture Maintenance and Preparation  Selection of Cultures Maintenance of Activity of Cultures  Maintenance of Purity of Cultures  Preparation of Cultures  Activity of Culture  Mixed Cultures  Bacterial Cultures  With the exception of the propionic acid bacteria added to Swiss cheese, the majority of the bacterial cultures used as starters in dairy products, sausage, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Cyanobacteria? Definition of Cyanobacteria/Cyanobacteria definition Cyanobacteria are photosynthetic bacteria that obtain energy through photosynthesis. They are often referred to as blue-green algae, although they are not classified as true algae. Cyanobacteria played a crucial role in the production of oxygen and the shaping of Earth’s atmosphere. They can be found in various aquatic ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Category Name Division Cycadophyta Class Cycadopsida Order Cycadales Family Cycadaceae Genus Cycas Distribution of Cycas Cycas is the largest genus within the Old World Cycads and stands out as the most widely distributed genus in the order Cycadales. Its distribution spans across various geographical regions, showcasing its adaptability and ecological significance. Below is a detailed ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Cyclic AMP pathway? Synthesis of Cyclic AMP Cyclic AMP pathway Functions of Cyclic AMP References

What is Cyclops? Definition of Cyclops Cyclops are a genus of freshwater copepods characterized by their single large eye, named after the mythical creature from Greek mythology. They are commonly referred to as water fleas and play important roles in freshwater ecosystems, serving as intermediate hosts for various parasites such as the guinea worm and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Cysticercosis? Clinical manifestations of Cysticercosis Cysticercosis is a parasitic infection caused by the larval stage of the tapeworm Taenia solium. The clinical manifestations of cysticercosis depend on the location of the cysticerci (larval stage) within the body. It’s worth noting that not all patients with cysticercosis will experience symptoms. Asymptomatic cysticercosis is often ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Cystine Glucose blood agar is also known as Cystine Heart Agar. Francis developed blood-dextrose-cystine agar after determining F. tularensis would only grow on an artificial medium supplemented with sulfhydryl compounds (i.e., cystine). F. Tularensis is extremely meticulous organism that requires cystine to grow at its best. To honor the achievements of all time of Francis in the field of understanding the disease it was named Francisella Tularensis. The hemoglobin-rich medium is suggested to cultivate Francisella Tularensis. Without enrichment supplies, it facilitates the growth of cocci gram-negative and other pathogenic organisms.

Cystine tryptic agar (CTA) which is also referred to as cystine trypticase agar was created by Vera as an semi-solid growth medium to identify and maintain the health of microorganisms for long time period of time when stored at suitable temperatures. It's used for determination of the motility of bacteria and, when combined with carbohydrate, is involved in the fermentation process and the differentiation of microorganisms that are fastidious, such as Neisseria and streptococci, as well as pneumococci and non-spore-forming anaerobes.

What is Cytodifferentiation? Steps in Cytodifferentiation Cytodifferentiation involves a series of critical steps that lead to the specialization of cells within a culture, particularly in plant tissue culture. The fate of individual cells during this process is inherently variable and influenced by both intrinsic and extrinsic factors. As a result, the cytodifferentiation process is not ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Cytokines? Definition of Cytokines Cytokines are small proteins that play a crucial role in cell signaling, mediating communication between cells and regulating various physiological processes. What is Cytokinesis? Definition of Cytokinesis Cytokinesis is the process of cell division in which a single cell divides into two daughter cells, each with its own nucleus ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The cytoplasm, a highly viscous substance (gel-like) that is enclosed within the cell membrane. It is composed of water (about 85%), proteins (10-15%), lipids (2-4%) and nucleic acids, inorganic salts, and polysaccharides in smaller amounts. Depending on the cell's configuration, cytoplasm might also contain occasional inclusions (e.g. stored nutrients and pigments).

Cytoplasmic Matrix Physical Nature of Cytosol (Or Cytoplasmic Matrix)  The cytosol (cytoplasmic matrix) is a colloidal substance that is colourless or greyish, transparent, viscous, gelatinous, or jelly-like. It is more dense than water and may flow. In the past, there has been considerable debate on the physical nature of the matrix. Regarding the physical properties ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Cytoplasmic or Extra-Nuclear Inheritance? Cytoplasmic inheritance, also known as extrachromosomal or extranuclear inheritance, refers to the transmission of genetic material that is not found within the nucleus but rather in the cytoplasm of a cell. This type of inheritance contrasts with Mendelian inheritance, which involves nuclear genes. In cytoplasmic inheritance, the genetic information ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The cytoskeleton is a dynamic network of protein filaments found in the cytoplasm of all cells, including those of bacteria and archaea. It stretches from the cell nucleus to the cell membrane in eukaryotes and is composed of the same proteins in all organisms. It consists of microfilaments, intermediate filaments, and microtubules, all of which ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is a Cytotoxic T cell? Development of CD8+ T cells Effector CTLs Are Generated from CTL Precursors Activation and differentiation of CD8+ T cells Cytotoxicity Mediated by CD8+ T Role in anti-viral immunity Role in anti-tumor immunity What are Memory CD8+ T cells? All of these effector and memory subsets work together to generate ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Czapek medium (also known as Czapek’s agar or Czapek Dox medium) is a medium used to grow fungi and other organisms. This medium is suitable for qualitative cultivation of soil bacteria and saprophytic fungi. Czapek originally created the medium in 1902 to cultivate saprophytic mushrooms. Czapek-Dox Agar, a modified formula of the Czapek (1902-1903) and Dox (1910) formulas, is prepared according to Thom & Church. Medium contains sucrose as the only source of carbon, and nitrate is the only inorganic nitrogen source.

What is Dark Field Microscopy? Darkfield microscopy is a form of light microscopy that facilitates detection by contrast. For example, brightfield microscopy uses a light source that shines light directly through the sample in order to illuminate the sample from below; darkfield microscopy uses a condenser that shines light at an oblique angle so that ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Darwinism Theory? The Theory of Evolution – Darwinism Theory The Theory of Evolution, formulated by Charles Darwin in the mid-19th century, is a scientific explanation for the diversity of life on Earth. It is considered one of the most important and well-supported scientific theories in the field of biology. At its core, the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Bioinformatics? Bioinformatics is an interdisciplinary discipline that analyses and interprets biological data by combining biology, computer science, mathematics, and statistics. It involves the creation and application of computational tools, algorithms, and databases for storing, retrieving, managing, and analysing biological data. Bioinformatics is essential for organising, analysing, and deriving meaningful insights from enormous quantities ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Daughter Cells? Definition of Daughter Cells Daughter cells are the cells resulting from the division of a single parent cell, either through the process of mitosis, where they inherit identical genetic material, or meiosis, where they receive half the genetic content. Characteristics of Daughter Cells Daughter cells are the end products of cellular ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

GAT-B (Biotech) DBT-JRF (BET) Biotechnology Eligibility Test – Previous Year Question Papers Download: Excel in the GAT-B (Biotech) DBT-JRF (BET) Biotechnology Eligibility Test with our collection of previous year question papers. Download these past papers to gain a deep understanding of the exam structure, familiarize yourself with key topics, and practice with questions similar to ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

General Comments: Question paper will have two parts, Part-A (General aptitude & General Biotechnology) and Part-B (General plus specialized branches in Biotechnology). Part-A will have all compulsory 50 MCQ questions in General science, Mathematics, Chemistry, General aptitude, analytical, quantitative ability, general biotechnology etc. There will be 150 questions in Part B, out of which only ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Decanter centrifuge? Working Principle of Decanter Centrifuges Operating on the basis of buoyancy, a decanter centrifuge separates While a less dense component would float on top, a component with more density would naturally sink to the bottom of a mixture. In a decanter centrifuge, constant spinning improves the speed of settling and generates ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Moeller introduced the decarboxylase media to detect the ability of bacteria to decarboxylate amino acid. They were used for the first time to detect lysine, ornithine, and arginine decarboxylases among Enterobacteriaceae bacteria.

Decarboxylase Test Medium base is used to distinguish bacteria based on their ability to decarboxylate amino acids.

What are Decomposers? Definition of Decomposers Decomposers are organisms that break down dead or decaying organic matter into simpler substances, facilitating nutrient recycling in ecosystems. Common examples include fungi and bacteria. Types of decomposers Decomposers play a pivotal role in the biogeochemical cycling of nutrients within ecosystems. These organisms specialize in breaking down dead organic ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Decomposition? Definition of Decomposition Decomposition is the process by which organic matter breaks down into simpler substances, typically by the action of microorganisms like bacteria and fungi, releasing nutrients, carbon dioxide, and water back into the environment. Types of Decomposition Decomposition happens in two main types: abiotic and biotic. Each plays a distinct role in breaking ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Deforestation? Definition of Deforestation Deforestation is the large-scale removal of trees from forests or natural landscapes, often to repurpose the land for agriculture, urban development, or industrial use, leading to habitat loss, decreased biodiversity, and increased carbon emissions. Importance of Forests Forests are essential to the health of the planet, playing a critical ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Types of Hydrocarbon Crude petroleum HCs can be categorised as alkanes, cycloalkanes, aromatics, polycyclic aromatics, asphaltines, and resins. Alkanes Cycloalkanes  Aromatic HCs Polycyclic aromatic HC Asphaltines and resins Effects of Hydrocarbon The ecological and/or economic effects of direct or indirect exposure of live creatures to hydrocarbon molecules can vary. Principles of Bioremediation Oil Spill Cleaning ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Pesticides? any substance or mixture of substances intended for preventing, destroying, or controlling any pest, including vectors of human or animal disease, unwanted species of plants or animals, causing harm during or otherwise interfering with the production, processing, storage, transport, or marketing of food, agricultural commodities, wood and wood products or animal feedstuffs; ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Deletion Mutation? Definition of Deletion Mutation A deletion mutation is a genetic anomaly in which a segment of a chromosome or DNA sequence is omitted during DNA replication, leading to the absence of specific nucleotides or entire chromosomal segments. This can result in altered gene function or expression. Causes of Deletion Mutation Deletion ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Dendrites? Definition of Dendrites Dendrites are branched extensions of neurons that receive and process incoming signals from other neurons, facilitating communication within the nervous system. They transmit electrical impulses toward the cell body and play a crucial role in integrating synaptic inputs to generate action potentials. Characteristics features of Dendrites The following characteristics ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Dendritic cell? Location of Dendritic cell DCs in lymphoid organs Lymph nodes Spleen Thymus Blood Skin Gut Structure of Dendritic cells Dendritic cell maturation Mechanism of Dendritic Cells in Immunity – How Dendritic cells work against pathogens? (Immunity) Dendritic Cell Function in Innate Immune System Dendritic Cells Function in Innate Immunity to Adaptive ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Dendrochronology? Definition of Dendrochronology Dendrochronology is the scientific study of tree rings, used to date events and environmental changes by analyzing the growth patterns of trees. Each ring represents a year of growth, and variations in width and density can provide insights into past climatic conditions, ecological changes, and historical events. History of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Through the bite of an infected Aedes species mosquito (Ae. aegypti or Ae. albopictus), dengue viruses are transmitted to people. These mosquitoes can transmit other viruses including Zika and chikungunya. 4 billion people, or close to half of the world’s population, reside in dengue-risk zones. In risky locations, dengue is frequently the main cause of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Denitrification? The nitrogen cycle concludes with denitrification. The nitrogen cycle consists of living organisms fixing atmospheric nitrogen and then releasing it back into the atmosphere. Denitrification is the process of releasing nitrogen from living organisms into the atmosphere. Denitrification Process Denitrification is the last step in the nitrogen cycle. It is a naturally ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is a Density Gradient Centrifugation? Scientists apply density gradient centrifugation in laboratories to sort particles including cells, organelles, and biomolecules because of their density differences. During density gradient centrifugation a sample sits on top of a density gradient medium formed by substances such as sucrose or cesium chloride. During high-speed centrifuge spinning particles from ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Deoxycholate Citrate Agar is an alteration of Leifson formula that is suggested for the identification of Salmonella as well as Shigella spp. It is comparable to deoxycholate agar however it is slightly more selective for enteric pathogens due to higher levels of both deoxycholate and citrate salts. The sodium deoxycholate pH range of 7.3 to 7.5 inhibits gram-positive bacteria. Citrate salts in the amount contained into the composition, act as inhibitors to gram-positive bacteria, as well as other intestinal organisms that are normal. This makes it an effective and selective media, commonly used to isolate intestinal pathogens.

Test Name Deoxyribonuclease (DNase) Test Detection DNases enzyme Uses To find out if an organism can break down DNA and use it to get carbon and energy so it can grow.To distinguish Staphylococcus aureus from other Staphylococci. Result DNase Test Agar: After adding 1N HCl, a clear zone forms around the growth line, but the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Desert Ecosystem Definition Characteristics of Desert Ecosystem Component of a desert ecosystem Due to minimal precipitation, the desert ecosystem contains fewer plants. These places have fewer than 255 millimetres of precipitation and high or low temperatures. This ecosystem’s evaporation rate is extremely high. Depending on the availability of water, dates, cotton, millet, etc. are cultivated ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Such is the case with the slide and tube Widal test. The agglutinins against the ‘0’ (somatic) and ‘H’ (flagellar) antigens of Salmonella typhi, paratyphi A, and paratyphi B are measured qualitatively (slide test) and quantitatively (Tube test) using a suspension of suitable organisms that have been killed. Widal-quantitative tube agglutination test This test aids ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Milk is widely recognized as a significant source of calcium, an essential mineral that plays a crucial role in the development and maintenance of strong bones and teeth. This mineral is particularly important for infants and young children, whose rapidly growing bodies demand high levels of calcium to ensure proper bone formation and density. Calcium’s ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Lane-Eynon Method? Principle of Lane-Eynon Method The Lane-Eynon method is a titrimetric procedure that quantifies reducing sugars in a solution through the utilization of Fehling’s solution as the primary reagent. This method operates on the fundamental chemistry of reduction-oxidation reactions, where Fehling’s solution, composed of copper sulfate and an alkaline solution of sodium ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Magnesium is an essential mineral found in many foods, including milk. It plays a vital role in numerous bodily functions, such as muscle and nerve function, blood sugar control, and bone health. The magnesium content in milk contributes to its nutritional value, making milk a beneficial part of a balanced diet. The amount of magnesium ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Phosphorus is an essential mineral found in many foods, including milk. It plays a critical role in various bodily functions such as the formation of bones and teeth, energy production, and the synthesis of RNA and DNA, which are crucial for the growth and repair of cells. In milk, phosphorus is naturally present and contributes ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Detritus Food Chain? Characteristics of Detritus Food Chain The detritus food chain exhibits several distinct characteristics that set it apart from other food chains. Here are some key characteristics of the detritus food chain: These characteristics collectively highlight the unique features and ecological significance of the detritus food chain. By capitalizing on detritus ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Key Points on Deuteromycetes Here are the key points summarizing the characteristics and significance of Deuteromycetes: What are Deuteromycetes? Characteristic Features of Deuteromycetes Classification of Deuteromycetes The Deuteromycetes, commonly known as the ‘imperfect fungi,’ are categorized into four distinct form orders based on various characteristics. Each form order represents a unique mode of reproduction and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The development of frogs follows a typical sequence of events observed in sexually reproducing organisms. It begins with the fertilization of an egg or zygote. The zygote then undergoes a series of divisions, dividing and re-dividing to form an embryo. The embryo is the earliest stage of development and remains within the egg or reproductive ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Developmental Biology? Developmental biology is a scientific discipline that focuses on understanding how organisms grow, develop, and mature from a fertilized egg into a complex multicellular organism. It explores the processes, mechanisms, and patterns that shape the formation of tissues, organs, and the overall body plan throughout an organism’s life cycle. Developmental biologists ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The most common cause for human disease is viral infections. Millions are still dying from viral infections, including hepatitis and human immunodeficiency viruses (HIV).

What is Diaphragm of a Microscope? History of Diaphragm Definition of Diaphragm of a Microscope The diaphragm of a microscope is a component that controls the amount of light that passes through the specimen being observed. It is typically located between the light source and the stage, and consists of a series of adjustable blades ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Diatom? Definition of Diatom A diatom is a tiny, single-celled algae with a hard shell made of silica, found in oceans, waterways, and soil. They play a crucial role in oxygen production, nutrient cycling, and the food web of aquatic ecosystems. Scientific classification of Diatom Domain: Eukaryota Clade: Diaphoretickes Clade: SAR Clade: Stramenopiles ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Diatoms? Classification of Diatoms Diatoms, those mesmerizing aquatic organisms with their glass-like structures, hold a unique place in the world of classification. As members of the protist kingdom, they are eukaryotic organisms that do not fit squarely into the categories of plants, animals, or fungi. Instead, diatoms find their formal classification under the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Diauxic growth? When a bacterium is incubated in a medium containing two sugars one monosaccharide and another di or polysaccharide (like glucose and lactose). The bacteria first utilize glucose and complete their lag and log phase. After completion of glucose utilization, they used lactose and produce and another lag phase due to the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Monocot Stem? Characteristics Features of Monocot Stem Monocot stems possess unique characteristics that distinguish them from other plant types. These features play a crucial role in their growth, development, and overall functionality. The following points outline the defining characteristics of monocot stems: What is dicot Stem? Characteristics Features of dicot Stem Dicot stems ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Passive and active transport are two different methods to move molecules across cells' membranes. The cell membrane is multi-tasking device that provides structure to the cell , while protecting the contents of the cytosol from the outside environment.

Aerobic respiration refers to a series of metabolic reactions that occur in the presence oxygen in a cell. It is used to convert chemical energy into ATPs.

What is Analytical balance? What is Triple beam balance? Difference Between Analytical Balance Vs Triple Beam Balance Topic Analytical Balance Triple Beam Balance Structures The components of an analytical balance are a weighing pan, an anti-draft ring, a display panel, a keyboard, two glass doors, four levelling feet, a level bubble, an rs-232 interface, a ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Asexual reproduction is the process of reproduction that does not involve gamestasy, and does not require the exchange of genetic information which results in offspring that are identical to their parents.

What is BOD? What is COD? Difference between Biochemical Oxygen Demand (BOD) and Chemical Oxygen Demand (COD) – BOD vs COD Similarities Between BOD and COD Difference between Biochemical Oxygen Demand (BOD) and Chemical Oxygen Demand (COD) pdf Download References

Biomagnification Bioaccumulation Difference between Biomagnification and Bioaccumulation

The biotic factor , also known as the component of the biotic refers to the living thing that creates the ecosystem.

A bone is a connective tissue in which living cells, tissues and other components are contained within hard, non-living intercellular material.

Breathing is also known as 'external respiration' because it is an external procedure of bringing oxygen into the body and exchanging carbon dioxide through the respiratory organs. The breathing process in all vertebrates is comprised of a high-yielding tubes which connect the nose with the alveoli. Breathing is a continuous cycle in which the amount of respiratory cycles in a minute is referred to as breathing or the rate of breathing. Under normal circumstances the speed and the depth of breathing is controlled by various homeostasis processes to regulate the partial pressure of carbon dioxide levels in the blood.

An anion can be described as an atom, or an atom group bearing either negative or positive electrical charges.

The DNA library is composed of DNA fragments that were transformed into vectors that can recognize and identify specific DNA fragments. There are two kinds of libraries: cDNA or genomic libraries. The genomic DNA libraries contain huge DNA fragments. On the other hand cDNA libraries are made up of reverse-transcribed, cloned mRNA. In the end, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Celsius scale, also known as the centigrade scale is a temperature scale that is based upon the point at which water freezes at 0degC, and the point at which water boils at 100degC.

A Chromosome is a thread-like form found in the nucleus or nuclear region of cytoplasm. It's made of one DNA molecule (Deoxyribonucleic acid) and proteins, which carry certain or all of the genetic materials in an organism.

Cilia and Flagella are tiny structures attached to eukaryotic and prokaryotic cells. They protrude from the surface of their cells. These structures help in the locomotion of unicellular organisms. Accordingly, they mainly contain proteins called microtubules or basal bodies. In the case of single-celled eukaryotic organisms, both cilia and flagella are vital for locomotion.

What is Cilia? What is Microvill? Difference between Cilia and Microvilli Cilia Microvilli Epithelial cells generate cilia, which are elongated, hair-like structures. Microvilli are epithelial cell-derived membrane protuberances. Cilia develop from basal granules. Basal granules are lacking in microvilli. Cylindrical cilia with tapered ends. Microvilli are cylindrical and terminate in blunt tips. Microvilli are shorter ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Cladogram tree? What is Phylogenetic tree? Cladogram vs Phylogenetic tree Cladogram Phylogenetic Tree Represents evolutionary relationships based on shared derived traits (synapomorphies) Represents evolutionary relationships among organisms or groups of organisms Focuses on identifying and grouping organisms based on shared characteristics Represents the pattern of descent and the evolutionary history of species or ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is a Classical Pathway? What is an Alternative Pathway? What is a Lectin Pathway? Similarities Between Classical Alternative and Lectin Pathway The complement components in different activation pathways Activation pathway The C component designations The activated C component designation C regulators The triggering/ initiator C component Classical C1q, C1r, C1s, C2, C3, C4, C5, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

In the realm of technological devices and gadgets, customization to cater to user preferences is a ubiquitous feature. While most devices boast a single adjustment knob for each controlled element, there are instances where a more nuanced approach is taken, featuring two distinct knobs: coarse and fine adjustments. These two modes of adjustment offer users ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Also known as transmissible diseases, or infectious diseases, communicable diseases can also be called transmissible diseases. The infectious agent is transmitted to others by contact with bodily fluids, bodily fluids, bites of insects, and air. Infectious diseases can spread either directly or indirectly. Direct transmission means that the infectious agent is transmitted through close physical contact. In indirect transmission, it is spread through air, water or other vectors.

Comparison between Compound Microscope and Simple Microscope.

In all organisms, somatic cells are diploloid, and sexual cells are typically haploid. The cells that are diploid have two homologous copies of two chromosomes inherited through two parental. The majority of mammals are diploid, with the exception of some rats. But, studies that have disproved that there is polyploidy among mammals have been conducted. Polyploidy is a condition where cells possess chromosomes which are more than diploid number of chromosomes. The majority of organisms that reproduce through mitosis have 2n DNA chromosomes, forming diploid cells.

Endocytosis is a cellular process by which cells internalize substances from their external environment. Exocytosis is a type of process, in which involves the movement of materials from the inside of a cell to the exterior of the cell by the use of energy.

Enzymes (or enzymes) are proteins that act like biological catalysts (biocatalysts). Catalysts speed up chemical reactions. Substrates are molecules on which enzymes can act. The enzyme then converts these substrates into other molecules called products. Enzyme catalysis is required for almost all metabolic processes within the cell to occur at sufficient rates to sustain life. 8.1 Metabolic pathways are dependent on enzymes to catalyze individual processes. Enzymology is the study of enzymes. The pseudoenzyme analysis field recognizes that some enzymes lost their ability to catalyze biological reactions during evolution. This is often evident in their amino acid sequences or unusual 'pseudocatalytical' properties.

Epithelial tissue is a kind of animal tissuethat is composed of polyhedral cells that are tightly aggregated joined tightly to each other as cellular layers that define the inside of hollow organs as well as protect the body's the body's surface.

Prokaryotic DNA Replication Eukaryotic DNA Replication Initiation Elongation Termination Similarities Between Prokaryotic and Eukaryotic DNA Replication difference between prokaryotic and eukaryotic dna replication 1. Location 2. Stage of Cell Division 3. Initiation 4. Direction of Replication 5. Enzymes DNA replication in prokaryotes and eukaryotes utilises comparable enzymes, although DNA replication in eukaryotes is more intricate ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Exocrine glands are those equipped with ducts which allow cells to secrete their product through these ducts, so that they are released onto the surfaces of the targeted organs or cells. The cells in the exocrine glands are connected to the epithelium covering them with small tubular ducts that transport the secretions to the target locations. Exocrine glands' secretions are not mixed into the bloodstream, as some of these substances could even cause harm in the blood if they are released.

Exotoxin is a toxins produced by bacteria. Exotoxins can cause damage to the host by damaging cells or disrupting normal cell metabolism. They are extremely powerful and could cause significant harm on the human host. Exotoxins can be released, or, as with endotoxins, they can be released when cells. Gram negative pathogens can release outer membrane vesicles with lipopolysaccharide endotoxin, as well as some viral proteins within the bounding membrane as well as other toxins in the intra-vesicular content and thus add an unimagined dimension to the widely-known membrane vesicle transport, which is extremely active in the interface between host and pathogen.

What is Gene? What is Allele? Differences Between Gene and Allele Understanding the concepts of genes and alleles is crucial in genetics. While both terms are fundamental to the study of heredity, they refer to different aspects of genetic information. Here, we explore the distinctions between genes and alleles, outlining their roles and characteristics in ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

There are two types of DNA libraries that are constructed by genetic engineers using scientific methods. These can be classified as cDNA libraries as well as Genomic libraries. The major distinction in cDNA as well as Genomic library is the fact that cDNA library is a repository for the complementary DNA cloned from the all ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

"Gram-positive" and "gram negative" are two terms used to classify two distinct kinds of bacteria. The distinction is in the form cells' walls and the way they react with Gram staining.

Habitats are natural ecosystem in which an organism is found and makes use of the resources in the area to survive, for shelter and food sources, and mating.

Heterochromatin is a densely packed or condensed DNA which is distinguished by the intense staining when stained by nuclear stains. They also contain transcripts that are inactive.

What is Heterosis? Heterosis, commonly known as hybrid vigor, refers to the phenomenon where the offspring of two genetically different parents exhibit greater vigor, growth, yield, or other desirable traits than either of the parent strains. This increased performance in hybrids is a key concept in plant breeding and agriculture. Here’s a closer look at ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Homologous Chromosomes? Homologous chromosomes are fundamental components of the genetic architecture in diploid organisms, including humans. These chromosomes are pairs that have the same structure and genes, though they may carry different alleles, or variations, of those genes. Understanding homologous chromosomes is crucial for grasping the mechanisms of heredity and genetic variation. What ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Through technological advances, The methods for sterilization have changed throughout the decades. There are now many different methods of sterilization employed in laboratories. However, autoclaving using steam is the most popular method for sterilization in the majority of labs. Although autoclaving is a clean rapid, reliable, and cost-effective method of sterilization, without any environmental risks and risks, it is still utilized most often in hospitals. However, there are three commonly employed methods of sterilization that are used: the steam autoclave unsaturated chemical-vapor sterilizer as well as the dry heat sterilizer. This article will only focus on steam autoclaves and dry heat sterilization techniques.

Osmosis refers to the movement of water molecules through semi-permeable membranes from high to low water potential. This semi-permeable membrane does not allow for solute particles to pass through it, but solvent particles (water molecules), can move across it. Tonicity can be described as the degree of the osmotic pressure gradient. There are three states. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Incomplete dominance is one of the mechanisms for dominance among heterozygotes in which the dominant allele does not fully overpower the phenotypic expressions of the recessive one, and there is an intermediate phenotype within the heterozygote.

An Independent Variable is kind of variable that is used in experiments, studies, statistical modeling and mathematical modeling that isn't dependent on any other variables that are part of the research.

Inhalation, also known as Inspiration, is a type of breathing that involves the inhalation of air. It is when the air is drawn into the lungs through the contraction of the diaphragm and respiratory muscles.

What are Lenticels? What are Hydathodes? Difference between Lenticels and Hydathodes Lenticels and hydathodes are both specialized structures in plants, yet they serve distinct functions and are located in different regions. Understanding their differences is essential for comprehending how plants regulate gas exchange and water balance. Below is a detailed comparison of these two structures: ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Linkage? What is Crossing Over? Difference Between Linkage and Crossing Over Here is a detailed comparison of these two genetic phenomena: Aspect Linkage Crossing Over Definition Tendency of genes close on the same chromosome to be inherited together during meiosis. Exchange of genetic material between non-sister chromatids of homologous chromosomes. Relationship of Related ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Lytic Cycle? The lytic cycle is a fundamental process in the life cycle of certain viruses, particularly bacteriophages, which are viruses that infect bacteria. This cycle is characterized by the following sequential events: The term “lytic” is derived from “lysis,” referring to the rupture and death of the host cell. This cycle contrasts ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The Major Histocompatibility Complex (MHC) is an extremely connected group of genes throughout all mammal species. The MHC is also known by HLA complex. HLA complex of humans as well as the H-2 complex in mice.

What are Monocarpic Plants? Examples of Monocarpic Plants Here are some notable examples of monocarpic plants: What are Polycarpic Plants? Examples of Polycarpic Plants Here are some examples of polycarpic plants: Difference Between Monocarpic and Polycarpic Plants Examples: Additional Differences: Difference Chart Between Monocarpic and Polycarpic Plants Characteristic Monocarpic Plants Polycarpic Plants Flowering Produce flowers ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Monocot Leaf? What is Dicot Leaf? Difference between Monocot and Dicot Leaves – Monocot vs. Dicot Leaves The differences between monocot and dicot leaves are fundamental in understanding plant biology, as these two groups exhibit distinct structural and functional characteristics. Both types of leaves are essential for plant life but serve varying purposes ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are unicellular organisms? Examples of Unicellular Organisms Unicellular organisms are remarkable entities that carry out all life processes within a single cell. These organisms can be found in various environments, from freshwater to marine habitats, and even in extreme conditions. Their simplicity, in terms of cellular structure, is contrasted by the diverse roles they ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Natural selection is the process that allows an organism to adapt to changing environmental conditions through the introduction of changes in the genotype of its genetic material.

What is Northern Blotting? Northern blotting is a laboratory technique used to study gene expression patterns by detecting and analyzing RNA molecules. It is named after its similarity to the Southern blotting technique, which is used for DNA analysis. The Northern blotting method allows researchers to determine the presence, size, and abundance of specific RNA ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

O antigen and H antigen are different in that O is the bacteria's outermost layer, while H is the flagella's threadlike structure.

In One-step RT-qPCR or One-step real time Polymerase chain reaction (PCR) the reverse transcriptase and DNA polymerase are premixed into a single tube.

An Oviparous animal is a creature that produces eggs which later develop into young ones, after being pushed out from the body of the female.

What is Photosystem 1 (PS1)? What is Photosystem 2 (PS2)? Difference between Photosystem 1 (PS1) and Photosystem 2 (PS2) Feature Photosystem I (PSI) Photosystem II (PSII) Location in Thylakoid Membrane Outer surface Inner surface Photocenter P700 P680 Absorbing Wavelength >680 nm <680 nm Photophosphorylation Both cyclic and non-cyclic Only non-cyclic Photolysis of Water No Yes ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Phytoplankton, a group free-floating microalgae, is an important component of freshwater, ocean and sea ecosystems.

Pinocytosis refers to the ingestion of liquid into a cell by the budding of small vesicles from the cell membrane.

Pollination is the transmission of gametes from males (pollen grains) in plants from the male reproductive part (anther) to the female reproductive part (stigma).

Primary metabolites are substances which are directly involved in the metabolic pathways of an organism , which are necessary to its development, growth and reproduction. They are a part of the physiological processes that occur within the organism. Primary metabolites are generated in the body during the growth phase due to the mechanism of growth. The phase of growth which is associated with the creation of primary metabolites is referred to as 'trophophase'..

What is primary sewage treatment? What is secondary sewage treatment? Difference between primary and secondary sewage treatment Primary Treatment Secondary Treatment Difference Chart between primary and secondary sewage treatment Aspect Primary Treatment Secondary Treatment Nature of Process Physical process involving removal of solid particles from sewage. Biological process involving the degradation of organic matter. Method ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Primary succession refers to a type or ecological succession that occurs in an environment that has just been formed, but does not have any habitable soil. However, living organisms are then colonized for their first time.

Difference Between Prokaryotic and Eukaryotic Cells Difference Between Prokaryotic and Eukaryotic Cells TOPIC PROKARYOTIC CELL EUKARYOTIC CELL Cell Type Single-cell Multicellular Cell Size 0.5-3um 2-100um Cell Wall Cell wall present, comprise of peptidoglycan or mucopeptide (polysaccharide). Usually cell wall absent, if present (plant cells and fungus), comprises of cellulose (polysaccharide). Number of chromosomes One–but not ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Unicellular organisms that don't possess membrane-bound organelles, such as nucleus and mitochondria are known as prokaryotic cells. They are classified into two groups based on the constituents of the cell wall Bacteria as well as Archaea.

Qualitative data deals with descriptions. It can be observed , but is not able to be calculated. In contrast Qualitative data is one that is focused on mathematical calculations and numbers and can be calculated as well as calculated.

When it comes to DNA replication and amplification, primers play a crucial role. Primers are short nucleotide sequences that provide a starting point for DNA synthesis. However, not all primers are created equal. There are two main types: RNA primers and DNA primers. Understanding the difference between RNA primers and DNA primers is essential for ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Saturated fats are the most basic type of fats. They are linear chains with no branches made of CH2 groups that are linked by single carbon bonds. They are joined by the terminal carboxylic acid.

The major distinction between simple and facilited diffusion is that simple diffusion is not accompanied by the involvement of the channel or carrier proteins whereas the facilitated one takes place through channels or protein carrier proteins.

What is Quenching ? Quenching relates to a process that reduces the fluorescence intensity of a supplied substance. A variety of methods can succeed in quenching, such as excited state reactions, energy transfer, complex-formation and collisional quenching. As an outcome, quenching is often profoundly dependent on pressure and temperature. Some examples of common chemical quenchers are ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is a Telomere? Telomeres are crucial components found at the ends of chromosomes. They are made up of repetitive nucleotide sequences that protect the genetic material from damage. Each time a cell divides, the telomeres shorten, playing a key role in cellular aging and health. Here’s a breakdown of what telomeres are, how they ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Vascular plants, often referred to as tracheophytes, are the plants on the land with cells that are lignified to conduct minerals and water all over the body.

Difference Between Virus and Viroids In this article we will discuss about Differences Between Viroids and Prions. Virus Virus is a microscopic, infectious particle that can reproduce or replicate within the living cell of an organism or host. Viruses can not reproduce without a host cell. They infect almost all living forms such as animals, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The Xylem is a blood vessel which transports water as well as dissolved minerals that are absorbed by root to remainder part of the plant.

In biology, absorption refers to the procedure of absorbing or assimilating substances within cells or across tissues through the process of diffusion or Osmosis.

Actin is one of the globular proteins. They're among the top proteins within the majority of eukaryotic cells. They assist in providing structure, shape and flexibility to the body.

The immune system shields the body from a range of pathogens and the toxins. Innate immunity is the first line of defense against pathogens via physical and chemical barriers , such as mucus layers, skin and saliva. The second line of defense is also triggered by innate immunity via the phagocytes. This defense line is ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The duration of time that is for acute diseases is dependent according to the nature of the disease and its context however it is more concise in comparison to chronic illnesses. The term "acute" can also be used to refer to conditions where the onset of symptoms is sudden and happens quickly. In the case of severe disease is usually fulminant when it's not always true for acute rhinitis. It is commonly associated with the common cold.

Agglutination reactions help fragment test antigens, which are typically coupled to the carrier. The carrier could be made up of (such as charcoal or latex particles) or biological (such as red blood cells). The process of agglutination involving Red blood cells can be known as Hemagglutination. The process that involves the white blood cells can be referred to as leukoagglutination.

Amphibians belong to a class of vertebrates with cold blood that is adept at exploitation of terrestrial and aquatic habitats.

Angiosperms are flowering plants which are the biggest and the most diverse group of plants within the kingdom of Plantae.

Bacillus anthracis, a Gram-positive, rod-shaped bacterium, causes anthrax. This is a deadly disease that can infect livestock and humans. It is the only permanent (obligated) pathogen in the genus Bacillus. Because it can be transmitted from animals to people, its infection is called zoonosis. Robert Koch, a German physician, discovered it in 1876. It became the first pathogen to be experimentally demonstrated. It was also the first scientific proof for germ theory.

The primary distinction between antigenic drift or antigenic change is the fact that antigenic drift is a way to create change in viruses that is caused by the accumulation of mutations in genes that encode for antigen-binding sites, whereas antigenic shift is a method of combining two kinds of viruses to create one new type that has an assortment of surface antigens of the viruses that were originally.

d arterial blood vessels are the two kinds of blood vessels that are part of the closed circulatory system. The primary purpose that blood vessels serve is move circulation of blood around the entire body. However, veins and arteries differ in design and purpose.

An autotroph is a type of organisms that produce their own food through the use of diverse substances like sunlight, water and various other chemicals.

An autotroph is one of the groups of organisms that can produce their own food using diverse substances like sunlight, water and various other chemical compounds.

B cells and T cells are two kinds of lymphocytes involved in activating the immune system within the body. Both B and T cells are created within the bone marrow. T cells move into the thymus to develop. T cells as well as B cells play a role in the recognition of pathogens as well as other harmfulforeign substances within the body, such as parasites, viruses, bacteria and dead cells. Two types of T cells comprise called helper T cells and cytotoxic cells. 

What is Backcross Method? The backcross method is a genetic technique used in plant breeding and animal genetics to transfer a specific trait from one organism to another while maintaining the genetic background of the recurrent parent. This method involves several key steps and objectives: Key Concepts of the Backcross Method Advantages of the Backcross ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Bacteria are single-celled microscopic species that are distinguished in the absence of an incipient nucleus as well as a few organelles that have no membranes.

Both kinds of fission are the two types of Asexual reproduction, where the binary fission gives rise to two daughter cells that are derived from the parental cell while in multiple fission the parent cell is the one that gives birth to a number of daughter cells. Binary fission is one the most commonly used ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Bones and cartilage are two essential components of the skeletal system in vertebrates, providing structure, support, and protection to the body. While both bones and cartilage contribute to the framework of the body, they differ significantly in their composition, physical structure, cellular makeup, and functions. Understanding the differences between bones and cartilage is crucial for ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is bulk Method? The bulk method is a plant breeding technique used to develop new varieties by selecting plants with desirable traits through repeated cycles of selection and propagation. Here’s a brief overview of how it works: The bulk method is often used in the early stages of breeding programs to quickly evaluate and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Chemokines as well as cytokines constitute two immune modulating agents that are involved in mediating and modulating of the immune system's responses. immune system. Different types of cytokine superfamilies are recognized: chemokines INFs, INFs, CSFs, TGFs and TNFs. They differ only by the function they perform within the body. Chemokines cause a gradient of concentration that directs other leukocytes to the location of the infection. The primary distinction between chemokines and cytokines is that cytokines are tiny proteins that are released by cells within the body that affect other cells. Chemokines are a part of the superfamily of cytokines and possess Chemotactic properties.

The bathroom, experiencing the urge to bowel, peeing regardless of what you refer to it as stool is a normal element of your daily life. But, there are times when this process of eliminating waste from your body alters. If you experience fluid or loose stool, this is known as diarrhea. This is a fairly common occurrence that usually goes away without treatment.

involved in transmitting the genetic code needed for protein synthesis. Certain viruses also use DNA as their material for genetics.

DNA replication, in molecular biology is the biological process by which two identical copies of a DNA molecule are created. As the main part of biological inheritance, DNA replication is an essential component in all living organisms. This is necessary for cell division, growth, and repair of damaged tissue. It also ensures that each new cell receives its own copy DNA. Because cells possess the unique property of division, replication of DNA is essential.

What is Dominance Hypotheses? The Dominance Hypothesis refers to a concept in plant breeding and genetics that deals with the expression of traits in offspring based on the dominance of alleles. It essentially posits that in a heterozygous state, one allele (the dominant allele) can mask the expression of another allele (the recessive allele). Here’s ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Early and Late Wood? Early wood and late wood are fundamental components of tree growth, produced by the cambium layer in response to seasonal changes. These two types of wood are differentiated based on the time of year they are formed and their structural characteristics, playing crucial roles in a tree’s overall development. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Proteomics and Genomics are two major areas of molecular biology. Genomes are the biological material that makes up an organism. It contains genes that contain the information about genetics of organisms (genetic code). The research conducted to uncover the information contained in the genome is called genomics.

Cell-mediated immunity and immunological immunity are two kinds of adaptive immune responses which allow the human body to protect itself in a targeted manner against harmful substances such as viruses, bacteria and contaminants. While there is some overlap between the two parts of the immune response and both are based on the function of lymphoid cell function - there are some significant distinctions.

What is Hyaline cartilage? Characteristics of Hyaline cartilage The characteristics of hyaline cartilage make it well-suited for its various functions, including providing structural support, reducing friction between joint surfaces, facilitating smooth movement, and aiding in the growth and development of skeletal elements. What is Elastic cartilage? Elastic cartilage is a type of connective tissue that ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Vertebrates and Invertebrates are the two categories into which all the species of animals are classified. Animals are heterotrophic, multicellular organisms that are classified within the kingdom known as Animalia. The primary distinction between vertebrates and invertebrates lies in the fact that vertebrates comprise of a backbone while invertebrates don't have an internal backbone.

Meningitis refers to inflammation of the meninges. Meninges refer to the three membranes covering the brain and spinal chord. When fluid around the meninges becomes contaminated, meningitis may occur.

Both microtubules and microfilaments are components of a cell’s cytoskeleton. Microtubules, microfilaments, and intermediate filaments compose the cytoskeleton. Tubulin proteins are polymerized to produce microtubules. They provide the cell with mechanical support and help to intracellular transport. Polymerization of actin protein monomers produces microfilaments. They contribute to the mobility of the cell on the surface. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Mitochondria originates of the Greek word meaning'mitos' thread and 'chondrios'-granule. Mitochondria are also referred to as the "powerhouse of cells' because their primary purpose is to generate energy through the process of ATP.

In cell biology, the process of mitosis is a phase of the cell cycle , in which duplicated chromosomes are divided into two nuclei. Cell division creates cells that are genetically identical, in which the number of chromosomes are maintained. Thus, mitosis is called equational division. In general the case of mitosis, it begins with S stage of interphase (during the time that DNA replication occurs) and is usually followed by cytokinesis and telophase that divides the organelles, cytoplasm and cell membrane of a cell into two cells that contain roughly equal amounts of the cellular components. Different stages of mitosis together are the basis for what is known as the Mitotic (M) period of the animal cell cycle, which is the split of the cell's mother into daughter cells that are genetically identical to one another.

What is Monocot Flower? What is Dicot Flower? Differences Between Monocot and Dicot Flower – Monocot vs. Dicot Flower Monocot and dicot flowers represent two major categories of flowering plants, with distinct characteristics that set them apart. These differences encompass their floral structures, pollen, and methods of pollination. Understanding these distinctions is crucial for identifying ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Monocot Root? Monocot roots refer to the root systems found in monocotyledonous plants, commonly known as monocots. These plants typically exhibit a distinct root architecture that differentiates them from dicots (dicotyledonous plants). Here is a detailed examination of monocot roots: Structure of Monocot Roots: Functions of Monocot Roots: Examples of Monocot Roots: Common ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Dicot Seed? Dicot seeds, belonging to the group known as dicotyledons, are characterized by the presence of two embryonic leaves, or cotyledons. This classification represents one of the primary divisions among flowering plants, or angiosperms, highlighting the diversity within plant biology. Dicot seeds are crucial for understanding plant development, morphology, and ecological roles. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Dicot Stem? What is Monocot Stem? Differences Between Monocot and Dicot Stem – Monocot vs. Dicot Stem The following points outline the primary contrasts between monocot and dicot stems: Aspect Monocot Stem Dicot Stem Basic Structure Typically circular and hollow. Generally solid and cylindrical. Hypodermis Composition Composed of non-green sclerenchyma fibers. Made up ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Monohybrid cross Dihybrid cross Differences Between Monohybrid cross vs Dihybrid cross Characterisitcs Monohybrid Cross Dihybrid Cross Definition A genetic cross involving the study of one trait A genetic cross involving the study of two different traits Number of traits One trait Two traits Alleles involved Two alleles Four alleles Genotype combinations Three possible genotypes Nine ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Neisseria meningitidis, also known as meningococcus is a Gram-negative bacterium which may cause meningitis or other forms of meningococcal infection like meningococcemia, which is life-threatening sepsis. The bacterium is described as a coccus due to the fact that it is round and, more specifically, is a diplococcus due to the tendency of it to create pairs.

Nitrification is the biological process that involves the oxidation of ammonia to Nitrite, followed by the conversion of the nitrite to the nitrate.

Phenotype is a term that is used in genetics to describe all traits that can be observed in living organisms that result of interactions of the genotype and the environment.

Plasmodium viridax, a protozoal parasite, is a human pathogen. This parasite is the most common and widespread cause of recurring malaria. P. viridax malaria can cause severe illness and death. It is more virulent than Plasmodium falciparum (the most deadly of the five human malaria parasites), but it can be fatal. P. viritax is transmitted by the female Anopheles mosquito. The males don't bite.

Viridans streptococci comprise a vast collection of Gram-positive commensal streptococcal bacteria that are hemolytic and produce a green hue on blood plates (hence the name "viridans", from Latin "viridis", green). The pseudo-taxonomic name "Streptococcus viridans" is often used to describe this species group, however, those who don't prefer using the term "pseudotaxonomic" (which refers to a group of species as though they comprised one species) prefer to use the terms viridans streptococci, viridans streptococci group (VGS) or the viridans species of streptococcal. They do not possess Lancefield antigens. In general, the risk of pathogenicity is very low.

When differentiating between poisonous and non-poisonous snakes, several key physical characteristics and features can be observed. Understanding these differences is crucial for identifying and handling snakes safely. Poisonous Snakes Non-poisonous Snakes Differences Between Poisonous and Non-poisonous Snakes Characteristic Poisonous Snakes Non-poisonous Snakes Body Color Generally bright Not so bright Neck Constriction Present Absent Head Shape ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Polyembryony? What is Apomixis? Characteristics of Apomixis Characteristics of Polyembryony Differences Between and Apomixis Characteristics of Apomixis vs. Polyembryony Category Apomixis Polyembryony Offspring The offspring are genetically identical to the parent plant. This is because the embryos are produced asexually from the parent’s cells. The offspring can either be genetically identical or genetically ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Primary succession can be described as a kind of eco-succession that occurs in an area that is new and has no suitable soil, and is first colonized with living creatures.

A single-celled organism without nucleus and other organelles with membranes. Prokaryotes are derived in the Greek pro (pro"pre" - meaning "before") and the word karuon (karyon, meaning 'nut' or "kernel"). In the two-empire model that resulted in the works of Edouard Chatton, prokaryotes were classified as part of the Empire of Prokaryota. However, in the three-domain system that is based on molecular analysis, prokaryotes are divided into two domains: Bacteria (formerly Eubacteria) and Archaea (formerly Archaebacteria). Organisms with nuclei are put in the third domain, Eukaryota. When studying the evolutionary origins of life prokaryotes are believed to have ascended before Eukaryotes.

What is Pureline Selection? Pureline selection is a plant breeding method used to develop new varieties from a single genotype or “pure line.” This approach is based on selecting and propagating individuals that consistently exhibit desirable traits, aiming to create a genetically uniform and stable line. Here’s how it typically works: Pureline selection is particularly ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

White blood cells are two of the components of the blood supply in mammals. RBCs (RBCs) are biconcave discs that are circular in shape with hemoglobin-containing pigments to carry oxygen throughout the animal's body. Oxygen is essential to the catabolism of cells within animals. A portion of carbon dioxide is transported through RBCs. They are created as a waste product in catabolism. They are also known as white blood cells. (WBCs) contain a range of types of cells like leukocytes neutrophils, and monocytes. They are able to differentiate into various defense mechanisms. The major distinction in red and white blood cells lies with their purpose that red blood cells transport oxygen around the human body, whereas white blood cells play a role with the protection of animals by destroying pathogens that attack the body's cells.

What is Sapwood? Sapwood, also known as alburnum, is the outer, lighter-colored layer of wood found in a tree, situated between the bark and the heartwood. It is composed of living cells, including vessels and fibers, and plays a crucial role in the tree’s physiological processes. Here are some key characteristics and functions of sapwood: ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

In many domains, including medicine, statistics, and machine learning, it is vital to comprehend the complexities of diagnostic tests and their outcomes. There are four key principles that come into play when assessing a diagnostic test’s efficacy: sensitivity, specificity, false positives, and false negatives. Confusion and incorrect interpretation of test results can result from the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Plasma and serum are two blood derivatives which do not have blood cells such as red blood cells white blood cells and platelets. Both are enriched with proteins, drugs hormones, toxins and electrolytes. Both plasma and serum can be used to treat and diagnose. They are separated from blood using centrifugation, which eliminates the blood's cellular component. Blood is infused with anticoagulants when it has been transfused to stop the clotting. The serum color is amber, while the plasma color is straw. The primary difference between serum as well as plasma lies in the fact that the latter is a protein-rich liquid that separates when blood is coagulated, whereas plasma forms the liquid part of blood that holds blood cells suspended.

Staphylococcus is an genus of Gram-positive bacteriophages within the family of Staphylococcaceae of the family of Bacillales. Under microscope they appear to be as spherical (cocci) and are found clusters that resemble grapes. Staphylococcus species are anaerobic, facultative organisms (capable of growth anaerobically and aerobically).

Taenia Solium Characteristics of Taenia Solium Taenia solium, also known as the pork tapeworm, is a parasitic flatworm that infects humans and pigs. Here are some of its characteristics: Life history of Taenia solium Fasciola Hepatica Characteristics of Fasciola Hepatica Fasciola hepatica is a parasitic flatworm that infects the liver and bile ducts of various ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Transcription is the process by which the genetic information stored on DNA strands is transferred into an RNA-RNA strand via the polymerization process caused by enzymes known as DNA-dependent polymerases.

What is Transduction? Steps of Transduction The process of transduction involves several steps, which can be summarized as follows: The overall outcome of transduction is the transfer of genetic material, including specific genes or genetic elements, between bacteria. This process facilitates the spread of genetic diversity, including the transfer of antibiotic resistance genes or virulence ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Type 1 error in tests of statistical hypotheses, refers to the mistake that is caused by refusing to accept a null hypothesis even though it's true. Type 1 errors occur when a hypothesis that ought to be accepted was rejected. Type I errors are identified by an (alpha) also known as an error. It is also known as the significance level that the tests. This type of error can be described as a false negative error in which it is impossible to prove the hypothesis due to an error in the test.

Differences Between Viroids and Prions In this article we will discuss about Differences Between Viroids and Prions. Viroid: Viroids are known as the smallest infectious pathogens which are made up solely of a short strand of circular, single-stranded self-replicating RNA that has no protein coating. Prions: Prion is an abnormal or misfolded protein that causes ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Voluntary muscles are muscles that are movable by at the discretion of a person . They are usually connected to the skeleton system.

Voluntary muscles are those that are movable by your own freewill of a person . They are usually connected to the skeleton system.

Mold and yeast are two types of fungi that grow. They are multicellular or unicellular microorganisms of the eukaryotic family. They are saprophytes that live externally decomposing organic material and absorbing nutrients via their cell walls.

Because the aim of biologists is to cultivate microorganisms or eukaryotic cells with no introduction of any extraneous organisms aseptic methods are essential for ensuring that experiments are conducted with precision and accuracy. Always keep in mind that a totally safe working environment for scientists does not exist.

Why do different forms of DNA exist? Main spiral properties of DNA forms. Prop|Form A B Z Spiral type Right Right Left Step, Å 28.03 33.75 43. 5 Bases per coil 11 10 12 Major groove width, Å 7.985:A.P — 30:B.P4:A.P — 31:B.P 17.918:A.P — 29:B.P9:A.P — 28:B.P 15.1714:A.P — 27:B.P13:A.P — 28:B.P Minor groove ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Acrylamide Stock Solution Preparation Application: Acrylamide is used along with bisacrylamide to form gels used in SDS-PAGE. Acrylamide forms polyacrylamide polymers, while bisacrylamide crosslinks between polyacrylamide chains. To prepare 1L of Acrylamide Stock Solution the following components are required; Component Amount Concentration acrylamide (mw: 71.08 g/mol) 389.6 g 5.481 M bisacrylamide (mw: 154.17 g/mol) 10.4 ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Antibodies? Antibodies, also known as immunoglobulins (Ig), are Y-shaped proteins produced by specialized white blood cells called B lymphocytes (B cells) in response to the presence of foreign substances known as antigens. Antibodies are an essential component of the immune system and play a crucial role in recognizing, binding to, and neutralizing antigens. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

For the creation of solutions and manipulation of liquids, numerous vessels and apparatuses are employed in the laboratory. They differ in their intended application and precision. Volumes must always be measured at a constant temperature because changes in temperature result in volume changes owing to thermal expansion. At 10 °C, water has a substantially smaller ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Plasma Membrane Functions of Plasma Membrane Models of Plasma Membrane Following are descriptions of the top four historical Plasma Membrane models. The examples are: 1. Lipid and Lipid Bilayer Model 2. Unit Membrane Model (Protein-Lipid Bilayer-Protein) 3. Fluid Mosaic Model Modifications of Fluid Mosaic Model 1. Microvilli 2. Intercellular Spaces 3. Interdigitations 4. Desmosomes and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Programming Language? A programming language is a formal language that is used to write computer-executable instructions or code. It is a set of rules and syntax that enables programmers to communicate with computers and assign them specific instructions or tasks. Programming languages enable the creation of algorithms and software applications. They offer a ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Birds are among some of the top vertebrate creatures on Earth. There are over 9000 species of birds, and they're scattered across all of the planet from the poles all the way to the equator.

What is Immunological Techniques? Immunodiffusion tests Single Diffusion in One Dimension (Oudin Procedure) Double Diffusion in One Dimension (Oakley- Fulthrope Procedure) Single diffusion in two dimensions (Radial immunodiffusion) Double diffusion in Two Dimension (Ouchterlony Procedure) Immunoelectrophoresis Counter Immunoelectrophoresis Rocket Electrophoresis Radioimmunoassay (RIA) Enzyme-Linked Immunosorbent Assay (ELISA) Enzyme-Linked Immunosorbent Assay (ELISA) is a widely used and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Designed to enlarge things too tiny for the human eye to see, a microscope is a tool. It provides a portal to the hidden world of minute structures, allowing medical practitioners, teachers, and researchers to examine materials, cells, and creatures in until unheard-of clarity. Microscopes range significantly in kind, from simple to very sophisticated models. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Differential centrifugation (or the differential velocity method) is one of the most prevalent techniques applied in biochemistry and cell biology regarding the separation of organelles and other subcellular particles according to their sedimentation rates. It is available not only for separate microscopic analyses, but also as a useful technique for preliminary remediation of suspended nonliving ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Diffusion? Definition of Diffusion Diffusion is the process by which molecules move from an area of higher concentration to an area of lower concentration, driven by random molecular motion, until equilibrium is reached. Types of Diffusion Diffusion is a critical process in biology, physics, and chemistry, where molecules move from an area of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Digastric Muscle? Digastric Muscle Definition The digastric muscle is a bilaterally paired suprahyoid muscle located beneath the jaw, characterized by two distinct ‘bellies’—an anterior and a posterior section—that play pivotal roles in jaw movement and swallowing. Characteristics of Digastric Muscle The digastric muscle exhibits several distinctive characteristics: Where is the Digastric Muscle Located? ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The earthworm, a vital detritivore in terrestrial ecosystems, possesses a specialized and efficient digestive system tailored for its diet and lifestyle. This system is characterized by its alimentary canal, a continuous tubular structure that extends longitudinally from the anterior mouth to the posterior anus. This canal is essential for the processing and absorption of organic ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Insects exhibit a remarkable diversity in their feeding habits, leading to significant adaptations in their digestive systems. These adaptations can be classified based on their dietary preferences, which include phytophagous (plant-eating), entomophagous (insect-eating), wood-boring, wool-feeding, and saprophytic behaviors. Each of these feeding strategies necessitates specific structural modifications within the digestive system to efficiently process the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Digital microscopes are modern microscope which does not have an eyepiece. This is a huge contrast from an optical microscope. Digital microscopes have an electronic camera that acts as the detector as well as the imaging output gadget. It displays the images takes place via a computer's screen or monitor, which defines the scope of the microscope's digital.

What is Dinoflagellate? Definition of Dinoflagellate Dinoflagellates are single-celled eukaryotic microorganisms, primarily found in marine environments, characterized by two whip-like flagella that facilitate movement. Many species are photosynthetic, and they play vital roles in aquatic ecosystems, ranging from primary producers to causing phenomena like bioluminescence and red tides. Dinoflagellates Classification Dinoflagellates are a diverse group ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Domain: Bacteria Phylum: Actinomycetota Class: Actinomycetia Order: Mycobacteriales Family: Corynebacteriaceae Genus: Corynebacterium Species: C. diphtheriae What is Diphtheroids? (Corynebacterium diphtheriae) Characteristics of Diphtheroids/Corynebacterium diphtheriae The infectious disease known as diphtheria is caused by the bacterium Corynebacterium diphtheriae. Key characteristics of Corynebacterium diphtheriae are as follows: Due to pervasive vaccination programs, diphtheria is now uncommon in many ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Diploid Cell? Definition of Diploid Cell A diploid cell is a cell that contains two complete sets of chromosomes, one inherited from each parent. Features of diploid cells Diploid cells are integral to the genetic architecture of many organisms. Here are the salient features of these cells: Diploid cells in Human body In ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Direct ELISA? Principle of Direct ELISA The principle of direct ELISA revolves around the specific binding interaction between an antigen and its corresponding antibody. In this type of ELISA, the antigen of interest is adsorbed or immobilized onto the surface of a plastic plate, typically a microtiter plate with multiple wells. To minimize ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Direct Microscopic Count (DMC) Cell Counting Formula In Counting Chamber The number of bacterial cell per milliliter (ml) = Number of cells counted X dilution (if used) X 50,000* The factor of 50,000 is used in order to determine the cell count for 1 ml: 1 ml = 1000 mm3 = (50 times the chamber ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Whta is Dirt and Soil? Direct Observation of the Samples Requirements Procedure Step 1: Wear Protective Gloves Before handling soil and dirt samples, put on a pair of gloves to maintain aseptic conditions and prevent contamination. Step 2: Preparation of Samples Using a spatula, scoop a small amount of dirt and place it onto a ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Disaccharides? Definition of Disaccharides Disaccharides are sugars formed by the joining of two monosaccharide molecules through a glycosidic linkage. They are soluble in water and include examples like sucrose, lactose, and maltose. Properties of Disaccharides Disaccharides possess several properties that are influenced by their structural characteristics and composition: These properties contribute to the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Aspects of Plant Diseases Aspects of plant diseases encompass a multifaceted study of the various factors that contribute to the development and impact of diseases on plants. Understanding these aspects is critical for effective disease management and prevention in agriculture. The occurrence of a plant disease is contingent upon three essential elements: the presence of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Ever wondered about the little scientific marvels you hold in your hand during chemistry or biology labs? We’re shining a spotlight on one such unsung hero of the scientific world – disposable glass pasteur pipettes.  These handy tools, so often taken for granted, have a fascinating history and a crucial role in your experimental success. Let’s dive in and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Disruptions to Ecosystems Characteristics of Ecosystems Disruptions Ecosystem disruptions, commonly referred to as disturbances, possess several defining characteristics that critically shape their ecological consequences. Understanding these characteristics is essential for grasping how ecosystems respond to and recover from various forms of disruption. Key Implications of These Characteristics: Different causes for Disruptions of Ecosystems Different causes ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is a Dissecting microscope or a Stereo microscope? A dissecting microscope—also known as a stereo microscope—is an optical microscope study apparatus that enables the observation of an object at low to moderate magnification (typically 5x to 250x) through reflective light versus transmitted light. Thus, it’s a microscope made for viewing little details that could ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Distant Hybridization (Wide hybridization)? Definition of Distant Hybridization Distant hybridization, or wide hybridization, refers to the crossing of individuals from different species or genera that are more distantly related than varieties within the same species, aiming to introduce novel traits and increase genetic diversity. History of Distant Hybridization Objectives of Distant Hybridization Barriers ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Types of Waters Inhabited by Microorganisms Biotopes of water microorganisms may include subterranean and/or surface waters, as well as sediments on the ocean floor. Microorganisms of Aquatic Environment Microorganisms inhabit surface waters in all zones; they may be suspended (plankton), cover fixed submerged objects, plants, etc. (periphyton), or reside in sediments at the bottom (benthos). ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is DNA? DNA is a polymer of deoxyribonucleotides stuck together (or simply deoxynucleotides). It is made up of deoxyadenylate (dAMP), deoxyguanylate (dGMP), deoxycytidylate (dCMP), and deoxythymidylate (dTMP) units (dTMP) (Some authors prefer to use TMP instead of deoxythymidylate because it is only found in DNA.) History of DNA The history of DNA begins with ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is DNA Analyzer? DNA Analyzer Principle  Parts of DNA Analyzer Operating Procedure of DNA Analyzer Applications of DNA Analyzer Advantages of DNA Analyzer Limitations of DNA Analyzer

In the world of genetics, there exists a remarkable technique that allows us to unlock the mysteries hidden within our DNA. DNA fingerprinting, also known as DNA profiling, is a laboratory genetic method that has revolutionized the way we identify individuals, establish relationships, and investigate crimes. By analyzing specific regions of our unique genetic code, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Helicase? What is DNA Helicase? History of DNA Helicases The history of DNA helicases begins with their discovery in the mid-1970s. These enzymes, crucial for unwinding DNA strands, have been extensively studied across a wide range of organisms. From bacteria to plants and humans, research on helicases has revealed their essential role in ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is DNA Ladder? Definition of DNA Ladder A DNA ladder is a solution containing DNA molecules of known lengths that are used as a reference to estimate the size of unknown DNA fragments separated through gel electrophoresis. Characteristics of DNA Ladder DNA ladders used for electrophoresis possess several important characteristics to ensure their effectiveness ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is DNA Library (Genomic, cDNA)? Types of DNA Library There are two main types of DNA libraries: genomic libraries, and cDNA libraries. 1. Genomic Library 2. cDNA Library Genomic Library Construction Steps Genomic Library Construction Steps Creating a cDNA library begins with mRNA, which carries genetic instructions from DNA to ribosomes for protein synthesis. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Ligase? In biochemistry, ligases are a class of enzymes that incorporate joining of two large molecules by forming new bond. This process which is referred to as ligation, commonly entails a hydrolysis of a indivisible chemical group of one of the substrates which allows formation of new linkages that include C-O, C-S or ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is DNA Methylation? DNA Methylation Definition DNA methylation is an epigenetic process in which a methyl group (CH3) is added to the DNA molecule. This modification primarily occurs at the 5-carbon position of the cytosine ring, resulting in the formation of 5-methylcytosine (5-mC). It is considered one of the major mechanisms for regulating gene ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The DNA microarray technology is among the most effective technology that can offer an extremely high-throughput and precise overview of the whole transcriptome and genome, which lets scientists understand the molecular processes that underlie natural and malfunctioning biological processes. Microarray technology may accelerate the process of screening thousands of protein and DNA samples at once.

What is DNA Polymerase? DNA polymerases Definition DNA polymerases are enzymes that catalyze the synthesis of DNA molecules from nucleoside triphosphates, playing a crucial role in DNA replication and repair across all living organisms. Properties of DNA Polymerase DNA polymerases possess several important properties that contribute to their role in DNA replication. These properties ensure ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is DNA polymerase I? Definition of DNA polymerase I DNA polymerase I (Pol I) is an enzyme found in prokaryotes that plays a role in DNA replication and repair, primarily assisting in the removal of RNA primers and filling in the resulting gaps with DNA nucleotides. Structure of DNA polymerase I Mechanism of DNA ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is DNA polymerase II? Definition of DNA polymerase II DNA polymerase II (DNA Pol II) is a prokaryotic DNA-dependent DNA polymerase that primarily functions as a backup enzyme in DNA replication and repair processes. It belongs to the B family of DNA polymerases and possesses DNA synthesis and proofreading activities. Structure of DNA polymerase ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is DNA polymerase III (holoenzyme)? Definition of DNA polymerase III (holoenzyme) DNA polymerase III holoenzyme is the primary enzyme complex in prokaryotes responsible for DNA replication, possessing both synthesis and proofreading capabilities to ensure accurate replication of the genome. Components of DNA polymerase III (holoenzyme) The DNA polymerase III holoenzyme, a central player in ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is DNA polymerase IV? Definition of DNA polymerase IV DNA polymerase IV is a prokaryotic enzyme encoded by the dinB gene, involved in mutagenesis and DNA repair processes, especially during the SOS response to DNA damage. Unlike many polymerases, it lacks proofreading activity, making it error-prone, but it plays a crucial role in translesion ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is DNA Recombination? The main thing that happens in recombination is the exchange of genetic information. Types of DNA Recombination Recombination is mainly of four types: There are two other kinds of recombination that are used in recombinant DNA technology. It is well known that restriction endonucleases and DNA ligases can cut and join ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is dna repair mechanism? DNA repair is a collection of processes by which a cell identifies and corrects damage to the DNA molecules that encode its genome. dna repair definition Types of dna repair mechanism There are present four types of DNA Repair System such as; 1. Mismatch Repair System Enzyme participate in dna ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is DNA Sequencing? Definition of DNA Sequencing DNA sequencing refers to the techniques used to determine the order of the nucleotide bases adenine, guanine, cytosine, and thymine within a DNA molecule. Methods of DNA Sequencing DNA sequencing is a crucial technique used in various fields of biological research, allowing scientists to unravel the genetic ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Domain? Definition of Domain In biology, a domain is the highest taxonomic rank used to categorize and group organisms based on shared characteristics and evolutionary history. Domain in the Tree of Life Development of the Domain System The conception and evolution of the domain system, a fundamental framework for the classification of life, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Dot Blot is a simplified technique of western blotting, which is mainly used for the detection of proteins.

What is Double Beam Balance? Double Beam Balance Principle Purpose of Double Beam Balance Parts of double beam balance A double beam balance is a mechanical mass measuring equipment with many important components: Operating Procedure of double beam balance Advantages Limitation Usage of Double beam balance Difference Between a Triple Beam Balance & Double Beam ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Double Circulation? Types of Circulatory Systems In the animal kingdom, circulatory systems are fundamental for the transport of nutrients, gases, and waste products. There are primarily two types of circulatory systems: the open circulatory system and the closed circulatory system. Each of these systems has distinct mechanisms and efficiency levels, catering to the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Dounce Homogenizer? Working Principle of Dounce Homogenizer Prats of Dounce Homogenizer The main parts of a Dounce homogenizer are: Operating Procedure of Dounce Homogenizer Types of Dounce Homogenizer Designed for the mild and effective homogenizing of biological materials, like tissues and cells, dounce homogenizers are specialist laboratory tools. They comprise two well made ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Downstream processing? Downstream processing refers to the procedures required to recover and purify fermentation-produced products. In the step of downstream processing, particles, mostly cells, are separated from the liquid using filtration, centrifugation, and flocculation. Steps Of Downstream Processing Five stages in downstream processing after Fermentation: Stage 1: Solid-Liquid Separation 1. Flotation 2. Flocculation ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

History of medicinal plants The history of medicinal plants is a profound narrative that traces humanity’s relationship with nature, reflecting a continuous quest to alleviate suffering and cure ailments. This exploration begins with primitive practices rooted in superstition and speculation, evolving into a scientific understanding of pharmacology that we recognize today. Classification of drugs The ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Food Preservation by Drying Purpose of drying The purpose of drying in food processing is multi-fold and serves several important functions. Here are the key purposes of drying: Principle of Preservation by Drying/ Dehydration/ Concentration The principle of drying in food processing is based on the state of water in the food and its effect ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Dutch elm disease (DED)? Dutch elm disease, often called DED, is a nasty problem for elm trees. It’s caused by a type of fungus that gets carried around by tiny beetles. When these beetles munch on healthy trees, they leave behind fungal spores that grow inside the tree’s veins—the parts that move water ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Ecological Succession? Ecological Succession Definition Ecological succession is the systematic and predictable process by which species composition in an ecosystem changes over time, progressing from initial colonization to a mature and stable community. Characteristics of Ecological Succession Ecological succession is a fundamental concept in the realm of ecology, delineating the sequential transformation of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

E. coli, short for Escherichia coli, is a versatile bacterium that can be found in a variety of environments, including certain foods, soil, and the intestines of animals, including humans. It belongs to the genus Escherichia and exhibits a wide diversity of strains. While many strains of E. coli are harmless and even beneficial, some ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Earthworm? Classifications of Earthworms Earthworms, commonly known as nightcrawlers, are complex organisms that play a vital role in the ecosystem. Their classification within the biological hierarchy is detailed and sequential, providing a comprehensive understanding of their evolutionary lineage and biological significance. Habit and habitat of Earthworm Earthworms are fascinating creatures that play a ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

A Molecular Biology Technique is used for the identification of Post Translation Modification mostly carbohydrate Epitopes by transferring onto a membrane and analyzed using a probe.

Ebola Virus Ebola Virus Classification Hosts of Ebola Virus Structure of Ebola Virus Genome of Ebola Virus The genome is composed of a single strand of negative RNA and measures around 18–19 kilobases in length. There are seven proteins in all that are encoded by the genome. Neither the 3′ nor the 5′ end is polyadenylated or ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Hydrophytes? Classification of Hydrophytes The classification of hydrophytes is based on their morphological and ecological characteristics, leading to a categorization into five distinct groups. Each group of hydrophytes has adapted to its specific aquatic environment, reflecting the diversity of survival strategies among aquatic plants. Morphology of Hydrophytes The morphology of hydrophytes, or aquatic ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Ecological efficiency? Energy transfer Energy transfer in an ecosystem is a fundamental process that involves the flow of energy from one trophic level to another. The energy originates from primary production, which occurs in autotrophic organisms such as plants and algae. These photoautotrophs convert solar energy into chemical energy through the process of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Ecological Pyramids? Definition of Ecological Pyramids Ecological pyramids are graphical representations that depict the distribution of energy, biomass, or numbers of organisms across different trophic levels in an ecosystem. Features of the Ecological Pyramid The Ecological Pyramid is a fundamental concept in ecology, offering a structured visual representation of the distribution and flow ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

India boasts an exceptionally rich wildlife heritage, underpinned by a long-standing tradition of conservation. The ethical foundation of wildlife preservation in India can be traced to ancient times, where conservation principles were embedded within the cultural and spiritual practices of its people. These values were cultivated by sages, emphasizing the connection between humans and nature. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Economic Importance of Algae Overview Algae is a photosynthetic, eukaryotic marine organism. Their size ranges from unicellular microalgae to giant kelp. Algae are characterized by their lack of flowers, formal roots, leaves, or even stems.  They can grow anywhere such as in the dirt or on rocks, marine water, freshwater, etc. Algae are variable in ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

In this article, we will learn about the Economic Importance of Fungi in agriculture, industries, medicine, etc. There are present a huge number of fungi, which has tremendous economic importance to humans. Every day we benefited or were harmed directly or indirectly by those fungi. They help in yielding antibiotics, maintain the soil fertility, cause ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is a gymnosperm? Uses of Gymnosperms Ecological Importance of Gymnosperms Economic Importance of Gymnosperms 1. Ornamental value of Gymnosperms 2. Food Value of Gymnosperms 3. Medicinal value of Gymnosperms Gymnosperms, comprising conifers, cycads, ginkgoes, and gnetophytes, are significant sources of bioactive compounds with medicinal properties. These plants produce a variety of phytochemicals, including alkaloids, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Protozoa are unicellular, microscopic, eukaryotic protists which are found in everywhere such as water; soil, on the body of plants and animals. They lack a cell wall and their size ranges from 5 to 250 micrometers.

In the early 20th century there was no treatment to treat infections caused by bacteria. This included tuberculosis and pneumonia, as well as the rheumatic and gonorrhea diseases, and infections of the urinary tract. However, in 1929 the the bacteriologist Alexander Fleming discovered the first real antibiotic, penicillin, heralding a new era of medical science. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Population density significantly influences the dynamics of ecosystems, affecting various biological processes and interactions. Understanding the factors that impact population density is crucial for comprehending how species coexist and thrive in their environments. Population regulation is often shaped by density-dependent factors. These factors become more significant as population density increases. One of the primary density-dependent ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Egg Cell? Definition of Egg Cell An egg cell, or ovum, is the female reproductive cell in sexually reproducing organisms. It is a haploid cell produced in the ovaries through oogenesis and is essential for fertilization, as it combines with a sperm cell to form a diploid zygote, which can develop into a ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Egg Yolk Agar modified is based upon the original Egg Yolk Agar formula developed by McClung & Toabe to isolate and differentiate organisms based in Lecithinase, lipase production, and proteolytic activities.

What is Elastic Cartilage? Definition of Elastic Cartilage Elastic cartilage is a specialized type of connective tissue characterized by its yellowish appearance and high content of elastic fibers. It is found in body organs that require flexibility and shape maintenance, such as the external ear, epiglottis, and eustachian tube. Elastic cartilage provides strength and elasticity ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Electrocardiogram (ECG)? Purpose of ECG Test The electrocardiogram (ECG) test is a fundamental diagnostic tool utilized in cardiology to assess the heart’s electrical activity and rhythm. Its purposes are multifaceted, enabling healthcare providers to detect, diagnose, and monitor various cardiac conditions effectively. Working principle of electrocardiograph/Electrocardiogram Waves of Normal ECG A normal electrocardiogram ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is the Electrofusion of Plant Cells? Materials Required for Electrofusion Electrofusion of plant cells involves a variety of materials essential for the successful execution of the technique. The following is a comprehensive list of the materials required, each with a detailed explanation of its function in the electrofusion process: Electrofusion Protocol The following detailed ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

An electron microscope is an instrument which produces an image of a sample by means of a beam of electrons. Optical microscopes use light to form an image, electron microscopes have greater resolution, and can be used to observe objects that are too small to be seen with an optical microscope. In a large variety ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Electron Spin Resonance (ESR)? Working Principle of Electron Spin Resonance (ESR) How Does Electron Spin Resonance (ESR) Works? Instrumentation/Parts of Electron Spin Resonance (ESR) Component Function Klystrons Act as the radiation source; stabilized against temperature fluctuations; frequency controlled by voltage and an automatic circuit; power output around 300 milliwatts. Waveguide/Wavemeter Placed between oscillator ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is the Electron Transport Chain? Electron transport chain Definition The electron transport chain is a series of protein complexes and molecules located in membranes, where electrons are transferred through redox reactions to generate a proton gradient that drives ATP synthesis via oxidative phosphorylation. Electron Transport Chain Animation Video Fundamentals of the Electron Transport Chain ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Electroporation? Electroporation is a fascinating technique that temporarily makes cell membranes more permeable by applying brief electric pulses. This method, widely used in labs and medical settings, allows substances like DNA, drugs, or proteins to enter cells by creating tiny pores in the membrane. Imagine zapping cells with a controlled jolt of electricity—this ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Electroporator (Electroporation machine)? An electroporator, often called an electroporation machine, is a lab instrument used to temporarily make cell membranes more permeable. Think of it as a precision tool that helps scientists sneak substances like DNA, drugs, or proteins into cells—something that’s tricky to do manually because cell membranes are naturally protective. The ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

can be described as an test of immunoprecipitation (immunodiffusion) test that determines what specific strain of Corynebacterium Diphtheriae is toxic.

What do you mean by elements of life? What are essential chemical elements? What are Trace Elements? Basic Elements Required in the Human Body The human body depends on several basic elements to function properly, each playing a critical role in various biological processes. These elements form the foundation of the body’s structure and contribute ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is ELISA? What is ELISA reader? Purpose of an ELISA reader Principle of ELISA Plate Reader Types of Elisa Plate Readers Essential tools in labs for identifying and counting biological, chemical, or physical events on microtiter plates are ELISA (Enzyme-Linked Immunosorbent Assay) plate readers. In academic institutions as well as in the pharmaceutical and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is ELISA test ? Definition of ELISA ELISA, short for Enzyme-Linked Immunosorbent Assay, is a widely used laboratory technique that detects and measures the presence of specific antibodies or antigens in a sample. It involves the binding of target molecules (antibodies or antigens) to a solid surface, followed by the addition of enzymes or ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is ELISA? ELISA, short for enzyme-linked immunosorbent assay, is a widely used and highly sensitive test in the field of immunoassays. It was first introduced by Eva Engvall and Peter Perlmann in 1971 and has since become a gold standard technique for detecting and quantifying various molecules, including hormones, glycoproteins, proteins, antibodies, and antigens. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Eosin Methylene Blue (EMB), a microbiological media, is a differentiating medium that slightly inhibits the growth and color of Gram-positive bacteria. It also provides a color indicator to distinguish between organisms that ferment lactose (e.g. E.coli) and those who do not (e.g. Salmonella, Shigella). Holt-Harris, Teague, and Levine first created EMB agar.

What is Embryo Development in Plants? Development of the embryo (Embryogenesis) The development of the embryo in angiosperms, known as embryogenesis, is a complex and highly regulated process that transforms a diploid oospore (zygote) into a mature embryo. This process involves several key stages and can be categorized into different types based on the patterns ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is an Embryo Sac? Definition of Embryo Sac The embryo sac is the female gametophyte in flowering plants, located within the ovule, where fertilization occurs, leading to the development of the seed and endosperm. Structure of Embryo Sac The structure of the embryo sac, also known as the mature female gametophyte, is integral to ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The study of embryology, also known as embryos, is a key element of evolution in biology and can identify the commonalities and differences between different species. The embryo of an organism refers to the fertilized egg that it progresses through the stages of development, which are unique to the particular species. In examining how the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Embryology? Definition of Embryology Embryology is the scientific study of the formation, development, and growth of embryos and fetuses within organisms. History of Embryology The historical trajectory of embryology is a testament to humanity’s enduring quest to understand the origins and development of life. This journey, spanning diverse civilizations, offers a rich tapestry ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Embryonic Induction? Historical Background of Embryonic Induction The historical background of embryonic induction is marked by the pioneering work of Hans Spemann, a German embryologist, and his student Hilde Mangold in the 1920s. Their extensive research on newt species, specifically Triturus cristatus and Triturus taeniatus, led to the discovery of neural induction. In ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Embryonic Stem Cell? Definition of Embryonic Stem Cell Embryonic stem cells (ESCs) are pluripotent cells derived from the inner cell mass of a blastocyst, an early-stage embryo, capable of differentiating into any cell type within an organism. History of Embryonic Stem Cell The history of embryonic stem cells (ESCs) is marked by pioneering ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Emulsion PCR? Principle of Emulsion PCR Emulsion PCR (polymerase chain reaction) is a sophisticated technique designed to amplify individual DNA templates in a high-throughput manner by partitioning the DNA into tiny water-in-oil droplets. Each droplet serves as an independent microreactor, allowing for the separate amplification of distinct DNA fragments. This method leverages the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Hey there today in this article we will learn about epidemiology. Before we know about the epidemiology, first we need to analyse the term epidemiology. The term epidemiology comes from a Greek word epidemios which mean “among the people” and logos, meaning “study”. Epidemiology is a branch of microbiology in which epidemiologist are concern about ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Endemism? Endemism Definition Endemism is the condition where a species is native to and restricted to a specific geographic area, such as an island or country, and is not found naturally elsewhere. What is an Endemic Species? Types of Endemism Endemism can be categorized into several distinct types, each reflecting different evolutionary and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Endo created Endo Agar to distinguish gram-negative bacteria based on lactose fermentation and inhibit gram-positive bacteria. The latter were not inhibited by bile salts, as was traditional. Endo was able to inhibit gram-positive bacteria using sodium sulfite, basic fuchsin.

What is Endocrine Glands? Definition of Endocrine Glands Endocrine glands are ductless glands that secrete hormones directly into the bloodstream to regulate various physiological processes in the body. Characteristics of Endocrine Glands Endocrine glands possess several distinct characteristics that differentiate them from other types of glands. Here are the key characteristics of endocrine glands: Overall, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Endocrine System? Definition of Endocrine System The endocrine system is a network of glands that release hormones directly into the bloodstream to regulate various bodily functions, including metabolism, growth, reproduction, and mood. It works in conjunction with the nervous system to maintain homeostasis and coordinate complex processes within the body. Structure of Endocrine ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Endocrinology? Definition of Endocrinology Endocrinology is the branch of medicine and biology that studies the endocrine system, its glands, and the hormones they produce. It focuses on how hormones regulate various physiological processes, including growth, metabolism, reproduction, and behavior, as well as the diagnosis and treatment of hormonal disorders. History of endocrinology Endocrinology, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Endocytosis is a cellular process by which cells internalize substances from their external environment. 

What is the Endoplasmic Reticulum? Endoplasmic Reticulum (ER) Definition The endoplasmic reticulum (ER) is a large, membrane-bound organelle found in eukaryotic cells. It plays a crucial role in the synthesis, folding, modification, and transport of proteins and lipids. The ER is divided into two types: the rough ER, studded with ribosomes and involved in protein ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Endosperm? Definition of Endosperm The endosperm is a tissue found in seeds of flowering plants that provides nourishment to the developing embryo. It is formed from the fertilization of a secondary nucleus by a sperm cell and can vary in structure, including nuclear, cellular, or ruminate types, depending on the plant species. Characteristic ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Endospores are dormant, tough, resistant, and non-reproductive structures which are produced by gram-positive bacterial cell (such as bacillus, clostridium) in the phylum firmicutes during the unfavorable condition of the environment.

There are two methods which are commonly used to stain bacterial endospore such as Schaeffer Fulton and Klein methods.

What is Endosymbiosis? Definition of Endosymbiosis Endosymbiosis is a form of symbiosis in which one organism (the endosymbiont) lives inside the cells or body of another organism (the host), often resulting in mutual benefits for both entities. Endosymbiotic Theory The Endosymbiotic Theory offers a comprehensive explanation for the evolutionary transition from prokaryotic to eukaryotic cells. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Endosymbiotic Theory? Definition of Endosymbiotic Theory The Endosymbiotic Theory posits that certain organelles in eukaryotic cells, specifically mitochondria and chloroplasts, originated from free-living prokaryotic cells that were engulfed by ancestral eukaryotic cells, leading to a mutually beneficial symbiotic relationship. Origin of the eukaryotic cell 1. Gene Trees and the Complexity of Eukaryotic Origins ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Endotoxin definition/what is endotoxin? Endotoxin examples The term”endotoxin” is typically used to describe the pyrogens that Gram-negative bacteria produce. In the field of bacteriology, this complicated compound is also referred to as lipopolysaccharide. It can be located in the membranes on the outside of bacteria such as Escherichia Coli, Salmonella shigella, Vibrio cholerae as well ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Energy Flow Energy Flow in Ecosystem Law of Thermodynamics in the Ecosystem Food Chain In the ecosystem, there are basically three different kinds of food chains. In nature, we mostly look at the food web because many living things eat both plants and animals. So, they live in more than one trophic level. Producers are ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Energy rich compound? Phosphoenolpyruvate Structure of Phosphoenolpyruvate The structure of phosphoenolpyruvate (PEP) consists of a three-carbon pyruvate molecule with an additional phosphate group attached to one of the carbon atoms. Here is the structural formula of PEP: HO-C=O | P-O-P-OH | CH2-CHO In the structure, the central carbon atom is double-bonded to an ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Enhancer RNA? Enhancer RNAs Detection Functions of enhancer RNAs Biogenesis of Enhancer RNAs 1D eRNAs 2D eRNAs Enhancer RNAs in disease Enhancer RNA and inflammation Enhancer RNA and neurodegenerative disorders Enhancer RNA and cancer Enhancer RNA in diabetes Mechanisms of Enhancer RNAs Transcriptional Noise Transcription-dependent effects Functional activity in cis Functional activity in ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Enhancers and silencers? What is Enhancer? Enhancers play a critical role in regulating gene expression in both prokaryotes and eukaryotes. They are specific regions of DNA that, despite their distance from the genes they influence, serve as crucial elements for the transcriptional activation of genes. Below is a detailed breakdown of what enhancers ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Entamoeba histolytica can be described as an anaerobic parasite amoebozoan that is part of the Genus Entamoeba. It is a major cause of infection for humans and other primates , causing amoebiasis. E. histolytica is estimated to affect between 35 and 50 million people across the globe.

What is Enteroaggregative E. coli (EAEC)? Disease Caused by Enteroaggregative E. coli (EAEC) Pathogenesis Mechanism of Enteroaggregative E. coli (EAEC) The pathogenesis of Enteroaggregative Escherichia coli (EAEC) involves several stages and mechanisms. EAEC is primarily transmitted through the fecal-oral route, often through contaminated food and water sources. The pathogenesis of EAEC is a complex process ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Enteroinvasive E. coli (EIEC)? Enteroinvasive Escherichia coli (EIEC) is a pathogenic bacteria that shares similarities with Shigella, a bacteria known to cause shigellosis. EIEC infections lead to a syndrome that closely resembles shigellosis, characterized by severe diarrhea and high fever. Unlike other types of E. coli, EIEC is highly invasive and enters intestinal ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Enteropathogenic Escherichia coli (EPEC) Enteropathogenic Escherichia coli (EPEC) are a group of strains of Escherichia coli that have been associated with diarrheal illnesses. The understanding of EPEC has evolved over time with the discovery of different mechanisms of pathogenesis. Here is a summary of the key points about EPEC: Advancements in techniques and a better ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Entner–Doudoroff pathway is an alternative pathway of Glycolysis. This pathway is found in Gram-negative bacteria, certain Gram-positive bacteria, and archaea. Entner–Doudoroff pathway Definition Entner–Doudoroff pathway containing Organisms Some example of bacteria those contain Entner–Doudoroff pathway are Pseudomonas, Azotobacter, Rhizobium, Agrobacterium, Escherichia coli, Enterococcus faecalis, Xanthomonas campestris, Zymomonas mobilis, Enterococcus faecalis. This pathway also found in ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Enzyme Immobilization Soluble Enzyme + Substrate———– Product (single time usage of enzyme) Immobilized Enzyme + Substrate———Product (Repeated usage of enzyme) A number of essential considerations must be made when immobilising an enzyme. What is a Support Matrix? It is a substance that facilitates the entrapment of an enzyme. For effective immobilization, a support matrix must ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Enzyme Inhibition? Types of Enzyme Inhibition There are present three types of Enzyme Inhibition such as; 1. Reversible Inhibition Reversible inhibition refers to the temporary cessation of enzyme activity due to the binding of a reversible inhibitor. This binding is not permanent, and the enzyme can regain its activity once the inhibitor is ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Enzymes? Definition of Enzymes Enzymes are protein molecules that act as biological catalysts, accelerating chemical reactions within living organisms without being consumed in the process. Characteristics Features of Enzymes Enzymes are biological molecules with distinct characteristics and features that enable them to play crucial roles in various biochemical processes. Here are the key ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What Are Enzymes? Structure of Enzyme  Enzymes Classification Historically, enzymes were given names based on their discoverer. With additional study, classification grew more exhaustive. The International Union of Biochemists (IUB) classifies enzymes into six functional classes based on the sort of reaction they catalyse. Hydrolases, oxidoreductases, lyases, transferases, ligases, and isomerases are the six types ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Eosinophils? Definition of Eosinophils Eosinophils are a type of white blood cells that are involved in combating parasites, regulating allergic reactions, and supporting immune responses. They have distinctive granules in their cytoplasm and play a crucial role in maintaining immune system balance. Characteristics of Eosinophil Eosinophils possess several distinctive characteristics: These characteristics collectively ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

A game changer for the microscopic world is epi-fluorescence microscopy. Imagine being able to see cells as vibrant, dynamic creatures showing off their inner workings instead of just as static objects. This method, based on the principle of fluorescence, has opened up the hidden details of life at the cellular level and made the invisible ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Epidemiology is the branch of public health that studies the distribution, patterns, and causes of diseases and health conditions in populations. It aims to identify risk factors for diseases, understand how they spread, and develop strategies to prevent or control health problems. Epidemiologists use data and research to track health trends and inform public health ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Epidermal Tissue System? Epidermal tissue system Components The epidermal tissue system, forming the outermost layer of the plant body, originates from the protoderm. This system is crucial for protecting the plant and regulating its interaction with the environment. The components of the epidermal tissue system include: Epidermis The epidermis is a fundamental component ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Epidermophyton floccosum is a type of filamentous  fungus which causes nail and skin infection in human beings. The anthropophilic dermatophyte may cause diseases like tinea pedis (athlete’s foot) and tinea cruris, tinea corporis and even onychomycosis. The diagnostic methods for fungal infection are physical examination, testing for culture, and molecular examination. Treatment for fungal infections ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are epimers? Epimer Definition Epimers are a type of stereoisomers that differ in configuration at only one stereogenic center while having the same configuration at all other stereogenic centers. Epimerization Main Characteristics of Epimers The main characteristics of epimers can be summarized as follows: How Do Epimers and Anomers Differ? Epimers and anomers are ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Epistasis is the interplay between genes that influence the character. Genes may mask one to the point that one gene is thought to be "dominant" or they can be combined to create a new characteristic. It's the relation between two genes that could be the basis for a particular phenotype of certain characteristics. Each locus has two alleles that define the phenotypes. They may affect each other in a manner that regardless of the particular allele of one gene it is recessive another dominant variant of. A different expression for epistasis requires a ratio chart, or table.

Epithelial Tissue is one the types of tissues (epithelial muscular, connective and nerve) in mammals. It is composed of polyhedral cells that are tightly aggregated that adhere firmly to each other, forming sheets of cells that cover the inside of hollow organs as well as covering the body's the surface. Epithelium, also known as epithelial tissue (plural epithelia) comprises cells that are laid out in continuous sheets, the form of single or multiple layers.

Epstein-Barr Virus (EBV), also known as Human Herpesvirus 4, is a virus that belongs to the herpesvirus family. It is one of the most common viruses in humans and is estimated to infect over 90% of people worldwide at some point in their lives. EBV is primarily transmitted through contact with infected saliva, such as ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Equisetum? Taxonomic Rank Name Division Sphenophyta Class Sphenopsida Order Equisitales Family Equisitaceae Genus Equisetum Equisetum Characteristics Equisetum, commonly known as horsetail, encompasses a distinctive group of plants that display unique morphological and ecological characteristics. These features highlight the evolutionary significance of Equisetum and its adaptability to various environments. Equisetum Morphology The structural components ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Ergastic Substances? Types of Ergastic Substances Ergastic substances of plants exist in three forms: 1. Reserve Materials Reserve materials are non-living inclusions in plants that serve as essential nutritional components for plant growth and development. They are categorized into three main types: carbohydrates, nitrogenous matters, and fats and oils. Each type plays a ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Erythrocyte Sedimentation Rate (ESR) can be described as a commonly used test used to detect non-specific signs of inflammation result of infection cancers, or certain autoimmune disorders. It is defined as the rate that Red Blood Cells (RBCs) accumulate over an hour.

Scientific classification of Escherichia coli Domain Bacteria Phylum Proteobacteria Class Gammaproteobacteria Order Enterobacterales Family Enterobacteriaceae Genus Escherichia Species E. coli Binomial name Escherichia coli Escherichia coli E. coli Habitat Geographical distribution of Escherichia coli  Reservoir, source, and transmission of infection  E.coli Morphology and Arrangement Antigenic Structure of E.coli Heat Stable Lipopolysaccharide (LPS) is the major ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Test Name Esculin Hydrolysis test Purpose  This test is used to try to figure out what kind of Enterobacteriaceae it is and how it differs from other kinds.To see if the microbe can use esculin as a source of carbon by breaking it down with water. Media Required Esculin Hydrolysis Agar Result Positive: Blackened medium, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Ethanol Metabolism? Definition of Ethanol Metabolism Ethanol metabolism is the biological process by which the body breaks down and eliminates ethanol, primarily in the liver, through a series of enzymatic reactions that convert it into less toxic compounds, ultimately producing energy and releasing water and carbon dioxide. Location of Ethanol Metabolism Distribution of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Ethanol? What is Ethanol (Alcohol) Fermentation? Ethanol Formula The molecular formula for ethanol is C2H6O, which indicates that it contains two carbon atoms and one oxygen atom. The hydroxyl group (-OH) at the end of the two-carbon chain is denoted by the structural formula for ethanol, C2H5OH. Properties of Ethanol Ethanol, commonly known ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Ethical Aspects of Biological Research? Ethical considerations are of utmost importance in biological research to ensure the responsible and humane treatment of living organisms, respect for participants’ rights, and the integrity of scientific inquiry. Ethical aspects of biological research encompass various principles and guidelines that researchers should adhere to. Here are some key ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Ethidium bromide is used to visualize DNA in agarose gels and in many cesium chloride gradient protocols.

What is Ethnobotany? Definition of Ethnobotany Ethnobotany is the scientific study of how people from different cultures use and interact with plants for purposes such as food, medicine, and rituals. It examines both traditional knowledge and cultural practices related to plants. History of Ethnobotany Concept of Ethnobotany Scope of Ethnobotany Ethnobotany in India Ethnobotany in ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

In this article you will learn about Ethnobotany as a tool to protect interests of ethnic groups. Sharing of wealth concept with few examples from India. Biopiracy, Intellectual Property Rights and Traditional Knowledge. Ethnobotany as a tool to protect interests of ethnic groups Ethnobotany, the study of the relationship between people and plants, plays a ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Ethology? Definition of Ethology Ethology is the scientific study of animal behavior in natural conditions, focusing on understanding behavior as an evolutionary adaptation. History of Ethology The history of ethology is a fascinating journey that has shaped our understanding of animal behavior and its evolutionary roots. Charles Darwin, renowned for his groundbreaking work ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Eubacteria? Definition of Eubacteria Eubacteria, also known as true bacteria, are prokaryotic microorganisms that belong to the domain Bacteria. They are single-celled organisms lacking a nucleus, with DNA organized in a single circular chromosome. Eubacteria can be gram-negative or gram-positive and have economic, agricultural, and medical significance. Examples include E. coli, Lactobacilli, and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Euglena? Definition of Euglena Euglena is a genus of single-celled microorganisms found in water, capable of photosynthesis and movement. General Characteristics of Euglenoid Euglenoids, a captivating group of unicellular organisms, exhibit a rich tapestry of characteristics encompassing their structure, habitat, habits, reserve food, and reproduction. This multifaceted profile sheds light on their intricate ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Eyespot help in cell’s phototaxis, it senses the intensity and direction of light source and responds to it. In response, it helps the organism in swim towards the light (positive phototaxis), or away from it (negative phototaxis).

What is Euglena? Requirements for Microscopy of Euglena Under The Microscope With these simple yet indispensable requirements, the microscopic realm of Euglena can be unlocked. By skillfully preparing a well-mounted slide with a carefully placed cover slip, the compound microscope becomes a portal to the hidden wonders of the single-celled organisms. The dropper serves as ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Eukaryotic Cell? Definition of Eukaryotic Cell A eukaryotic cell is a type of cell characterized by a membrane-bound nucleus and the presence of various organelles within its cytoplasm, distinguishing it from prokaryotic cells which lack a true nucleus. Eukaryotic cells are found in organisms such as plants, animals, fungi, and many unicellular entities. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Have you ever wondered how your body creates new cells? Or how genetic information is passed down from one generation to the next? The answer lies in a fascinating process called DNA replication. In this article, we’ll dive deep into the world of eukaryotic DNA replication, exploring its intricacies, importance, and the cutting-edge research surrounding ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Eukaryotic gene regulation is a fundamental aspect of molecular biology that plays a critical role in the expression of genes within eukaryotic cells. This intricate system governs when, where, and how much specific genes are expressed, which is essential for the proper development and functioning of organisms, ranging from unicellular protozoa to complex multicellular organisms, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Although the procedure of synthesis of RNA is the same in prokaryotes as well as eukaryotes however, the process is much more complicated in eukaryotes. In eukaryotes it is possible to synthesize RNA in the nucleus.

What is Eutrophication? Definition of Eutrophication Eutrophication is the process in which a water body becomes overly enriched with nutrients, leading to the excessive growth of algae and plankton. This often results in the deterioration of water quality, depletion of oxygen, and ecological imbalances in the affected ecosystem. Causes of Eutrophication – What causes eutrophication? ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Evolution? Evolution is a fundamental biological process that describes the changes in the inherited characteristics of populations of organisms over successive generations. It is the process by which species have emerged, diversified, and adapted to their environments over millions of years. At its core, evolution is driven by the following key concepts: Evolution ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Evolution? Definition of Evolution Evolution is the process by which species change over time through the gradual accumulation of genetic variations, driven by mechanisms like natural selection, genetic drift, and mutation, leading to the development of new traits or species. Evolution Theory The theory of evolution explains how species change over time through ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Origin of Parazoa Choanoflagellate: Link to sponges Sponges’ internal chambers are bordered by a series of specialised cells known as choanocytes (choano = collar; cyte =cell). These are the cells that feed sponges. Each choanocyte, like choanoflagellates, possesses a collar of tentacles enclosing a single anterior flagellum. By undulating dozens of flagella, choanocytes generate a ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Excretion in Annelida What is nephridia? Nephridia are specialized excretory structures found in many invertebrates, including annelids, that play a crucial role in eliminating metabolic wastes and maintaining osmotic balance. These tubular organs function similarly to kidneys in higher animals, facilitating the removal of waste products and regulating internal fluid composition. In annelids, such as ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Structure of The Kidney The kidney serves as a vital organ in the excretory system of many animals, functioning to filter waste from the bloodstream and regulate fluid balance. While mammalian kidneys are more complex than their fish counterparts, understanding their structure and function provides insight into their crucial role in maintaining homeostasis. Functions of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The earthworm, a vital detritivore in soil ecosystems, possesses a sophisticated excretory system that plays a pivotal role in waste elimination and osmoregulation. This system is primarily composed of specialized tubular structures known as nephridia. Originating from the ectoderm, nephridia are analogous to the kidneys observed in vertebrates, serving as the primary excretory organs in ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Exocrine gland? Definition of Exocrine gland An exocrine gland is a gland that releases its secretions through ducts onto epithelial surfaces outside of the body. Characteristics of Exocrine Glands Exocrine glands possess several characteristics that distinguish them from other types of glands in the body. Here are some key characteristics of exocrine glands: ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Exocytosis is a type of process, in which involves the movement of materials from the inside of a cell to the exterior of the cell by the use of energy.

What are exons? The history of the term “exon” dates back to 1978 when Walter Gilbert, an American biochemist, introduced the concept. Gilbert proposed a new perspective on the structure of genes, suggesting that the traditional idea of a cistron should be replaced by a transcription unit consisting of regions that would be lost from ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Experimental Group? Definition of Experimental Group The experimental group, in scientific research, refers to the group subjected to specific changes or treatments in a variable to observe and evaluate potential outcomes, in contrast to a control group which remains unaltered or standardized for comparison. How Does an Experimental Group Work? In the context ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Many individuals believe that in the 1950s, American biologist James Watson and English physicist Francis Crick discovered DNA. In actuality, this is not true. DNA was discovered by the Swiss chemist Friedrich Miescher in the late 1860s. Then, in the decades that followed Miescher’s discovery, other scientists, notably Phoebus Levene and Erwin Chargaff, conducted a ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Animal cells are ideal for recombinant protein production because they possess the ability to carry out post-translational modifications, a process that is often lacking in bacterial cells. This capability makes animal cells essential for the commercial synthesis of various biological products, including antibodies, hormones, growth factors, cytokines, and viral coat proteins, which are used in ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

1. The SXY–CIITA Regulatory System 2. TNF- And IFN-Induced Expression Of Mhc Class I 3. Expression Of Mhc Class Ib Genes 4. Other Regulatory Pathways Governing Mhc Class II Gene Expression

The morphology of insects encompasses their structural features, including body shape, size, and arrangement of various parts. Insects possess a three-part body plan consisting of the head, thorax, and abdomen. Insects also exhibit a variety of appendages and surface modifications that serve specific functions, such as camouflage, locomotion, and sensory perception. Their exoskeleton, made of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Extinction? What is Background extinction? Factors Involved in Background Extinction Background extinction, the natural rate of species loss throughout Earth’s history, is influenced by various factors that shape the delicate balance of ecosystems. While not as sensational as mass extinctions, background extinction occurs gradually as species struggle to adapt to environmental changes. Understanding ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Extra-embryonic Membranes? Types of Extra-Embryonic Membranes During chick development, four types of extra-embryonic membranes are formed: Each of these extra-embryonic membranes is composed of two germ layers. The amnion and chorion consist of the extra-embryonic ectoderm and the somatic layer of mesoderm, collectively known as the somatopleure. On the other hand, the yolk ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Extremophiles Definition Importance in Research Classifications of Extremophiles There are numerous types of extremophiles found all over the world, and each corresponds to the manner in which its environmental niche differs from mesophilic circumstances. These categories are not exhaustive. Many extremophiles are characterised as polyextremophiles because they belong to many groups. Thermococcus barophilus, for instance, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Microbiology of extreme environments focuses on the study of microorganisms that are capable of surviving and thriving in these harsh and inhospitable conditions. These microorganisms have evolved unique adaptations that allow them to withstand extreme temperatures, pressures, pH levels, salinity, and radiation exposure. Here are some key points about the microbiology of extreme environments: Studying ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The extrinsic pathway of apoptosis is a process whereby cells initiate programmed cell death in response to external signals, such as those from neighbouring cells or the immune system. This route is activated by the binding of particular ligands to cell surface death receptors, such as tumour necrosis factor (TNF) or Fas ligand. The binding ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Eye and Ear Microbiota (Microbiome) or Normal Flora of Eye & Ear? Normal Flora of the Ear Microorganism Type Category Staphylococcus spp. Gram-positive Bacteria Alloiococcus otitis Gram-positive Bacteria Corynebacterium spp. Gram-positive Bacteria Microbacterium spp. Gram-positive Bacteria Bacillus spp. Gram-positive Bacteria Arthrobacter spp. Gram-positive Bacteria Turicella otitidis Gram-positive Bacteria Micrococcus spp. Gram-positive Bacteria Moraxella ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Facilitated Diffusion? Facilitated diffusion Definition Facilitated diffusion is a passive transport process in which specific molecules move across a biological membrane with the aid of specialized transmembrane proteins, following their concentration gradient without the direct use of energy. Principle of Facilitated diffusion – How does facilitated diffusion work? The principle of facilitated diffusion ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Facilitated Diffusion? Facilitated diffusion is a specialized mechanism of passive transport across biological membranes. Unlike simple diffusion, which allows molecules to move freely based on their concentration gradients, facilitated diffusion employs specific transmembrane proteins to assist in the transport of molecules or ions. This process is spontaneous and does not necessitate direct energy ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

In the context of human beings,”growth” is a reference to the increase in size; as an example changing from a tiny newborn to a huge adult. While bacteria can grow in size prior to the division of cells, growth in bacteria is a term used to describe increasing the amount of organisms, instead of the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Many variables can affect the fermentation process of lactic acid bacteria (LAB) starters, including temperature, pH, strain capability, growth medium, inhibitors, bacteriophage, incubation period, heat treatment of milk, etc. To achieve the best activity of lactic acid bacteria during the manufacturing of fermented milks, caution is required. The following parameters significantly affect the growth and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Foods that are both animal and plant source play a significant role in the development of microbial communities. The ability of microorganisms develop or multiply in such food is contingent on the environment.

Interactions between microorganisms, animals, and plants are constant and natural. The ecological function of microorganisms and their role in the various biochemical cycles of nature are clearly documented. The human food supply is primarily composed of animals and plants or products that are derived from them, it's reasonable to assume that the food we consume may contain microorganisms that interact with food.

Ecological factors are environmental elements that have an effect on organisms and contribute to their distinctive behavioral patterns. These causes create dynamic population or species shifts in a certain geographical location. Types of Ecological Factors Abiotic Factors Abiotic elements are non-living components of an organism’s surroundings. A biotope is a habitat characterised by a certain ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Enzyme? Factors That Affects Enzyme Activity Enzyme activity, a crucial aspect of biological processes, is influenced by several key factors that dictate the rate and efficiency of enzymatic reactions. Understanding these factors is vital for comprehending the intricacies of enzyme functioning. Let us delve into the six main factors that affect enzyme activity: ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Fasciola hepatica – Classification Kingdom Animalia Phylum Platyhelminthes Class Trematoda Subclass Digenea Order Echinostomida Genus Fasciola Species hepatica Fasciola hepatica General Characteristics Habitat of Fasciola hepatica Hosts of Fasciola hepatica History and distribution of Fasciola hepatica Epidemiology of Fasciola hepatica Morphology of Fasciola hepatica/Structure of Fasciola Hepatica Shape, Size and Colour External Morphology Internal Morphology The architecture of F. hepatica’s body ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Fascioliasis is an infectious disease caused by Fasciola parasites, which are flatworms referred to as liver flukes. The adult (mature) flukes are found in the bile ducts and liver of infected people and animals, such as sheep and cattle. In general, fascioliasis is more common in livestock and other animals than in people.

What is Fasciolopsis Buski? History and Distribution of Fasciolopsis Buski Its discovery dates back to the mid-19th century and its distribution spans several regions in Asia, where it continues to be a health concern. Habitat of Fasciolopsis Buski Its habitat is closely tied to regions where aquatic plants, freshwater, and specific snail species coexist, making ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is FASTA format? FASTA format is a text-based format commonly used for representing nucleotide or protein sequences. It is named after the FASTA software package, which introduced this format. The FASTA format is widely used in bioinformatics and genomics for storing and exchanging sequence data. FASTA file looks like: A typical FASTA file consists ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Fate Map? A fate map is a diagram or representation of an egg or blastula that depicts the expected fate or destiny of each cell or region at a later stage of development. Fate maps are indispensable tools in embryological experiments as they provide researchers with valuable information about the normal developmental outcomes ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What do you mean by Fate of Pyruvate? Pyruvate, the end product of glycolysis, represents a central intermediate in cellular metabolism. Glycolysis is a sequence of enzyme-catalyzed reactions in which glucose is broken down into two molecules of pyruvate, generating ATP and NADH in the process. This pathway, also known as the Embden-Meyerhof-Parnas (EMP) pathway, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Fatty acid? Fatty acids are essential components in biochemistry, playing significant roles in various biological processes. These carboxylic acids consist of an aliphatic chain, which can be either saturated or unsaturated. In nature, most fatty acids have a straight chain with an even number of carbon atoms, ranging from 4 to 28. They ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Feedback Inhibition? Definition of Feedback Inhibition Feedback inhibition is a cellular regulatory mechanism in which the end product of a biochemical pathway inhibits the activity of the first enzyme in that pathway, preventing overproduction of the end product. Enzymes, Substrates, and Products Process of Feedback Inhibition Feedback inhibition, a cardinal regulatory mechanism within ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Feedback mechanism? Definition of Feedback mechanism A feedback mechanism is a regulatory system within a process or organism that responds to changes by either amplifying (positive feedback) or counteracting (negative feedback) them to maintain equilibrium or homeostasis. Open and Closed-Loop Feedback Mechanisms Feedback loops are integral components in the maintenance of homeostasis within ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Numerous carbohydrates, including glucose, meet their catabolic end in Gycolysis after being transformed into glycolytic intermediates. Most significant are glycogen and starch, which are storage polysaccharides that are either in cell walls (endogenous) or in the diet. The disaccharides are maltose. Lactose, trehalose. and sucrose, and the monosaccharides fructose and mannose and galactose. Dietary Polysaccharides ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

This test also can differentiate between ketone functional groups and water-soluble carbohydrates.

Fermentation is among the oldest techniques for processing food. The term "fermentation" refers to a procedure where chemical changes take place in organic substrates through the action of enzymes created by microorganisms. For instance yeast enzymes transform starches and sugars into alcohol, and proteins are transformed into peptides or amino acids. The fermentation process takes place without oxygen which produces ATP (energy).

In breadmaking, microorganisms are useful in two primary ways: (1) they can produce gas to leaven the dough, giving it the desired loose, porous texture, and (2) they can produce flavorful substances. They may also play a role in dough conditioning. Leavening  Leavening by Bread Yeasts  Leavening by Other Microorganisms  Leavening by Chemicals  Continuous Breadmaking  ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Beer and ale are the most widely produced and consumed malt beverages in this country, and they will be explored here. They are constructed from malt, hops, yeasts, water, and malt adjuncts. Malt is produced from germinated and dried barley grains that have had their sprouts or germs removed. The dried blooms of the hop ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

At normal temperatures, the normal progression of changes in fruit juices is alcoholic fermentation by yeasts, followed by oxidation of the alcohol to acetic acid by acetic acid bacteria. When enough acetic acid is created, vinegar is the result. Vinegar is a condiment produced from sweet or starchy sources through alcoholic fermentation followed by acetic ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Unless otherwise indicated, the term wine refers to the beverage produced by the alcoholic fermentation of grapes or grape juice by yeasts, followed by ageing. However, wines can be prepared by fermenting the juices of fruits, berries, rhubarb, dandelions, and honey, among others. Grape Wine The majority of grape wines are either red or white. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Fermentation media? For a good output of product during a fermentation process, the selection of the optimal microorganisms and fermentation media is crucial. As it provides nutrients and energy for the growth of microorganisms, the quality of fermentation media is vital. This medium serves as a substrate for the production of a product ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Special features of the gametes for fertilization Both gametes, the sperm and the egg, possess special features that enable successful fertilization. Egg: Sperm: In summary, the egg and the sperm possess specialized features that are essential for fertilization. The egg has protective coverings, recognition mechanisms, and cortical granules to prevent polyspermy and ensure compatibility with ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Fertilization Definition External and Internal Fertilization  Fertilizin and Antifertilizin  Fertilizin Antifertilizin Process of Fertilization  The two sequential steps of the fertilisation process are as follows: 1. The egg’s activation; 2. The amphimixis. 1. Activation of the Egg  The process of activation of eggs is completed in following stages : (i) Movement of the sperm towards ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Filtration? Filtration is utilised to separate a dispersion based on particle size. The filtered mixture is put to an appropriate porous material filter. Particles smaller than the filter’s pores can pass through and enter the filtrate, while larger particles are retained on the filter’s surface. Filtration is a process that is used to ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Filtration is the most popular method to sterilize heat sensitive liquid and gases, without exposure to denaturing temperatures. Instead of killing microorganisms that cause contamination the process simply eliminates them. It is the process of choice to sterilize chemical solutions for antibiotics radioisotopes, toxic chemicals or vaccines, as well as carbohydrates, all of which are ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Fimbriae and pili are interchangeable words employed to indicate short, hair-like structures on the outsides of procaryotic cells. Same as flagella, they are made of protein.  Fimbriae are smaller and harder as compared to flagella, and lightly smaller in diameter. They emerge from the bacterial cell surface and involved in different functions such as adhesion, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is an Aquarium? Types of Aquarium An aquarium can be categorized based on its purpose, size, and the type of aquatic life it contains. Below are the primary types of aquariums, explained in detail: Major Aquarium Accessories Aquarium accessories are essential to maintaining a balanced and healthy environment for aquatic life. These tools and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Fish diseases encompass a broad spectrum of health issues that can significantly impact the well-being, growth, and survival of various fish species. These diseases can arise from multiple types of pathogens, including bacteria, viruses, fungi, and parasites, as well as environmental stressors. Bacterial diseases, caused by organisms such as Aeromonas, Vibrio, and Edwardsiella, often manifest ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Fish Fins? Origin of Fins The origin of fish fins has long fascinated biologists and paleontologists, as it provides insight into the evolutionary trajectory of vertebrates. Although the earliest chordates did not possess paired appendages, it is widely accepted that tetrapod limbs evolved from the fins of ancestral fish. However, the precise mechanisms ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Fish is a vital protein source that requires meticulous handling to maintain its quality and safety. This necessity arises from fish’s susceptibility to spoilage, particularly in warm tropical climates, where high temperatures expedite the activities of bacteria, enzymes, and the oxidation of fats. In regions such as Nigeria, inadequate handling has resulted in significant losses, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Fisheries? History of Fisheries The history of fisheries has evolved alongside human civilization, with evidence suggesting that fish were a crucial resource as early as the Old Stone Age. Fisheries have grown from basic hunting and preservation methods to a complex science that combines multiple disciplines for efficient fish cultivation and sustainable resource ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Fishery by-products refer to the various materials derived from fish processing that are not intended for direct human consumption but have significant value in various industries. These by-products include fish meal, fish oil, fish skin, bones, and other remnants that arise during the cleaning and filleting of fish. They play a crucial role in waste ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Fishing crafts and gears are integral components of the fishing industry, facilitating the capture of aquatic species across various environments. Fishing crafts, which include boats, skiffs, and canoes, are specifically designed to navigate diverse water bodies, ranging from freshwater lakes to expansive ocean waters. These vessels vary in size, shape, and construction materials, reflecting the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Flagella? Definition od Flagella Flagella are slender, whip-like appendages extending from certain cells, primarily serving the purpose of motility and, in some organisms, functioning as sensory organelles. They are found across various organisms, from bacteria and archaea to eukaryotic cells. Types of Flagella Flagella, whip-like appendages found in various organisms, play a pivotal ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Flagella can not be seen under a bright-field microscope by using ordinary stains. A simple and useful method has been used for visualization of flagella is known as wet mount technique.

Flagellar movement, or locomotion helps in the movement of motile bacteria. Bacteria do not drift aimlessly, they move either towards nutrients (sugars and amino acids) or away from toxic substances such as bacterial waste products.  When a bacterial cell moves towards a chemical substance or away from repellents is called chemotaxis. Motile bacteria additionally can ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Flame Photometer? Principle of Flame photometer The flame photometer is based on the principle that alkali and alkaline earth metal atoms are excited in the flame and that the light emitted when the excited atoms revert to the ground state can be measured. When you introduce a sample containing metal compounds into a ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Flash chromatography? Principle of Flash column chromatography The principle of flash chromatography revolves around the rapid movement of the eluent, a liquid, through a short glass column under gas pressure, typically nitrogen or compressed air. The glass column is packed with a stationary phase consisting of an adsorbent material with a defined particle ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The term "flora" can be understood as the naturally found native plants in one particular area. Flora refers to all kinds of life in the plant kingdom, but is typically used to describe the vegetation of an area.

What is Floriculture? Definition of Floriculture Floriculture is a branch of horticulture that focuses on the cultivation, management, and marketing of flowering and ornamental plants, including flowers, foliage, and other decorative plants, for use in gardens, landscaping, and the floral industry. Importance and uses of floriculture Floriculture plays a crucial role in various sectors due ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Flow cytometry? Flow cytometry Instrumentation Flow cytometry Principle Information Obtained from Flow cytometry  The flow cytometer has various clinical and scientific applications. The determination of the type and amount of white blood cells in blood samples is a typical clinical application. By treating properly processed blood samples with a fluorescently tagged antibody and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Flow Cytometry? Definition of Flow cytometry Flow cytometry is a laser-based technology used to analyze and measure physical and chemical characteristics of cells or particles in a fluid mixture. It provides rapid and quantitative information about cell size, complexity, and fluorescence intensity, enabling various applications in research and clinical settings. Purpose of flow ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Flow cytometry is a fast and stable method for the quantification of viable cells. Determining cell viability is a significant step when assessing a cell’s reply to medication or other environmental agents.  It is additionally essential to recognize dead cells in a cell suspension in order to eliminate them from the study. Dead cells can ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Flower Culture? Principle of Flower Culture Protocol of Flower Culture The protocol outlined below provides a systematic approach for the successful culture of flower buds or mature flowers, ensuring optimal growth and minimizing contamination. Importance of Flower Culture Below are key aspects highlighting the importance of flower culture:

What is Fluid Mosaic Model of Plasma Membrane? – Fluid Mosaic Model Definition The fluid mosaic model is one method to comprehend biological membranes, consistent with the majority of experimental findings. According to this hypothesis, membrane components such as proteins and glycolipids form a mobile mosaic in the fluid-like environment formed by a sea of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Fluorescence Microscopy? A fluorescence microscope is an optical microscope that employs fluorescence for examining specific properties of select organic and inorganic substances. A fluorescence microscope functions by observing labeled samples; the labels here are the specific fluorescent molecules (or clusters of molecules)—termed fluorophores—that emit light when stimulated at specific frequencies. Components of a ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is fluorescence spectrometry? Principle of fluorescence spectroscopy Fluorescence Phenomenon The Electronic Excited State Operating Procedure of Fluorescence spectroscopy Types of luminescence Luminescence refers to the emission of light by a substance not resulting from heat; instead, it occurs when electrons in a material absorb energy and then release it as light. This phenomenon encompasses ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Folin-Wu Method? Principle of Folin-Wu Method Requirements Procedure of Folin-Wu Method Step 1: Preparation of Protein-Free Filtrate Step 2: Testing Procedure This process results in a color change proportional to the glucose concentration in the blood sample. By comparing the absorbance of the test sample against the standard, the glucose level in the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is a Food Chain? A food chain refers to the sequence of events in an ecosystem in which one living organism consumes another, which is then consumed by a larger organism. A food chain is the movement of nutrients and energy from one creature to another at different trophic levels. Features of Food Chain ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is irradiation in food? Food irradiation definition Food irradiation refers to the process of exposing food and its packaging to ionizing radiation, such as gamma rays, x-rays, or electron beams. This method is used to improve food safety and extend the shelf life of products by effectively destroying microorganisms responsible for spoilage and foodborne ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Molds? Morphological Characteristics of Molds In their classification and identification, they are based on their morphology (i.e. their form and structure as determined by their microscopic and macroscopic appearance). 1. Hyphae and Mycelium of Molds 2. Reproductive Parts or Structures  of Molds (a) Asexual Spores  of Molds (b) Sexual Spores  of Molds These ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Bacillus cereus? Bacillus cereus is a pathogenic bacterium known for causing food-borne illnesses. Here is information about Bacillus cereus: Biological characteristics of Bacillus cereus Bacillus cereus possesses specific biological characteristics that contribute to its survival and potential to cause illness. Here are the key characteristics of Bacillus cereus: Sources of contamination Bacillus cereus ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Listeriosis? Listeriosis, also known as listeria infection, is a foodborne illness caused by the bacterium Listeria monocytogenes. It is a significant cause of foodborne illnesses worldwide. Here are some key points about listeriosis: It is important to note that the information provided here is a general overview of listeriosis. For specific guidance and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Chemical preservatives? How Foods Get Chemical Preservatives? Food can acquire chemical preservatives through various means: Role of chemical preservatives  Chemical preservatives play a crucial role in food preservation by performing several functions: Classification of chemical preservatives Chemical preservatives can be classified into different categories based on their nature and origin. Here are three ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are food additives? According to the Food Safety Standard Authority of India (FSSAI). Food additive may be defined as any substance not normally consumed as a food by itself or used as a typical ingredient of the food, whether or not it has nutritive value, the intentional addition of which to food for a ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Food radiation (the process of applying ionizing radiations to food items) is a technique that enhances the safety and prolongs the shelf-life of food by eliminating or reducing pests and microorganisms. As with pasteurizing milk, and making preserves for vegetables and fruits radiation could make food safer for consumers.

Low temperatures are employed to stop chemical reactions and the action of enzymes in food and to stop or slow the development and activities of microorganisms found in food items.

The utilization of high temperatures to preserve food items is based on their damaging effects on microorganisms as well as their spores.

Food preservation through low-temperature treatment is a widely used and effective method to extend the shelf life of various food products while maintaining their quality. By carefully managing temperature during handling, transportation, and storage, both physical and biological deteriorations can be controlled, ensuring that the food remains fresh for a longer period. Low-temperature treatment involves ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

When food is called "spoiled", it usually means that there is decay or decomposition of an unfavorable nature. Foods unfit for consumption are not considered spoiled. Spoiling could be caused by one or more of these:

What is Bioengineering? Bioengineering and Bioreactor Calculating the Reaction Rate To calculate the reaction rate of the fermentation of sucrose to ethanol and carbon dioxide, we can use the balanced chemical equation and the stoichiometry of the reaction. The balanced chemical equation for the fermentation of sucrose is: C12H22O11 (aq) + H2O (l) → 4C2H5OH ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Food Vacuole? Definition of Food Vacuole A food vacuole is a membrane-bound organelle found in certain cells, especially protozoan microorganisms, that encloses and digests ingested nutrients using digestive enzymes, subsequently releasing the digested molecules into the cytoplasm for cellular utilization. Structure Of Food Vacuole The food vacuole, a specialized cellular compartment, is characterized ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Food Web? Definition of Food Web Characteristics of the food web Trophic Levels in a Food Web Energy Flow Types of Food Webs There are different kinds of food webs that differ in how they are put together and what they show or stress about the organisms in the ecosystem they show. Scientists ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Foodborne Giardiasis? Characteristics of Giardia Giardia is a genus of microscopic, single-celled parasites that can cause the infection known as giardiasis. Here are some characteristics of Giardia: Overall, Giardia is a highly adaptable and resilient parasite that can cause a range of symptoms in humans and animals. By practicing good hygiene and food safety ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Shigella infection? Biological characteristics of Shigella Shigella bacteria possess several distinctive biological characteristics that contribute to their ability to cause infection and survive in various environments. Here are the key biological characteristics of Shigella: Sources and transmission of Shigella infection Epidemiology of Shigella infection The epidemiology of Shigella infection provides insights into the historical background, transmission dynamics, and global burden of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

To identify bacteria in food, microscopic examination is the first step. It can determine the structure, shape, size, aggregation and staining reactions. These characteristics could be particularly important.

The term "yeast", which is similar to mold, is often used, but it can be difficult to define. It refers to fungi that are not filamentous, but unicellular, ovoid, or spheroid, and can reproduce by budding and fission. Yeasts can be beneficial or harmful to foods. Yeast fermentations play a role in the production of bread, wine, vinegar, and surface-ripened dairy products. Yeasts can be grown for enzymes or for food. When yeasts cause spoilage in sauerkraut, fruit juices and sirups as well as honey, jellies, meats and wine, they are considered undesirable.

What are foodborne viruses? Foodborne viruses are those that can be contracted by eating or drinking contaminated food or water. They can withstand extremes in temperature and humidity as well as hostile conditions like low pH (acidity). Because of this, they can survive infectively in food and water for much over a month. These viruses ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Forest Ecosystem? Types- Forest Ecosystem 1. Coniferous Forest (Boreal Forest) 2. Temperate Deciduous Forest 3. Temperate Evergreen Forest 4. Tropical Rainforests 5. Temperate Rainforests 6. Subtropical Rainforests 7. Tropical Seasonal Forests 8. Tropical Evergreen Rainforest 9. Tropical Deciduous Rainforest 10. Taiga/Boreal 11. Mixed Forests 12. Mediterranean Forests Components of Forest Ecosystem A. Abiotic ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Germ layer? Fate of The germ layers 1. Ectoderm 2. Mesoderm 3. Endoderm 4. Neural crest Formation of Three Germ Layers (i) Formation of Endoderm (ii) Formation of Mesoderm (iii) Formation of Ectoderm FAQ

What is Fossils? Definition of Fossils Fossils are the preserved remains or traces of ancient organisms that provide evidence of past life on Earth. Types of Fossils Fossils come in various forms, providing valuable insights into the past life on Earth. Here are some of the different types of fossils: Furthermore, fossils can be classified ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Proteins, as complex biological molecules, play an essential role in the myriad of processes in living organisms. Consisting of amino acids, proteins can be envisioned as polypeptide structures formed through long chains of these amino acid residues. Therefore, it’s not surprising that they are one of the most abundant organic molecules present in living beings. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Fragmentation? Definition of Fragmentation  Fragmentation is a form of asexual reproduction in which an organism or part of it breaks into smaller pieces, each capable of developing into a fully mature individual. General Steps of Fragmentation Fragmentation is a pivotal biological process characterized by its systematic progression through distinct stages. This method of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Frameshift Mutation? Definition of Frameshift Mutation A frameshift mutation is a genetic alteration caused by the insertion or deletion of nucleotides in a DNA sequence, which shifts the reading frame of codons and results in the production of an altered and typically nonfunctional protein. Causes of Frameshift Mutation The main causes of frameshift ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Frank-Starling Law? Mechanism of the Frank-Starling mechanism The mechanism underlying left ventricular performance is intricately linked to the Frank-Starling Law, which establishes the relationship between preload and cardiac output. This relationship can be observed through the Frank-Starling curves, which depict how variations in left ventricular end-diastolic volume (EDV) or pressure influence stroke volume ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Griffith Experiment & Transforming Principle Frederick Griffith, a British bacteriologist, conducted a series of studies with Streptococcus pneumoniae bacteria and mice in 1928. Griffith was not attempting to detect genetic material; rather, he was attempting to produce a vaccine for pneumonia. Griffith utilised two strains of bacteria identified as R and S in his tests. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Freeze Fracture Technique? Principle of Freeze Fracture Technique The principle of the freeze-fracture technique is based on the physical separation of biological membranes at their hydrophobic core when the sample is frozen and then fractured. Here are the key aspects of this principle: Overall, the freeze-fracture technique provides valuable insights into the functional ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Location of Fructolysis Why does fructose metabolism or fructolysis occur in liver cells? Properties and Sources of Fructose Absorption of Fructose From Fructose to Fat/Fructolysis/fructose metabolism pathway Steps of fructose metabolism pathway 1. Step 1 2. Step 2 3. Step 3A Metabolic Pathway Notes: At this point, the liver cell can use the same steps ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Fruit and vegetable crops? Fruit and vegetable crops refer to the plants cultivated primarily for their edible parts, which are rich in nutrients and essential for a balanced diet. Here’s a breakdown of what these crops entail: Production of fruit and vegetable crops The production of fruit and vegetable crops is a fundamental ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Funaria is a moss you’ll often find thriving in damp, shady areas like forest floors or along stream banks. Unlike typical plants, it lacks true roots, stems, or leaves, absorbing water and nutrients directly through its surface. If you take a closer look, you’ll spot its vibrant green tufts topped with tiny, capsule-like structures—these hold ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Fungi? Definition of Fungi Fungi are eukaryotic organisms that include yeasts, molds, and mushrooms. They are heterotrophic, meaning they obtain nutrients by absorbing dissolved molecules from their surroundings, and they play a vital role in decomposing organic matter. Fungi are classified in the kingdom Fungi and are distinct from plants, animals, and bacteria, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

In this article, we will learn about the Types of Fungi and Their Reproduction. There are present 5 types of fungi such as Chytridiomycota, Zygomycota, Glomeromycota, Ascomycota, and Basidiomycota. Fungi reproduce by vegetative, sexual, and asexual method. The sexual reproduction is accomplished by the mating of haploid hyphae and form a diploid spore called a ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Kingdom: Fungi Division: Ascomycota Class: Sordariomycetes Order: Hypocreales Family: Nectriaceae Genus: Fusarium Fusarium is a large genus of filamentous fungi belonging to the hyphomycetes group, which is extensively distributed in soil and closely associated with plants. The majority of species are saprobes and are relatively abundant constituents of the soil microbiome. Certain species generate mycotoxins ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Fusarium Wilt? Fusarium wilt is a plant disease that’s been giving gardeners and farmers headaches for ages. It’s caused by a sneaky soil-dwelling fungus called Fusarium oxysporum, which basically invades a plant’s roots and starts clogging up its internal plumbing. Imagine the plant’s vascular system—the tiny tubes that move water and nutrients—getting blocked by ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are G Protein Coupled Receptors? Structure of G Protein Coupled Receptors Classification of G Protein Coupled Receptors The G protein-coupled receptor (GPCR) superfamily encompasses a vast array of receptors, with at least 831 human genes, approximately 4% of the protein-coding genome, predicted to code for GPCRs. Despite the lack of detectable shared sequence homology ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is gab operon? Structure of gab operon There are three structural genes that make up the gab operon: Regulation of gab operon Differential Regulation of Promoters The expression of the genes in the operon is controlled by three promoters that work in different ways. Two of these promoters are controlled by the sigma factor ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Gal operon? Structure of Gal operon The Leloir pathway of D-galactose metabolism Regulation of Transcription Regulation without Regulatory Proteins Control of P1 by Adenine Tracks Control of P2 by UTP Repression by GalR and HU: DNA Looping Regulation in the Absence of DNA Looping: Interaction between GalR and RNA Polymerase Activation of P2 ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Galactose? Galactose is a monosaccharide sugar that is an aldohexose. It is a C-4 epimer of glucose having the same structure as glucose, except that the atoms around carbon no. 4 are arranged differently. This sugar is around 65% of the sweetness of sucrose and is less sweet. It is paired with glucose ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Gamete? Definition of Gamete A gamete is a haploid reproductive cell, such as a sperm or egg, that carries half the genetic material of an organism and fuses with another gamete during fertilization to form a diploid zygote, initiating the development of a new organism. Types of Gamete Gametes, or reproductive cells, are ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is gametogenesis? Gametogenesis Definition Gametogenesis is the biological process through which precursor cells undergo cell division and differentiation to form mature sex cells or gametes. Spermatogenesis 1. Formation of Spermatids  Primary germinal cells or primordial cells refer to the male germinal cells that create sperm. The primordial cells undergo the following three steps in ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Gamma-ray Spectroscopy? Gamma-ray (γ-ray) spectroscopy Principle The basic idea behind gamma-ray spectroscopy is to detect and analyze the energy of incident gamma rays. Gamma rays of varying energy and intensities are emitted by radioactive sources. A gamma-ray energy spectrum is produced when these gamma rays are detected and examined using a spectroscopic instrument. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Domain: Bacteria Phylum: Actinomycetota Class: Actinomycetia Order: Bifidobacteriales Family: Bifidobacteriaceae Genus: Gardnerella Species: G. vaginalis What is Gardnerella Vaginalis? Gardnerella vaginalis is a micro-aerophilic coccobacillus that is a constituent of the vaginal microbiota. This bacterium, while present in the vaginal flora, does not inherently lead to bacterial vaginosis unless its populations become predominant. Contrary to some ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is gas chromatography? Gas chromatography (GC) is a sophisticated technique that separates, identifies, and quantifies chemical components in complex mixtures. It operates on the principle of distributing the components between a mobile phase and a stationary phase. In GC, the mobile phase is an inert gas like helium, and it acts as a carrier ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Gas Treatment in Food Preservation? Gas treatment is a crucial tool in food preservation, utilizing different gases and their mixtures to modify or control the atmosphere surrounding food products. By doing so, the shelf life of perishable foods can be extended, preventing microbial spoilage and degradation. Here’s an overview of gas treatment as ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The GasPak Anaerobic System is a laboratory method used to grow bacteria that thrive in oxygen-free environments, known as anaerobes. Using throwaway sachets filled with compounds like sodium borohydride and sodium bicarbonate helps to create an anaerobic (oxygen-free) environment more quickly. These molecules combine to generate hydrogen and carbon dioxide when water is introduced. The ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Gastrointestinal Amebiasis? Characteristics of Entamoeba histolytica Entamoeba histolytica is a pseudopod-forming anaerobic protozoan parasite that is responsible for causing amebiasis in humans. Here are some key characteristics of Entamoeba histolytica: Life Cycle of E. histolytica Gene Structure and Organization  Cell Biology and Biochemistry  Sources of contamination of Amebiasis Amebiasis can be sourced from ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

GAT-B (Biotech) Previous Year Question Papers Download: Strengthen your GAT-B (Biotechnology) exam preparation with previous year question papers. Download a complete set of past GAT-B question papers to familiarize yourself with the exam format, identify key topics, and enhance your problem-solving abilities. These papers provide valuable insights into the types of questions you can expect, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Download GATE Biotechnology (BT) Previous Year Question Papers Ace your GATE Biotechnology (BT) exam with our extensive collection of previous year question papers. These past papers are essential for understanding the exam pattern, mastering key topics, and practicing time management. By revisiting questions from previous years, you can sharpen your problem-solving skills and gain valuable ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

GATE Life Sciences (XL) Previous Year Question Papers Download: Boost your GATE Life Sciences (XL) exam preparation with access to previous year question papers. Download the comprehensive collection of past GATE Life Sciences (XL) question papers to understand the exam pattern, improve time management, and enhance your problem-solving skills. These question papers cover all the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Number of tests Once in a year Fellowship/ Assistantship Subject to fulfilling the admission criteria of the admitting institutes. Administering institutes IISc Bangalore and 7 IITs Organizing Institute of Exam One of the administering institutes Medium of examination English Mode of examination Computer based test (CBT) Subject papers allowed Maximum TWO Paper combinations Combination of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The Graduate Aptitude Test in Engineering (GATE) for Biotechnology (BT) 2024 encompasses a detailed and rigorous syllabus designed to evaluate the knowledge and understanding of candidates in various domains of biotechnology. The syllabus is segmented into three primary sections: General Aptitude, Engineering Mathematics, and Core Discipline, with the Core Discipline carrying the most significant weightage. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Gause’s Principle, also known as the competitive exclusion principle or Gause’s law, is a fundamental concept in ecology that describes the competition between species for limited resources. It states that two species that compete for the same resources cannot coexist in the long term at constant population values. When one species has even a slight ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Gel Electrophoresis System? Definition of Gel Electrophoresis System Gel electrophoresis is a laboratory technique that uses a gel as a medium to separate and analyze biomacromolecules such as DNA, RNA, and proteins based on their size and charge. An electric field is applied to move the molecules through the gel, with smaller or ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Gel Filtration Chromatography? Phases in Gel Filtration Chromatography There are two main phases in gel filtration chromatography: the mobile phase and the stationary phase. In summary, gel filtration chromatography consists of two phases: the mobile phase (the solvent that transports the sample through the column) and the stationary phase (the gel-packed column that ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Gel Permeation Chromatography? Gel Permeation Chromatography Principle The separation of components based on their molecular weight or size is the basis of gel permeation chromatography (GPC), also known as gel filtration or size exclusion chromatography. The method employs a stationary phase composed of a porous polymer matrix. The solvent that serves as the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Staining protein gels using Coomassie Brilliant Blue R-250 is common to see proteins that are resolved using SDS-PAGE. It is extremely sensitive and suitable for long-term storage of gels.

The gelatin proteins derived from the animal connective tissue, collagen. Gelatin is produced when collagen is boiled in water. A gelatin hydrolysis test is used to detects the presence of gelatinases. Gelatinases are extracellularly secreted by some bacteria which hydrolyze or digest gelatin.

What is Gene cloning? “DNA Cloning” is a molecular biology technique that is utilized to create exact copies, or clones, of one particular gene or DN.” History of Gene cloning Principle of Gene Cloning Requirements for Gene Cloning Restriction Enzyme Digestion and Ligation Enzyme Source Recognition Sequence Restriction Digest EcoRI Escherichia coli 5’GAATTC3’CTTAAG   5′—G↓AATTC—3’3′—CTTAA↑G—5′ ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is gene expression, and how does it relate to cell specialization? Gene expression is a fundamental biological process through which the information encoded in a gene is utilized to produce functional products, primarily proteins. This mechanism plays a crucial role in cell specialization, often referred to as cell differentiation, wherein generic cells evolve into ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is gene expression? What is Gene Expression Profiling? Gene Expression Profiling Definition Gene expression profiling (GEP) is a technology for identifying the genes that are active in a given sample of cells or tissue. This technique enables profiling of genes that are differentially expressed in disease states; thereby providing diagnostic and prognostic information. Tools ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Gene frequencies? Gene frequencies, also known as allele frequencies, refer to the relative proportions of different alleles at a particular locus or gene within a population. They represent the prevalence or abundance of specific alleles in relation to the total number of alleles in the gene pool. Gene frequencies are typically expressed as ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Gene Interactions? Definition of Gene Interactions Gene interactions refer to the relationships between multiple genes where the expression of one gene can influence, or be influenced by, the expression of another gene, collectively determining specific phenotypic traits in an organism. Types of Gene Interaction Gene interactions can be categorized into two primary types: ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Gene mapping, also known as genome mapping or genome mapping, is an important technique used by scientists to establish the location of genes on a chromosome. It entails determining the location of a gene, quantifying the distance between genes, and establishing landmarks within the genome. Just like landmarks help us make our way around a ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Gene Pool? Definition of Gene Pool The gene pool refers to the total collection of genes and alleles present within a population of a particular species. How Gene Pools works? Factors Affecting Gene Pool Several factors can influence the composition and dynamics of a gene pool. These factors include: These factors interact and can ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Gene Prediction? Example Gene: A sequence of nucleotides coding for protein Gene Prediction Problem: Determine the beginning and end positions of genes in a genome atgcatgcggctatgctaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgggatccgatgacaatgcatgcggctatgctaatgaatggtcttgggatttaccttggaatgctaagctgggatccgatgacaatgcatgcggctatgctaatgaatggtcttgggatttaccttggaatatgctaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgcggctatgctaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatcctgcggctatgctaatgaatggtcttgggatttaccttggaatgctaagctgggatccgatgacaatgcatgcggctatgctaatgaatggtcttgggatttaccttggaatatgctaatgcatgcggctatgctaagctgggaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgcggctatgctaatgcatgcggctatgctaagctcatgcggctatgctaagctgggaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgcggctatgctaatgcatgcggctatgctaagctcggctatgctaatgaatggtcttgggatttaccttggaatgctaagctgggatccgatgacaatgcatgcggctatgctaatgaatggtcttgggatttaccttggaatatgctaatgcatgcggctatgctaagctgggaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgcggctatgctaatgcatgcggctatgctaagct Gene atgcatgcggctatgctaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgggatccgatgacaatgcatgcggctatgctaatgaatggtcttgggatttaccttggaatgctaagctgggatccgatgacaatgcatgcggctatgctaatgaatggtcttgggatttaccttggaatatgctaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgcggctatgctaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatcctgcggctatgctaatgaatggtcttgggatttaccttggaatgctaagctgggatccgatgacaatgcatgcggctatgctaatgaatggtcttgggatttaccttggaatatgctaatgcatgcggctatgctaagctgggaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgcggctatgctaatgcatgcggctatgctaagctcatgcggctatgctaagctgggaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgcggctatgctaatgcatgcggctatgctaagctcggctatgctaatgaatggtcttgggatttaccttggaatgctaagctgggatccgatgacaatgcatgcggctatgctaatgaatggtcttgggatttaccttggaatatgctaatgcatgcggctatgctaagctgggaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgcggctatgctaatgcatgcggctatgctaagct Bioinformatics and the Prediction of Genes Utilising computational algorithms and tools to analyse genomic data, bioinformatics plays an essential role in the prediction of genes. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Gene silencing, a mechanism of reducing or suppressing gene expression, is critical in managing gene expression in cells. Genes, which are responsible for protein production, have distinct expression spectra that determine the amount of protein produced by a gene in a specific cell type. When the expression profile of genes is altered, however, it can ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Gene therapy is a groundbreaking field of medicine that focuses on the modification of cells to treat or prevent genetic disorders by repairing or replacing defective genetic material. It holds the potential to cure a wide range of genetic diseases by directly addressing the underlying genetic abnormalities. In this series of articles, we aim to ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Fibre-yielding plants have played a crucial role in the advancement of human civilization, second only to food plants in their utility. Early humans relied on these plants to meet essential needs such as clothing, shelter, and tools. While animal products provided some solutions, plant fibers offered lighter and more flexible alternatives for tasks such as ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Legumes? Nutritional Value of Legumes Legumes are highly regarded for their nutritional value, making them essential components of a balanced diet. These foods offer a wealth of benefits due to their rich nutrient profile, including proteins, carbohydrates, dietary fiber, vitamins, and minerals. Their bioactive compounds further enhance their appeal by contributing to various ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Timber plants? Important timber yielding plants 1. Tectona grandis Tectona grandis, commonly known as teak, is a prominent species within the family Verbenaceae. Renowned for its exceptional qualities, teak is one of the most significant commercial timber crops in tropical regions. 2. Dalbergia sissoo Roxb Dalbergia sissoo Roxb, commonly known as shisham or ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Vegetable Oils and Fats? Vegetable oils and fats have been integral to human civilization since ancient times, with evidence of their use in various cultures for food, body care, and practical applications like soap-making. While early humans primarily relied on animal fats, different civilizations, including the Chinese, Hindus, and Egyptians, developed methods to ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Beverages? Examples Of Nonalcoholic Beverages Containing Caffeine Coffee Tea Cocoa and Chocolate Mate Guarana Khat Cola Cassine Examples of Alcoholic beverages 1. FERMENTED BEVERAGES Fermented beverages represent a significant category within the alcoholic beverage industry, encompassing a diverse array of products derived from the fermentation of various plant materials. Here, we explore key ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Legumes? Examples of Legumes Legumes encompass a wide range of plants, each with distinct characteristics and uses. The following are notable examples, categorized by their types and key attributes: Forage Legumes Many legumes are cultivated specifically for forage or green manuring rather than human consumption. These include: Examples of Tree Legumes Tree legumes ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Spices? Spices obtained from roots and rootstalks Spices obtained from barks Spices obtained from flowers or flower buds Spices obtained from Fruits Spices derived from fruits encompass a diverse range of botanical origins, each contributing unique flavors and uses. Here, we explore notable examples, including their botanical names, families, parts used, morphology, and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Principle of Western blotting The principle of Western blotting involves the separation of proteins based on their size through gel electrophoresis, followed by the transfer of the separated proteins onto a solid support (blotting), and the detection of the target protein using specific antibodies (detection). In the first step, gel electrophoresis, proteins are separated based on ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is a Genetic Code? The genetic code is a set of rules that living cells use to decipher the information encoded in genetic material (DNA or mRNA sequences). The ribosomes are responsible for carrying out the translation process. Using tRNA (transfer RNA) molecules to carry amino acids and to read the mRNA three nucleotides ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Genetics is the branch of biology that focuses on genes, heredity, and variation in living organisms. It studies how traits and characteristics are passed from one generation to the next through genetic material (DNA or RNA in some viruses). Genetics covers topics such as gene expression, mutation, genetic recombination, and the roles of genes in ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Genetic Engineering? Definition of Genetic Engineering Genetic engineering is the deliberate manipulation of an organism’s DNA using advanced techniques to modify, add, or remove specific genes, resulting in desired genetic traits or functions. Basic Tools of Genetic Engineering Genetic engineering involves the manipulation and transfer of genes from one organism to another. To ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is genetic variation? Definition of genetic variation Genetic variation refers to the differences in DNA sequences among individuals within a population, resulting in diverse traits. This variation arises from factors such as mutations, gene recombination during reproduction, and genetic drift, and it plays a crucial role in evolution and adaptation to changing environments. Types ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Genus? Definition of Genus A genus is a taxonomic rank in biological classification that groups together species with shared characteristics or evolutionary lineage, positioned above species and below family. Classification System The Naming System In the realm of biological taxonomy, the system of binomial nomenclature stands as a cornerstone for naming organisms. This ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Geographical Indication? Definition of Geographical Indication A Geographical Indication (GI) is a label used on products that have a specific origin and qualities, reputation, or characteristics linked to that location. It ensures that only products from that region can legally use the name associated with it. Objectives of Geographical Indications The objectives of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Gerhardt's test is a type of laboratory test which is performed for the qualitative detection of ketone bodies in urine.

What is Germ Theory of Disease? Key principles of the germ theory of disease The key principles of the germ theory of disease can be summarized as follows: These principles collectively form the foundation of the germ theory of disease, guiding our understanding of the causes, transmission, prevention, and treatment of infectious diseases. Germ theory ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Germplasm conservation? History of Germplasm Conservation Germplasm conservation has evolved through significant scientific and international efforts to safeguard the genetic diversity of crop plants. Below is a detailed historical account highlighting key milestones: Methods of Germplasm Storage and Conservation There are two methods for Germplasm Storage and Conservation A. Ex Situ Conservation Ex ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Giardia Intestinalis? Classification of Giardia Intestinalis Domain: Eukaryota Phylum: Metamonada Order: Diplomonadida Family: Hexamitidae Genus: Giardia Species: G. duodenalis History and Distribution of Giardia Intestinalis Giardia intestinalis has a long and significant history as one of the earliest recognized protozoan parasites affecting humans. Its study has evolved over the centuries, revealing important aspects of its distribution ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Giardia is an infectious parasite and responsible for the diarrheal illness known as giardiasis. Giardia mainly infects humans, cats, and dogs. Giardia Classification Domain: Eukaryota (unranked): Excavata Phylum: Metamonada Order: Diplomonadida Family: Hexamitidae Subfamily: Giardiinae Genus: Giardia Giardia Giardia Characteristics Giardia infection/Giardiasis Giardiasis definition Giardiasis is an intestinal infection caused by the protozoan Giardia lamblia. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Gibberellin? Definition of Gibberellin Gibberellin is a class of diterpenoid plant hormones that regulate various developmental processes, including stem elongation, germination, flowering, and dormancy. Structure of Gibberellin Biosynthesis of Gibberellin Gibberellins, a class of plant hormones, play a pivotal role in various growth and developmental processes. The intricate pathway leading to the synthesis ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Gibbs free energy is also referred to as the Gibbs function. Gibbs energy, also known as free enthalpy, is the measurement used to determine the highest amount of work that can be done in a thermodynamic process when temperatures and pressures remain constant. Gibbs free energy can be identified by the symbol “G”. Its value ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The term Giemsa stain originated from a name of German chemist and bacteriologist Gustav Giemsa. He apply this stain with a combination of reagents to detect the presence of malaria parasites. This stain is used for nucleic acid staining and histopathological diagnosis of malaria and other parasites. Giemsa Stain is a types of Romanowsky stains ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Giolitti Cantoni Broth Base with the addition of potassium tellurite is utilized to enrich selectively Staphylococcus aureus, a food-borne pathogen, from suspected items, according to ISO.

What is Gland? Definition of Gland A gland is a group of specialized cells or an organ that produces and releases substances, such as hormones or secretions, for use within the body or for elimination from the body’s surface or cavities. Characteristics of Glands Glands possess several characteristic features that distinguish them from other types ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

A gland is a part of the body that makes and releases substances like hormones, enzymes, or fluids to help the body function. Think of it like a tiny factory—some glands send their products directly into the bloodstream to control things like growth, energy, or mood (these are called endocrine glands, like the thyroid or ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Definition Glandular epithelium  The glandular epithelium comprises a set of tissues that is not the epithelium that covers and lines that is specifically designed to secrete and produce of different macromolecules. Due to its primary role it is often referred to as”the secretory epithelium. It is situated under the lining and covering epithelium. It may ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

 tools can be fascinatingly complex? If you’re nodding your head, then let’s share a curiosity-infused journey into the world of one such tool – the glass bulb pipette. Think of it as a miniature transporter, a bridge between containers, a silent contributor in groundbreaking experiments. From classrooms to advanced research labs, the humble glass bulb ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Have you ever wondered how laboratory scientists are so precise with their liquid measurements? What magical tool enables them to transfer or release a specific amount of liquid? Well, the answer is as clear as glass, actually it is glass: The Glass Dropper Pipette.  “In the world of science, precision is paramount, and the glass dropper ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Ever held a magic wand that can make your laboratory tasks a breeze? Say hello to the glass serological pipettes! These are not just any ordinary laboratory equipment, oh no, they are the unsung heroes that make precision and accuracy a reality in the realm of laboratory science.  “In science, every millimeter, microliter, and milligram counts, and that’s ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Global Warming? Definition of Global Warming Global warming is the long-term increase in Earth’s average surface temperature, primarily caused by the buildup of greenhouse gases like carbon dioxide and methane due to human activities such as burning fossil fuels and deforestation. This leads to climate changes and various environmental impacts. Causes of Global ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Gluconeogenesis? Gluconeogenesis Definition Gluconeogenesis is a metabolic process that synthesizes glucose from non-carbohydrate precursors, such as lactate, glycerol, and amino acids, primarily in the liver and kidneys, to maintain blood glucose levels during fasting or low carbohydrate intake. Location of Gluconeogenesis – Where does Gluconeogenesis Occur? Gluconeogenesis primarily occurs in the liver, which ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Gluconic Acid is the 16 stereoisomers of 2,3,4,5,6-pentahydroxyhexanoic acid. It is an inorganic chemical. It occurs naturally in honey, plants, and wine. The first carbon of glucose is oxidised to form gluconic acid, which has antibacterial and chelating effects. Please include the chemical composition and further details. Properties Of Gluconic Acid Chemical formula C6H12O7 Molecular ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is a Glucose Tolerance Test? A glucose tolerance test is a test that is used to diagnose diabetes or prediabetes. It involves measuring the body’s ability to process glucose, a type of sugar that is the main source of energy for the body. During the test, a person will drink a solution containing a ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Glycocalyx definition The cell membrane of bacteria, epithelia is surrounded by a pericellular matrix, which is known as Glycocalyx. It is a carbohydrate-enriched coating that covers both eukaryotic cells and prokaryotic cells, particularly bacteria Glycocalyx composition and structure Types of Glycocalyx  Based on the bacterial species the structural features and chemical composition of glycocalyces can ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Glycogen? Definition of Glycogen Glycogen is a branched polysaccharide made of glucose units that serves as the primary form of glucose storage in animals, fungi, and bacteria. It is primarily stored in the liver and muscles and acts as a readily mobilized energy source when the body needs glucose. Characteristics of Glycogen Glycogen ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Glycogenesis? Definition of Glycogenesis Glycogenesis is the biological process of synthesizing glycogen from glucose molecules, primarily in the liver and muscles, for energy storage and glucose homeostasis. Key Enzymes in Glycogenesis Glycogenesis is the biochemical process that converts glucose into glycogen for storage in the liver and muscle tissues. This process relies on ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Glycogenesis? What is Glycogenolysis? Differences between Glycogenesis and Glycogenolysis – Glycogenesis vs Glycogenolysis Glycogenesis and glycogenolysis are two key metabolic processes that govern the storage and release of glucose in the body. While they are related, they have opposing functions. Glycogenesis stores glucose in the form of glycogen, whereas glycogenolysis breaks down glycogen ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Glycogenolysis? Glycogenolysis Definition Glycogenolysis is the enzymatic process of breaking down glycogen, a stored polysaccharide, into glucose-1-phosphate and glucose to provide energy or maintain blood sugar levels during fasting or increased energy demand. Glycogenolysis Location Glycogenolysis occurs in the cytoplasm of cells, primarily in the liver and skeletal muscles, with minimal activity in ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is glycolysis? Definition of glycolysis Glycolysis is a metabolic process in which glucose, a six-carbon sugar, is broken down into two three-carbon pyruvate molecules, producing a net gain of two ATP and two NADH molecules. This anaerobic pathway occurs in the cytosol and is a key step in cellular energy production. Major Features of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Glycolysis? Glycolysis 10 Steps Glycolysis is a central metabolic pathway that facilitates the breakdown of glucose into pyruvate through a series of enzymatic reactions. This process is methodically organized into ten distinct steps, divided into two primary phases: the Preparatory phase and the Payoff phase. Preparatory Phase: Payoff Phase: In summary, glycolysis is ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Glycoprotein? Definition of Glycoprotein A glycoprotein is a complex molecule composed of a protein covalently bonded to one or more carbohydrate chains, playing diverse roles in biological processes and cell-to-cell interactions. Glycoprotein Structure Methods used to study glycoproteins Glycoproteins, with their intricate structures and multifaceted roles in biological systems, necessitate advanced methodologies for ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Gnetum? Gnetum represents a unique genus within the Gnetaceae family and the Gnetales order, characterized as a group of gymnosperms. The Gnetales order consists of three distinct extant genera: Ephedra, Gnetum, and Welwitschia, each exhibiting remarkable morphological differences. Historically, the phylogenetic placement of Gnetum has been contentious. While earlier classifications positioned it closer ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Glucose, a key sugar molecule, plays a vital role in the human body as the primary carbohydrate found in the bloodstream. Its importance lies in its function as the main source of energy for various body tissues, notably the brain. When glucose is metabolized, it undergoes a sequence of chemical processes that result in the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The principal purpose for Golgi's main function is Golgi apparatus is to transfer vesicles or packets of different cell products, to various areas of the cell.

What is Golgi Body (Golgi Complex)? Definition of Golgi Body (Golgi Complex) The Golgi body, also known as the Golgi complex or Golgi apparatus, is a membrane-bound organelle found in most eukaryotic cells. It functions primarily in the processing, packaging, and distribution of proteins and lipids, which are transported in vesicles to various destinations within ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Gonad? Origin of Gonads Structure and Location of Gonads 1. Ovaries 2. Testes Gonadal hormones Female Gonad Hormones Female gonad hormones play a crucial role in the reproductive system and the development of female characteristics. The two major hormones produced by the ovaries are progesterone and estrogens. Overall, estrogens and progesterone are essential ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Gonads? Definition of Gonads Gonads are reproductive glands in organisms that produce gametes (sperm in males and eggs in females) and secrete sex hormones (such as testosterone, estrogen, and progesterone) essential for sexual development and reproduction. In males, they are called testes, while in females, they are referred to as ovaries. Structure of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Gradient PCR? Definition of Gradient PCR Gradient PCR is a specialized molecular technique that allows for the simultaneous testing of different annealing temperatures in a single PCR run, optimizing the conditions for precise DNA amplification. Principle of Gradient PCR The principle of Gradient PCR revolves around the capability to simultaneously evaluate a range ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Number of tests Once in a year Exam conducted by NTA Fellowship/ Assistantship M.Sc. Biotechnology & Allied Areas Rs.5000/- per monthM.Sc. Agricultural Biotechnology Rs.7500/- per monthM.Tech/M.V.Sc programmes Rs.12000/- per month Administering institutes DBT supported Post-Graduate (DBT-PG) programmes Medium of examination English only Mode of examination Computer based test (CBT) Exam pattern Number of tests (per ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Gram-negative bacteria are a type of bacteria identified by their reaction to the Gram stain test, where they lose the purple dye and take up a red or pink counterstain. This happens because their cell walls are thinner and structurally different compared to Gram-positive bacteria. Instead of a thick peptidoglycan layer, they have a smaller ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Gram-positive bacteria are a group of bacteria classified based on how they react to a lab test called the Gram stain. When stained, these bacteria hold onto a purple dye because of their thick, mesh-like cell wall made of peptidoglycan. This sturdy layer acts like a protective shield, unlike Gram-negative bacteria, which have thinner walls ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Gram-staining used to differentiate between Gram-Positive and Gram-Negative Bacteria.

Gram-negative bacteria are a diverse group of microorganisms known for their unique cell structure, which plays a key role in how they interact with the environment and cause infections. Unlike Gram-positive bacteria, Gram-negative bacteria have a thin peptidoglycan layer sandwiched between two membranes. The outer membrane contains lipopolysaccharides (LPS), which can trigger strong immune responses ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Purpose of Gram-Sure Test Principle of Gram-Sure Gram-negative organisms’ cell walls include aminopeptidase, which can be identified through the hydrolysis of L-alanine-7-amido-4-methylcoumarin, a nonfluorescent substrate, into a fluorescent product. Materials Required Quality Control All Gram-Sure lot numbers were tested with the following quality control organisms and determined to be acceptable. The examination of control organisms ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Grassland Ecosystem Definition Geographical distribution Different Names of Grasslands Other Names of Grasslands Place Name of the grassland North America Prairies Eurasia (Europe and Asia) Steppes Africa Savanna South America Pampas India Grassland, Savanna Brazil Campos Venezuela Llanos South Africa Veld Australia Down Savannas are a popular term for tropical grasslands. They are found in ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Grazing Food Chain? Definition of Grazing Food Chain The grazing food chain is a type of food chain in which energy flows from photosynthetic producers to herbivores and then to carnivores. It starts with green plants that convert sunlight into energy through photosynthesis and is characterized by the consumption of plant material by ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Grocott-Gomori’s Methenamine Silver Staining is a type of special staining technique used in microbiology and histology to visualize fungal organisms, specifically those that form characteristic spores known as arthroconidia. The staining technique was developed in the 1930s by Grocott and Gomori and is based on the use of silver and methenamine. The fungal cells are ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Metamorphosis in Insect? Types of Insect Metamorpho­sis Insects exhibit remarkable diversity in their developmental processes, primarily classified into three distinct types of metamorphosis: ametabola, hemimetabola, and holometabola. Each type demonstrates unique features that influence the life cycle, habitat, and ecological roles of various insect species. What is the endocrine control of moulting in ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Test Name Growth at 42 Test Purpose This test distinguishes pyocyanogenic pseudomonas from other Pseudomonas species.Determine an organism’s capacity to live at a temperature of 42°C.To distinguish fermentative bacteria from non-fermentative bacteria. Uses The test is used to determine an organism’s capacity to grow at 42°C.This test distinguishes pyocyanogenic pseudomonas from other Pseudomonas species. Result ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Curious about gymnosperms and their role in the plant kingdom? Whether you’re wondering, “Is a pine tree a gymnosperm?” or “What’s the difference between gymnosperms and angiosperms?”, this guide unlocks the answers. Gymnosperms (from the Greek for “naked seeds”) are a group of seed-producing plants that include conifers, cycads, and ginkgos. Unlike angiosperms (flowering plants like the petunia, which is an angiosperm), gymnosperms do not produce ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

HACCP, short for Hazard Analysis Critical Control Points, is a practical system designed to keep food safe throughout its production. Rather than relying solely on end-product testing, it tackles potential risks—like harmful bacteria, unwanted chemicals, or even physical hazards—by spotting where things could go wrong during processes like cooking, cooling, or packaging. Once these critical ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Hemagglutination assay? Haemagglutination Test Principle The fundamental principle underlying the hemagglutination test revolves around the interaction between antigens and antibodies present on the surface of Red Blood Cells (RBCs). When these antigens encounter their corresponding complementary antibodies or vice versa, they bind together, resulting in the agglutination or clumping of the RBCs. This ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Haemophilus influenzae? Scientific classification of H. influenzae Infection Domain: Bacteria Phylum: Pseudomonadota Class: Gammaproteobacteria Order: Pasteurellales Family: Pasteurellaceae Genus: Haemophilus Species: H. influenzae Geographical Distribution and Habitat of H. influenzae Infection The geographical spread of H. influenzae and its habitat are both shaped by factors like vaccination coverage and population immunity. Geographical Distribution Habitat ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Handwashing is a fundamental and essential practice in basic hygiene that helps to prevent the transmission and spread of infectious agents. Poor hygiene practices can have a significant impact on causing various infections, including those affecting the skin, respiratory tract, and gastrointestinal system. Respiratory and gastrointestinal infections are often associated with a lack of or ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Hanging drop technique allows for the analysis of living microorganisms. This involves fixing the Microbial suspension into a drop of liquid over the slide of glass.

Hanta Virus Structure of Hanta Virus Genome Structure of Hanta Virus Epidemiology of Hanta Virus Transmission of Hanta Virus Replication cycle of hantaviruses Pathogenesis of Hanta Virus The recognition of hantaviruses by macrophages (M) or dendritic cells (DCs) induces proinflammatory cytokines, which alter the phenotype of endothelial cells (ECs) from anti- to pro-adhesive. Pro-adhesive ECs ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Haploid? In the realm of cellular biology, the term “haploid” denotes a specific chromosomal state in which a cell or organism possesses half the number of homologous chromosomes typically found in somatic cells. Derived from the Greek word “haplous,” which translates to “single,” the concept of haploidy is pivotal in understanding the genetic ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Hatchery Management? Hatchery Management of Indian Major Carp Hatchery management plays a pivotal role in the aquaculture of Indian major carps (IMC), which are essential for food security and nutrition in India. This management process involves various systematic practices to ensure successful breeding, rearing, and incubation of carp species such as Catla (Catla ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Haworth projection? Characteristics of Haworth projection The Haworth projection is a two-dimensional representation used to depict the three-dimensional structure of cyclic carbohydrates, such as monosaccharides and disaccharides. It provides valuable information about the arrangement of atoms and functional groups within the molecule. Here are some key characteristics of the Haworth projection: The Haworth ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The most meticulous organisms that have a high nutritional requirements can be developed using infusion media. Meat infusions were among the first media utilized to cultivate bacteria. Huntoon created a medium with fresh beef heart and peptone that was later named the Heart Infusion Aggar. He showed that it can be utilized to help support the growth of fastidious nutritional microorganisms, without the need for enrichment like blood from animals. Heart Infusion Agar can be used as a general-purpose growth medium. It is recommended for cultivation of fastidious and nutritious microorganisms and as a medium for basal growth that can be used for a wide range of purposes.

The bulk of plasma proteins are composed of big particles, making it difficult for them to pass through the glomeruli of the kidney. However, kidney tubules filter out and reabsorb smaller protein particles back into the blood. There are traces of proteins such as Tamm-Horsfall protein, hormones, mucopolysaccharides, albumin, enzymes, and immunoglobulins in normal urine. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

agulation of proteins is a test in biochemistry to find whether there are proteins such as albumin and globulin found in proteins. The coagulation of proteins in reaction the heat stimulus is an typical phenomenon. The process of coagulation by heat of proteins happens in two phases; denaturation or Agglutination, or the dissociation of the protein denatured in the form it is in.

Heat Treatment as a Food Preservation What is the Role of heat treatment in food preservation? Heat treatment plays a vital role in food preservation by offering various benefits that help ensure food safety, extend shelf life, and improve the overall quality of food products. The following points highlight the key roles of heat treatment ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Hektoen Enteric Agar, a selective and differential medium, is used to distinguish Salmonella and Shigella species from other Enterobacteriaceae. Sylvia King, William I. Metzger introduced the medium in 1968. They developed HE Agar medium during their time at the Hektoen Institute, Chicago, in order to improve the recovery of Salmonella and Shigella from clinical specimens.

What Are HeLa Cells? Definition of HeLa Cells HeLa cells are an immortal human cell line derived from the cervical cancer tissue of a patient named Henrietta Lacks. First cultured in 1951, these cells have the unique ability to divide and proliferate indefinitely in vitro, making them invaluable for scientific and medical research. Their widespread ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Helicobacter pylori? Scientific classification of Helicobacter pylori Domain: Bacteria Phylum: Campylobacterota Class: “Campylobacteria” Order: Campylobacterales Family: Helicobacteraceae Genus: Helicobacter Species: H. pylori Morphology of Helicobacter pylori Helicobacter pylori is a Gram-negative bacterium with distinctive features that make it highly adapted to its environment. Its unique structure plays a critical role in its mobility and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Helminths? Classification of Helminths Helminths, a diverse group of invertebrates, are primarily recognized for their elongated, flat, or round bodies. They are categorized into two main classes: flatworms (Platyhelminthes), which include flukes (trematodes) and tapeworms (cestodes), and roundworms (Nematoda). The classification of helminths is essential for understanding their biology, life cycles, and modes ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The nucleic acids of many viruses encode surface proteins (such as hemagglutinin (HA) of influenza virus) that agglutinate red blood cells (RBC) of numerous species. Hemagglutination is the process by which viral hemagglutinins react with red blood cells to form a lattice of agglutinated cells that settle unevenly in a tube or microtiter well. Unagglutinated ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Hematocrit Centrifuge? Working Principle of Hematocrit centrifuge Parts of Hematocrit centrifuge Operating Procedure of Hematocrit centrifuge How to load hematocrit blood test into centrifuge? Applications of hematocrit centrifuge Advantages of hematocrit centrifuge Limitations of hematocrit centrifuge FAQ

What is Hematopoiesis? Hematopoiesis, derived from the Greek words “haima” meaning blood and “poiein” meaning to make, is the process through which blood cells are formed from hematopoietic stem cells. It is a crucial and continuous process necessary for maintaining the appropriate levels of circulating blood cells within the body. All cellular components of blood, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Hematoxylin and Eosin (H&E) Staining? Hematoxylin and Eosin (H&E) staining is a commonly used histological staining technique that is used to visualize the structure of cells and tissues in a sample. The staining is performed by first staining the tissue with hematoxylin, a basic dye that stains acidic structures such as the cytoplasm ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Despite all the technical advances in scientific laboratories, the Neubauer Chamber is still the most widely used method for cell counting worldwide. This technical data sheet was created to assist experienced and novice researchers in performing a cell count using a Neubauer or Hemocytometer. These principles can be applied to any cell-counting chamber. However, the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Hemoglobin? What is Globin Chain? The globin chain refers to the specific combination of protein subunits that make up different types of hemoglobin. Hemoglobin is composed of four globin chains, which can vary depending on the specific type of hemoglobin. The different types of hemoglobin and their corresponding globin chains are as follows: ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The Henderson-Hasselbalch equation is a handy formula used in chemistry and biology to estimate the pH of a solution, especially when dealing with buffers—mixtures that resist changes in acidity or alkalinity. Think of it like a cheat sheet for predicting how acidic or basic a solution will be based on the balance between a weak ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Hepatitis A is a liver inflammation brought on by the hepatitis A virus (HAV). Primarily, the virus is transmitted when an uninfected (and unvaccinated) individual consumes food or water contaminated with the faeces of an infected individual. The disease is strongly linked to unclean water or food, inadequate sanitation, poor personal hygiene, and oral-anogenital contact. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Hepatitis B is a viral infection that causes liver inflammation, sometimes leading to serious liver damage. The hepatitis B virus (HBV) is transmitted through contact with the blood or other body fluids of an infected person. This can occur through sexual contact, sharing needles, or from an infected mother to her baby at birth. Symptoms ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Hepatitis C is a viral infection that causes liver inflammation, sometimes leading to serious liver damage. The hepatitis C virus (HCV) is spread through contaminated blood, and it can be acute or chronic. Acute hepatitis C is a short-term illness that occurs within the first 6 months after someone is exposed to the virus. Chronic ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Hepatitis D, commonly referred to as “delta hepatitis,” is a viral infection of the liver (HDV). Hepatitis D is only transmitted to individuals who are simultaneously infected with the hepatitis B virus. Hepatitis D is transmitted when blood or other body fluids from an infected individual enter the body of an uninfected person. Hepatitis D ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Hepatitis E Virus Taxonomy and Classification of Hepatitis E Virus Structure of Hepatitis E Virus Genome of Hepatitis E Virus Epidemiology of Hepatitis E Virus Transmission of Hepatitis E Virus Genomic Replication Strategy Replication of Hepatitis E Virus/Life cycle of hepatitis E virus (HEV) Pathogenesis of Hepatitis E Virus Clinical Manifestations of Hepatitis E Virus Laboratory Diagnosis of Hepatitis E Virus Hepatitis E virus ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Herbariums are fascinating repositories of plant life, offering a unique window into the diverse flora that populates our world. In this comprehensive article, we’ll delve into the definition, importance, and captivating examples of these botanical treasure troves, providing you with a deeper understanding of these remarkable institutions. What is a Herbarium? – Meaning of Herbarium ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Domain Eukaryota Kingdom Animalia Phylum Chordata Subphylum Tunicata Class Ascidiacea Order Stolidobranchia Family Pyuridae Genus Herdmania Authority Lahille, 1888 What is Herdmania? Herdmania is a genus of marine ascidians, belonging to the family Pyuridae. These organisms are invertebrates with a sac-like body structure covered by a tough outer covering called a test. They are filter ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Herpes simplex viruses (HSVs) are highly host-adapted viruses that can cause a variety of diseases in human hosts. (a) herpes simplex virus type 1 (HSV-1) and (b) herpes simplex virus type 2 (HSV-2) are the two forms of HSVs (HSV-2). Both types share DNA homology, antigenic determinants, tissue tropism, and illness symptoms, but their epidemiology ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Hershey–Chase experiment Experiment DNA as Genetic Material Observation Conclusion Why is DNA Considered a Genetic Material? It was found that DNA was the most important part of most species’ genes. There were some important exceptions, such as viruses whose genes were made of RNA. But what makes DNA different from other molecules that can be ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Heterogeneous Nuclear RNA (hnRNA)? Properties of hnRNA Processing of hnRNA During processing, the hnRNA undergoes the following chemical modifications: 1. Packaging of hnRNA with protein 2. Polyadenylation or Poly (A) tail formation 3. RNA splicing 4. 5′ Capping Mature mRNA One central coding segment, two untranslated segments, one on either side of the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Heterotroph? Definition of Heterotrophs Heterotrophs are organisms that rely on eating other living things for their nutrition and energy, as they cannot produce their own food. Types of Heterotrophic Nutrition In the natural world, living things use different ways to get their food when they can’t make it themselves. These are the main ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Homogenizer? What is High Pressure Homogenizer? Working principle of high pressure homogenizer High-pressure homogenization uses compressed liquid material driven through a gap at high speeds under high pressure and subjected to strong shear stresses. The fast decrease and rise in static pressure produces an explosive force and a strong impact force from the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is High Throughput Sequencing (HTS)? Working Principle of High Throughput Sequencing (HTS) High-throughput sequencing (HTS) technologies High-throughput sequencing (HTS) technologies have revolutionized genomic research by enabling rapid and detailed analysis of genetic material. The principal HTS technologies can be categorized into next-generation sequencing (NGS) and third-generation sequencing. Each of these technologies has distinct methodologies, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is High-Pressure Processing (HPP)? When was High Pressure Processing invented? High Pressure Processing (HPP) was invented in June 1899 by Bert Holmes Hite, a researcher from the University of West Virginia. Hite demonstrated the inactivation of microorganisms using high hydrostatic pressure, marking the first documented use of pressure as a food preservation method. Following ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Purpose of Hippurate Hydrolysis Test Principle of Hippurate Hydrolysis Test Hippurate → Glycine + Benzoic acid Glycine + Ninhydrin → purple-colored complex Composition of Hippurate Hydrolysis Broth Ingredients Gms / Litre HI powder# 10.000 Peptone 10.000 Sodium chloride 5.000 Sodium hippurate 10.000 Final pH ( at 25°C) 7.4±0.2 Equivalent to Heart infusion powder Preparation of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Histology? Definition of Histology Histology is the scientific study of the microscopic structure of biological tissues. Sample preparation Methods in Histology Histological analysis necessitates meticulous sample preparation to ensure accurate microscopic observation. The preparation techniques vary based on the specimen type and the intended observation method. Herein, we delineate the primary steps involved ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Microbiology? Microbiology is the study of microorganisms, which are tiny, single-celled organisms that are found almost everywhere on Earth. These microorganisms include bacteria, viruses, fungi, algae, and protozoa, and they play vital roles in many aspects of our lives. Microbiology encompasses a wide range of disciplines and applications, including the biology of microorganisms, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Historical Overview Throughout human history, the origin of life has captivated our curiosity and inspired various creation myths involving supernatural forces. However, ancient Greek thinkers were the first to approach the topic from a scientific standpoint, proposing the concept of spontaneous generation as a mechanism for complex organic forms to arise from simpler inorganic matter. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The Emergence of Microbiology: Uncovering Microbes Microbiology, the study of microscopic living organisms, is a relatively recent scientific field that has significantly advanced our understanding of biology and disease. The foundation of microbiology can be traced back to the mid-19th century, during a period of considerable growth and development in the biological sciences. Key Developments ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Microscopes have been around for the ages. Roman philosophers had mentioned "burning glass" within their works. However, the first microscope of this type was not invented until the 1300's. Two lenses were set on opposite sides of the tube. This tube of magnifying power was the basis for our modern-day microscope.

What is Microbiology? Microbiology, derived from the Greek words μῑκρός (mīkros) meaning ‘small’, βίος (bíos) meaning ‘life’, and -λογία (-logía) meaning ‘study of’, is the scientific discipline focused on the study of microorganisms. These microorganisms can be unicellular (single-celled), multicellular (comprising multiple cells), or acellular (lacking cellular structure). The field encompasses several sub-disciplines, including virology, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Homeostasis? Definition of Homeostasis Homeostasis is the process by which living organisms maintain a stable internal environment despite external changes, ensuring optimal functioning of physiological systems. This involves regulating various parameters such as temperature, pH, and ion concentrations through feedback mechanisms that include receptors, control centers, and effectors. Components and Process of Homeostasis ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is a homogenizer? Homogenizer Definition A homogenizer is a device used to mix, emulsify, and evenly distribute particles in liquids, creating a uniform and homogeneous mixture. What does a Homogenizer do? Homogenizers are utilised to combine chemical and biological materials. This frequently involves lysing cells to create a homogeneous suspension. With the addition of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The technique of homology modeling, which is also referred to as comparative modeling, is a robust computational approach that is widely employed in the domain of structural biology. The technique enables researchers to forecast the spatial arrangement of a protein or any other macromolecule by utilizing its amino acid sequence and the established configuration of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Honey bee? Types of Honey bee There are several different types or species of honey bees. The most well-known and widely recognized species is the Western honey bee (Apis mellifera), which is native to Europe, Africa, and the Middle East. However, there are other species of honey bees as well. Here are a ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Hopkin’s Cole/Adamkiewicz–Hopkins Test Definition Hopkins Cole Test also referred to as glyoxylic Acid Reaction is among the qualitative testing methods for determining the differences between different types of amino acids and proteins. The test is used to determine the presence of tryptophan, an amino acid, in proteins.  Objectives of Hopkin’s Cole Test Principle of Hopkin’s ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Hormones? Definition of Hormones Hormones are chemical messengers produced by endocrine glands that travel through the bloodstream to regulate various bodily functions by interacting with specific target cells or organs. Characteristics or properties of hormone Below are some key characteristics of hormones: Endocrine Glands and Their Major Hormones Endocrine Gland Associated Hormones Chemical ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Hornworts? Habitat of Hornworts Hornworts, a group of non-vascular plants, exhibit specific habitat preferences and distribution patterns. Their environmental requirements and widespread presence are outlined as follows: Characteristics Features of Hornworts Hornworts exhibit several distinct characteristics that highlight their unique biological and ecological adaptations. These features are outlined as follows: Morphology of Hornworts ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Horticultural? Short Definition of Horticulture Horticulture is the science and art of cultivating garden crops, including fruits, vegetables, ornamental plants, spices, and medicinal herbs. It involves the intensive management of these plants through processes such as planting, growth manipulation, harvesting, and marketing, focusing on both production and enhancement within smaller, often protected environments. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Host Pathogen Interaction What is Infection? Types of Infection Infectious agents (pathogens) that cause infections include: What is Invasion? A Survey of Bacterial Invasins Spreading Factors Enzymes that Cause Hemolysis and/or Leucolysis Typically, these enzymes act on the animal cell membrane by inserting into it (creating a pore that leads to cell lysis) or by ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Host-Parasite Interactions? Types of Hosts In parasitology, hosts play vital roles in the life cycle of parasites. Each type of host has a specific function that contributes to the survival and development of the parasite. Understanding these types helps in comprehending how parasites interact with their hosts and spread diseases. Below are the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

A hot air oven is a laboratory appliance that is used to dry, sterilize, or heat materials. It works by circulating hot air inside the oven chamber to evenly distribute heat to the materials being processed. Hot air ovens are often used in a variety of settings, including research laboratories, industrial settings, and educational institutions. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

How  L-arabinose operon different from other operons? Nevertheless, Englesberg et al. discovered that the ara operon’s function differs significantly from that of the lac operon. Thus, the following paradigm was hypothesised: The arabinose system: genes and behavior How the ara system works? DNA looping: discovery, proof and biological use – helical-twist experiment 

What is transmission electron microscope? A transmission electron microscope (TEM) is an electron microscope that transmits electrons through a sample to observe it. Scientists use transmission electron microscopes to analyze materials and examine their microstructural and compositional properties. A transmission electron microscope transmits a highly focused beam of electrons through a sample to observe and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

A typical vaccine has an ingredient that resembles the microorganism that causes illness and is typically made from weak or dead forms from the microbes, their toxicants, as well as one or more of the surface proteins.

Curious about how to get gene sequences from NCBI? Whether you’re a student, researcher, or just a genetics enthusiast, NCBI is an amazing resource for all things genetic. It can be a bit overwhelming at first, but don’t worry—I’m here to guide you through the whole process. In this easy-to-follow, step-by-step guide, we’ll walk you ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Cell division is a crucial process that allows organisms to grow, repair, and reproduce. One important aspect of cell division is cytokinesis, the process of separating one cell into two daughter cells. While cytokinesis is a universal process, it can vary greatly between different types of cells. In this article, we will compare and contrast ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The nervous system relies on neurons to carry out various functions, ranging from basic motor reflexes to complex processes such as memory formation and decision-making. Unlike human communication through words and body language, neurons communicate through electrical and chemical signals. Similar to a committee member, a single neuron typically integrates and processes information from multiple ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Centrifuge? What is Centrifuge Balancing? Why it is important to balance a centrifuge? – Why is centrifuge balanced? What Happens if a Centrifuge is Unbalanced?  How Centrifuge Works? What is Centrifuge Tube? How to balance in different  centrifuge? If you are utilising a portable benchtop instrument, you must ensure that the centrifuge is ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Microscope Calibration? Method of Calibrating a Microscope The method of calibrating a microscope involves using an eyepiece graticule and a stage micrometer to establish a conversion factor that relates the divisions on the eyepiece graticule to a specific measurement in micrometers (µm). This calibration process allows researchers to accurately measure the size of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is ph Meter? Why Calibrate A pH Meter? Calibration of a pH meter is a critical procedure to ensure the accuracy and reliability of the measurements it provides. Here are the primary reasons why calibration is essential: In summary, calibrating a pH meter is essential for maintaining its accuracy, ensuring the reliability of results, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Understanding the evolutionary connections and interdependence of various species is a fundamental aspect of biology. Phylogenetic trees, also known as evolutionary trees or cladograms, illustrate the common ancestry and divergence of species over time. Constructing a phylogenetic tree is an effective method for deciphering the intricate tapestry of life on Earth and obtaining insight into ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

A compound microscope is a laboratory instrument with high magnification power, which is consists of more than one lenses.

Standard laboratory equipment for measuring and transferring minute amounts of liquid includes micropipettors. You’ll put them to use all through the semester and into subsequent upper-level courses. If you want reliable results from your tests, you must become an expert user of these tools. Objective Parts of a micropipette Different sizes of micropipettes The laboratory’s ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Making a Wet Mount Staining a Slide (After Making a Wet Mount) Adjusting Focusing Tension There is a ring on the inside portion of the right-hand focusing knob on all other compound microscope versions (490 and above). This ring can be manually adjusted to increase or decrease tension. Changing the Eyepiece (M Series Microscope) A ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is HPLC (High-performance liquid chromatography)? Principle of HPLC (High-performance liquid chromatography) Instrumentation of HPLC High-Performance Liquid Chromatography (HPLC) is a sophisticated analytical technique that relies on a precise set of instruments to achieve effective separation, detection, and analysis of chemical compounds. The key components of an HPLC system include the mobile phase reservoir, solvent ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Astrovirus is a type of virus that can cause gastroenteritis (also known as stomach flu) in humans. The virus is highly contagious and is primarily spread through close contact with infected individuals or through contaminated food or water. Symptoms of astrovirus infection may include diarrhea, vomiting, abdominal pain, and fever. Most people recover from an ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Human Brain? Definition of Brain The brain is the central organ of the human nervous system, responsible for processing information, controlling bodily functions, and facilitating cognition, emotions, and behaviors. Characterisitcs Features of Human Brain The human brain possesses several characteristic features that contribute to its complexity and functionality. Here are some key characteristics ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

A human cell is the basic unit that makes up your body, kind of like tiny rooms in a massive mansion working together to keep everything running. Picture it as a microscopic bubble with a flexible outer layer—the membrane—that decides what enters or exits. Inside, there’s a gooey mix called cytoplasm, packed with tiny machines ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Human Circulatory Circuit? Definition of Human Circulatory Circuit The human circulatory circuit, also known as the cardiovascular system, is a complex network comprising the heart and blood vessels that facilitate the continuous flow of blood throughout the body, ensuring the transport of oxygen, nutrients, and waste products to and from cells. This system ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Human Circulatory System? Definition of Human Circulatory System The human circulatory system is a complex network of blood vessels, including arteries, veins, and capillaries, driven by the heart, responsible for transporting nutrients, oxygen, hormones, and waste products throughout the body. Features of Circulatory System The human circulatory system, a cornerstone of physiological functionality, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Cytomegalovirus (CMV) is a widespread virus whose manifestations in immunocompromised patients with congenital CMV disease range from asymptomatic to severe end-organ dysfunction. Human cytomegalovirus is a member of the herpesviruses, Herpesviridae, or human herpesvirus-5 (HHV-5) family of viruses. Infections with the human cytomegalovirus are frequently associated with the salivary ducts. An infection with CMV may ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Digestive System? How Does the Digestive System Work? Types of Digestive System The digestive system can be categorized into two primary components: the gastrointestinal (GI) tract and the accessory digestive organs. Understanding these components is essential for comprehending how the body processes food and absorbs nutrients. Each part plays a distinct role in ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What Is Reproduction? Reproduction refers to the process where organisms create more of themselves. However, although the reproductive system is vital to maintaining a species’ existence, unlike other body systems it is not essential for keeping an individual alive. Two types of sex cells (GAH-meetz) are involved in the human reproductive process. In the female’s ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Definition of Human Heart The human heart is a vital organ that continuously pumps blood throughout the body, providing oxygen and nutrients to cells and removing waste products. It is a hollow muscular organ located in the chest, primarily on the left side, and consists of four chambers that contract in a coordinated manner to ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Human Immunodeficiency Virus (HIV)? Classification of HIV Human Immunodeficiency Virus (HIV) is classified into two primary types: HIV-1 and HIV-2. Both types belong to the Retroviridae family, specifically under the genus Lentivirus. These viruses exhibit significant diversity, which is crucial for understanding their epidemiology, transmission dynamics, and treatment options. Morphology of HIV Virus ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The male reproductive system includes a number of hormones and organs that are involved in reproduction. These hormones and organs can be found either inside or outside of the pelvis. Organs of the Male Reproductive System External male reproductive structures: Internal male reproductive organs: External male reproductive structures The scrotum contains the testes, epididymides and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The human body is home to trillions of tiny organisms, like bacteria, fungi, and viruses, that live on the skin, in the mouth, gut, and other areas. This community of microbes is called the human microbiome. Most of these organisms aren’t harmful—in fact, many are essential for health. They help digest food, produce vitamins, and even ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Human Papillomavirus (HPV) Structure of Human Papillomavirus (HPV) Genome Structure of Human Papillomavirus (HPV) Functions of viral proteins Protein Function E1 Viral DNA replication E2 Control of viral transcription, DNA replication, and segregation of viral genomes E4 Favor and support the HPV genome amplification; regulate the expression of late genes; control virus maturation; facilitate the release ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

typical flora of skin, hair, and nails is the stable community of microorganisms—mostly bacteria and fungus—that live on the outside surfaces of the human body without causing damage under typical circumstances. These communities, sometimes referred to as the skin microbiome, occupy ecological niches, fight against infections, and generate molecules that stop microbial invasion, therefore safeguarding ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Human teeth play a crucial role in the process of digestion, enabling the breakdown of food into smaller, manageable pieces before swallowing. Unlike some animals that can consume food in one large gulp, humans rely on their teeth to perform various functions essential for effective mastication. This article provides an overview of the structure, types, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is the humoral immune response/What is humoral immune response? Humoral immunity definition Humoral immunity, also known as the humoral immune response, refers to the branch of the immune system that produces antibodies in response to extracellular pathogens and foreign substances, primarily mediated by B-lymphocytes and plasma cells in the body’s extracellular fluids. History The ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Hyaline Cartilage? Hyaline cartilage is a type of connective tissue found in various parts of the human body, characterized by its glossy and smooth appearance. Here are some key points about hyaline cartilage: Overall, hyaline cartilage serves as an important connective tissue in the body, contributing to the proper functioning and structure of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Urinary casts are small, cylinder-shaped, tube-shaped particles that can be detected by a microscopic analysis of urine. Casts are the only kidney-specific components discovered in the urine sediment. It is believed that Tamm-Horsfall mucoprotein (uromodulin) released by renal tubular epithelial cells forms the fundamental matrix of all casts. Any components present in the tube filtrate, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

In this article you will learn about Hybridization For Self, Cross and Vegetative Propagation in plants and. their Procedure, advantages, and limitations. What is Hybridization? Objectives of Hybridization Hybridization is a crucial technique in genetics and plant breeding aimed at enhancing and combining desirable traits from different individuals. Its objectives serve to improve agricultural efficiency ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Hybridization Probes Definition Hybridization probes are a small nucleotide sequence that is used for the detection of complementary sequences (DNA or RNA) in a nucleic acid sample. DNA Probes detects the complementary DNA with the help of a hybridization reaction. This is achieved by permitting the probes to base pair with the sample nucleic acid ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Hydrogen Sulfide (H2S) Test? Hydrogen sulfide (H S)-producing bacteria Principle of Hydrogen Sulfide (H2S) Test Objective of Hydrogen Sulfide (H2S) Test Media for the detection of Hydrogen Sulfide (H₂S) Commonly used media for detecting hydrogen sulphide generation, sulphur sources, and sulphide indicators include the following: Media Sulfur source H₂S indicator Bismuth sulfite Peptones ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Hydrophobic Interaction Chromatography (HIC)? Principle of Hydrophobic Interaction Chromatography (HIC) The principle of Hydrophobic Interaction Chromatography (HIC) is based on the interactions between the hydrophobic regions of sample protein molecules and a hydrophobic stationary phase or matrix. This principle allows for the separation and purification of proteins based on their hydrophobicity. In HIC, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Hymenolepis nana? History and Distribution of Hymenolepis nana Hymenolepis nana, known as the dwarf tapeworm, has a significant historical and geographical context that sheds light on its prevalence and impact on human health. The name “Hymenolepis” originates from the Greek words for membrane and covering, referring to the thin shell surrounding its eggs, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Hypersensitivity? Definition of Hypersensitivity Hypersensitivity is an abnormal and exaggerated response of the immune system to a substance (antigen) that is usually harmless. It can lead to allergic reactions and immune-related diseases. Causes Of Hypersensitivity Diseases Hypersensitivity is caused by various immune responses that can be triggered by different types of antigens. The ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Hypersensitivity (also known as hypersensitivity response or intolerance) is a term used to describe undesirable reactions that are caused by the immune system, which includes autoimmunity and allergies. These are typically called an overreaction of the immune system, and these reactions can be harmful and uncomfortable. It is an immunologic term , and should not be misinterpreted as a psychiatric term of being hypersensitive, which refers that a person is hypersensitive to physical (ie sounds, touch light, sound, etc.) or emotional stimuli. However, there is a link between the two , studies have demonstrated that with ADHD (a mental disorders) tend to experience hypersensitivity reactions, such as asthma, allergies, or eczema and more than people who don't have ADHD.

What is Hyphae? Definition of Hyphae Hyphae are the elongated, branching filamentous structures of fungi and actinobacteria, collectively forming the mycelium, which is essential for their growth and development. Hyphae Types Fungal hyphae, the filamentous structures integral to the growth and development of fungi, exhibit a diverse range of types based on various criteria. Here, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Hypothalamus? Definition of Hypothalamus The hypothalamus is a small but crucial part of the vertebrate brain located beneath the thalamus. It regulates various physiological functions, including body temperature, hunger, thirst, and circadian rhythms, by linking the nervous system to the endocrine system through the pituitary gland. Additionally, it plays a role in controlling ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is hypotonic solution? Definition of Hypotonic solution A hypotonic solution is one that has a lower solute concentration compared to another solution, leading to a net movement of water into the region of higher solute concentration, typically across a semipermeable membrane. What Happens to Cells when it is placed in a hypotonic Solution? When ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

IIT JAM Biotechnology Previous Year Question Papers Download: Elevate your IIT JAM Biotechnology exam preparation with our extensive collection of previous year question papers. Download these past papers to gain insights into the exam format, identify frequently tested topics, and practice with real questions from previous years. These question papers are crucial for understanding the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Number of tests Once in a year Subject included Biotechnology, Geology, Chemistry, Mathematics, Economics, Mathematical Statistics Organizing authority IIT Madras is the Organizing Institute for JAM 2024 Exam conducted by IITs JAM Score Card Validity M.Sc programmes in IITsAdmissions in IISc, IISER Pune, IISER Bhopal, JNCASR, NITs Medium of examination English only Mode of examination ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Immune Response? Primary Immune Response The immune response can be divided into four distinct phases when the body encounters an antigen for the first time. These phases include the lag phase, exponential phase, plateau phase, and decline phase. Each phase plays a crucial role in the overall immune response. In addition to the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Immunity? Definition of Immunity Immunity is the body’s ability to resist or protect itself against harmful pathogens or diseases. What is Immune System? Lymphoid Organs Primary lymphoid organs Secondary lymphoid organs Tertiary lymphoid organs How does Immunity Work? Mechanism of Immunity Types of Immunity  The primary purpose of the immune system is to ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Immunodeficiency? General Features Of Immunodeficiency Diseases Prior to beginning our examination of specific disorders, it is necessary to review some common characteristics of immunodeficiencies. Classification of Immunodeficiency Immunodeficiency diseases are categorised as A. Congenital or Primary Immunodeficiencies 1. B-Cell Immunodeficiencies (a) X-linked hypogammaglobulinemia, (b) selective immunoglobulin deficiencies, (c) hyperIgM syndrome, and (d) interleukin-12 ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Immunodiffusion refers to the movement of antigen or antibody within the gel. Add the reactants to the wells. They diffuse to the area of lower/no concentration. A gradient of the reactants' concentration forms as they diffuse into the gel. Immunoprecipitation takes place in a region with an equivalent concentration of both the antibody and antigen. This is represented by bands.

What is Immunoelectrophoresis? Immunoelectrophoresis is a biochemical approach for protein separation and characterization that is based on electrophoresis and antibody-antigen interactions. It uses immunodiffusion and electrophoresis techniques to identify and analyse specific antigens within a protein mixture. The immunoelectrophoresis procedure begins with electrophoresis, which separates the antigen mixture into its distinct components. This is accomplished ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Immunofluorescence Assay? Definition of Immunofluorescence Assay Immunofluorescence is a laboratory technique used to detect specific proteins or antigens in biological samples by using antibodies labeled with fluorescent molecules, allowing visualization under a fluorescence microscope. Requirements of Immunofluorescence Assay Objective of Immunofluorescence Assay Principle of Immunofluorescence General Steps of Immunofluorescence Assay Types of Immunofluorescence ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Immunofluorescence Quenching Solution is used in immunofluorescence and immunocytochemistry applications.

What is Immunoglobulin A (IgA Antibody)? Definition of Immunoglobulin A (IgA Antibody) Immunoglobulin A (IgA) is an antibody that plays a key role in the immune function of mucous membranes. It is the second most abundant immunoglobulin in the body and provides protection against antigens and pathogens in the gastrointestinal, respiratory, and genitourinary tracts. Subclasses ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Immunoglobulin D (IgD Antibody)? Properties Of Igd Measurement Of Igd The measurement of IgD, an immunoglobulin found in body fluids, has evolved over time with the development of more sensitive techniques. This article explores various methods used to measure IgD and discusses the challenges and considerations associated with each method. From traditional techniques ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Immunoglobulin E (IgE Antibody)? Definition of Immunoglobulin E (IgE Antibody) Immunoglobulin E (IgE) is a type of antibody that is involved in allergic reactions and defense against parasites. It is the least abundant but highly potent class of immunoglobulins found in mammals. Structure of Immunoglobulin E (IgE Antibody) Molecular Level of Immunoglobulin E ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Immunoglobulin G (IgG Antibody)? Definition of Immunoglobulin G (IgG Antibody) Immunoglobulin G (IgG) is the most common type of antibody in the human body, representing approximately 75% of serum antibodies. It plays a crucial role in protecting against bacterial and viral infections by binding to specific antigens and activating immune responses. Structure of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Immunoglobulin M (IgM Antibody)? Definition of Immunoglobulin M (IgM Antibody) Immunoglobulin M (IgM) antibody is the first antibody produced by the immune system in response to an infection or foreign substance. It is a large pentameric antibody that plays a crucial role in the body’s initial immune response. Fundamentals of IgM IgM, or ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Definition of Immunological Tolerance Immunological tolerance is a state of specific immunologic nonreactivity to a specific antigen to which an individual has been previously exposed. Immune tolerance stops the immune system from responding to self-antigens. Mechanisms of Tolerance The proposed mechanisms of tolerance are clonal deletion, clonal anergy, and suppression. Clonal deletion: Clones of B ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Immunology is the branch of biological and medical sciences that studies the immune system, which is the body’s defense mechanism against harmful organisms, pathogens (like bacteria, viruses, fungi, and parasites), and other foreign substances. Immunologists work to understand how the immune system functions in both health and disease, including autoimmune disorders, hypersensitivities (like allergies), immunodeficiencies, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Oncologists and immunologists have long been optimistic about the potential of immunologic techniques to treat cancer patients. The primary interest in an immunologic approach stems from the fact that the majority of existing cancer treatments rely on medications that kill dividing cells or stop cell division, and these treatments have severe side effects on normal ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Implantation? Time of Implantation Site of Implantation Implantation stages Implantation is a complex process that involves a series of stages in the embryonic development of mammals. These stages are crucial for the successful attachment and invasion of the blastocyst into the uterine wall. The five recognized stages of implantation are migration and hatching, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

IMViC is a mnemonic that stands for four tests used in the identification of enteric bacteria: Indole, Methyl Red, Voges-Proskauer, and Citrate. These tests are commonly used in microbiology laboratories to identify bacterial species in the Enterobacteriaceae family, which includes many common pathogens such as Escherichia coli and Salmonella. The principle behind the IMViC tests ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The conventional approach to drug discovery and development in the pharmaceutical industry is frequently characterized by prolonged timelines, high expenses, and a propensity for setbacks. The drug discovery process has been revolutionized by the emergence of bioinformatics and advancements in computational technologies, leading to the development of a new approach known as in silico drug ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is In Vitro Fertilization (IVF)? Why IVF is done? IVF is performed for various reasons related to infertility and certain health conditions. Here are some common reasons why IVF may be done: Additionally, for individuals who do not have a functional uterus or face significant health risks during pregnancy, IVF with a gestational carrier ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Inbreeding depression? Definition of Inbreeding depression Inbreeding depression is the reduced biological fitness and health of offspring resulting from the mating of closely related individuals, which increases homozygosity and exposes deleterious recessive alleles. History of Inbreeding depression History of Inbreeding Depression Effects of Inbreeding Inbreeding, or the mating of closely related individuals, has ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Incinerator? Definition of Incinerator An incinerator is a specialized furnace designed for burning potentially dangerous materials in a controlled manner, typically at high temperatures, to eliminate pollutants and safely dispose of waste. Working principle of Incinerator The principle of an incinerator is based on a two-stage combustion process, involving a primary combustion chamber ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Inclusion Bodies? Inclusion bodies are thick in size, spherical and aggregated proteins typically found inside the cells of protokaryotes thanks to the overexpression of heterologous proteins. Inclusion bodies comprise small particles that are freely suspended and floating in the cell wall. This is why they are also known as inclusions of the cytoplasm. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Incomplete Dominance? Definition of Incomplete Dominance Incomplete dominance is a genetic scenario where the heterozygous phenotype is an intermediate blend of the two homozygous phenotypes, with neither allele being fully dominant or recessive. Concept of Dominance In genetics, the concept of dominance revolves around the relationship between alleles of a single gene. To ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Laboratory Incubator? An incubator serves as a temperature-controlled, insulated container that laboratories utilise for cultivating and maintaining various biological cultures. This essential piece of equipment creates optimal conditions necessary for growing microorganisms in artificial environments. Like most sophisticated lab instruments, it maintains precise control over environmental factors such as temp, moisture levels, and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Indirect ELISA? Indirect ELISA Principle The principle of an indirect ELISA involves the use of two binding steps to detect and quantify specific antibodies in a sample. The first step involves the incubation of the primary antibody with the antigen of interest. The primary antibody specifically recognizes and binds to the target antigen, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Indole test? Indole Test Definition The indole test is a biochemical assay used to determine a bacterium’s ability to metabolize tryptophan into indole through the action of the enzyme tryptophanase, aiding in the differentiation and identification of certain bacterial species. Purpose of Indol Test (Objectives of Indole Test) The indole test serves a ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What Is Induced Breeding (hypophysation)? History of induced breeding Induced breeding has played a transformative role in aquaculture, enabling the controlled reproduction of fish species that naturally require specific environmental stimuli for spawning. The history of this technique highlights key advancements across different countries, leading to its widespread adoption in modern fish farming. Principle of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Induced Mutation? Mechanism of induced mutation Induced mutations occur when external agents, known as mutagens, alter the structure or sequence of DNA. These mutations can arise through several mechanisms that affect how DNA bases interact or replicate. Let’s explore the primary mechanisms responsible for induced mutations. Base Replacement by Base Analogs Base analogs ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is an Industrial centrifuge? An industrial centrifuge is a machine that uses centrifugal force to separate or purify materials. Centrifuges work by spinning a sample at high speeds, using gravitational force to separate the components of the sample based on their density, size, or shape. Industrial centrifuges can be used for a wide range ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are industrial designs? Objectives of Industrial Designs The objectives of industrial designs are multifaceted, aiming to balance aesthetic appeal, functionality, and legal protection. Here are the primary objectives: Rights in Industrial Designs The rights associated with industrial designs are crucial in safeguarding the visual and non-functional aspects of a product. These rights ensure that ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Infertility? Definition of Infertility Infertility is the inability to conceive or achieve a successful pregnancy after a year or more of regular, unprotected sexual intercourse. Causes of Infertility in Male There are several potential causes of infertility in males. Some common factors that can contribute to male infertility include: Causes of Infertility in ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is an inflammation? Definition of inflammation Inflammation is the immune system’s response to injury or infection, characterized by redness, swelling, warmth, and pain at the affected site. Causes of inflammation Inflammation can be triggered by a variety of factors, each capable of initiating an inflammatory response. The following are among the most common causes: ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Influenza Virus? Classification of Influenza Virus Influenza viruses are often classified into three species: influenza A, influenza B, and influenza C. Only types A and B are relevant to human health. Despite the fact that both viruses are capable of infecting humans, genus A often causes widespread disease and epidemics. Influenza A Virus ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is IR Spectroscopy? Principle of IR Spectroscopy Infrared (IR) spectroscopy operates on the basis of analyzing the interaction between infrared radiation and a molecule. In terms of wavelength, the infrared region most frequently employed for analyzing organic compounds lies between 2,500 and 16,000 nm, corresponding to a frequency range of 1.9 × 10^13 to ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Innate Immunity ? Definition of Innate Immunity  Innate immunity refers to the body’s natural, non-specific defense mechanisms that provide an immediate response to invading pathogens without prior exposure. It serves as the first line of defense against infections and is present from birth. Features of Innate immunity Innate immunity possesses distinctive features that contribute ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Innate immunity is the naturally-occurring immunity generated through genetic factors and the body's physiology.   Innate immunity begins at birthand continues throughout one's life. 

What is Inoculating Loops and Needles? Definition of Inoculating Loops and Needles Inoculating loops and needles are handheld tools used in microbiology laboratories to transfer and manipulate microorganisms. Inoculating loops are wire loops with a small diameter used to collect and streak microbial cultures on solid agar-based media. Inoculating needles are sharp needles used to ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The insect circulatory system is an open system characterized by the circulation of hemolymph, a fluid that functions similarly to blood in vertebrates, throughout a body cavity known as the hemocoel. Unlike closed circulatory systems, where blood is confined within vessels, the hemolymph in insects bathes the internal organs directly. The primary component of this ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The insect endocrine system is a complex network of glands and neurosecretory cells that regulates essential physiological processes, including growth, molting, metamorphosis, and reproduction. It operates primarily through the release of hormones such as ecdysone and juvenile hormone. Ecdysone, produced by the prothoracic glands, controls the molting process, enabling the insect to shed its exoskeleton ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The excretory system of insects is primarily designed to eliminate nitrogenous waste while conserving water, reflecting their adaptation to terrestrial environments. Insects utilize a specialized structure known as Malpighian tubules, which are thin, tubelike organs extending from the gut. These tubules absorb waste products and excess salts from the hemolymph (the insect equivalent of blood) ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Taxonomy of Pests The taxonomy of pests plays a crucial role in understanding and managing these organisms effectively. Taxonomy, as the science of classifying organisms, provides a systematic framework for organizing and categorizing pests based on their characteristics, relationships, and evolutionary history. By studying the taxonomy of pests, researchers and pest control professionals can gain ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The insect nervous system is a complex and highly organized network that facilitates a wide array of functions crucial for the survival and adaptation of insects. It comprises two primary components: the central nervous system (CNS) and the peripheral nervous system (PNS). The CNS consists of a dorsal brain and a ventral chain of segmental ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Insect Plant Interaction? What are the main types of interactions between insects and plants? Insect-plant interactions are essential components of ecological dynamics, influencing biodiversity, ecosystem functioning, and agricultural productivity. These interactions can be categorized into three primary types: antagonism, commensalism, and mutualism. Each type encompasses specific relationships characterized by distinct functional roles and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The respiratory system of insects is a sophisticated network designed for efficient gaseous exchange. This system relies on a series of internal tubes known as tracheae, which permeate the insect’s body, extending to all tissues, including muscle fibers. Unlike in vertebrates, where oxygen is transported via blood, the tracheal system allows oxygen to reach its ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Insects? Definition of Insects Insects are small, six-legged invertebrates belonging to the class Insecta. They have a three-part body (head, thorax, and abdomen), a chitinous exoskeleton, compound eyes, and a pair of antennae. Insects are the most diverse group of animals, with over a million species, and play crucial roles in ecosystems as ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are insect vector? Vectors play a crucial role in the transmission of pathogens and parasites that cause infectious diseases in both plants and animals. By definition, a vector is an organism that carries a disease-causing agent and facilitates its spread among hosts. Understanding the dynamics of vector transmission is essential for developing effective control ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Integral Protein? Definition of Integral Protein An integral protein is a type of protein that is permanently anchored within the cellular membrane, often spanning its entire width, and plays crucial roles in various cellular functions due to its specific functional domains. Integral Protein Types Integral proteins, a pivotal component of cellular membranes, can ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Integrated Pest Management? Integrated Pest Management Approach The concept of integrated pest management (IPM) emerged as a response to the limitations of relying solely on chemical pesticides for pest control. The excessive use of pesticides led to the development of resistant pest populations, necessitating a more comprehensive approach. IPM takes into account all ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Integrated Plant Disease Management? Components of Integrated Disease Management (IDM) Integrated Disease Management (IDM) is a multifaceted approach designed to address plant diseases through the coordinated application of various control strategies. The primary components of IDM work synergistically to create a robust framework that mitigates disease impact while promoting sustainable agricultural practices. The ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Fish Integument (Skin) Epidermis And Dermis Epidermis The epidermis is the outermost layer of the skin, derived from the ectoderm, and consists of multiple layers of epithelial cells. These layers vary in thickness depending on the species, age, size, and reproductive stage of the organism. The cells in the epidermis are arranged in specific layers, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Integument? The integument refers to the outermost covering of the body in animals, which includes the skin and its associated structures. The skin is the largest organ of the body and serves as a protective barrier between the internal organs and the external environment. In addition to the skin, the integument includes other ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Intellectual property (IP) in biotechnology pertains to the legal protections afforded to innovations derived from biological sciences. Biotechnology itself involves utilizing living organisms or their components to develop new products or processes. This broad field encompasses various entities, from pharmaceutical companies to agricultural firms. Historically, biotechnology has roots stretching back to ancient practices, such as ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Intellectual Property Right? Definition of Intellectual Property Intellectual Property (IP) refers to creations of the mind, such as inventions, artistic works, designs, symbols, and names, for which exclusive legal rights are granted to the creator or owner to use, sell, or license their creation. Definition of Intellectual Property Right Intellectual Property Rights (IPR) ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Short-term interactions 1. Predation Example of Predation 2. Pollination Example of Pollination 3. Seed dispersal Example of Seed dispersal Symbiosis: long-term interactions Mutualism, commensalism, parasitism, neutralism, amensalism, and competition are the six forms of symbiosis. These are distinguished by the extent to which they benefit or hurt each partner. 1. Competition Example of Competition 2. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are intermediate filaments? Types of intermediate filaments The intermediate filaments are extremely varied in terms of their biochemical properties, but can be classified into four major kinds based on their morphology and localization: 1. Type I IF proteins 2. Type II IF proteins 3. Type III IF proteins 4. Type IVIF proteins Characteristics of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Interphase? Definition of Interphase Interphase is the phase in the eukaryotic cell cycle during which the cell grows, replicates its DNA, and prepares for cell division, encompassing the G1, S, and G2 sub-stages. Stages of Interphase 1. Gap 1 2. Synthesis In summation, the Synthesis phase is a critical juncture in the cell ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Intracellular stimuli, such as DNA damage, predominantly trigger apoptosis via the intrinsic route. The intrinsic apoptosis pathway, which is comprised of conserved signalling proteins, is physically connected with mitochondria and sensitive to mitochondrial oxidative stress in vertebrates. Members of the Bcl family linked to the mitochondrial membrane have an effect on the process, including the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Plant anatomy? Scope of Plant Anatomy  Plant anatomy, the study of the internal structures of plants, encompasses a wide range of topics and applications. Its scope extends across various disciplines and industries, providing essential insights into plant biology, ecology, evolution, and practical applications in fields such as agriculture, medicine, and environmental science. Below ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Introduction of Microbiology What is Microbiology?, Microbiology is an advanced biology course that studies unicellular (single cell), multicellular (cell colony), or acellular (lacking cells) microorganisms, including bacteria, archaea, algae, fungi, protozoa, and viruses. The term biology is the combination of two important words such as bios, which means “living organisms”, and logy, which means  “the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Metamerism? Occurrence of Metamerism The occurrence of metamerism, a body organization in which segments are repeated serially along an organism’s body, can be observed across several distinct groups in the animal kingdom. This type of segmentation, although relatively rare, provides significant structural and functional advantages, contributing to the adaptability and evolution of certain ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What Is Ecology? Ecology is the scientific discipline that focuses on understanding the interactions between living organisms and their environment. It explores how organisms, both plants and animals, interact with each other and their surroundings, including the physical and biological components of their environment. Ecology draws upon various scientific fields, such as biology, geography, geology, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Parasitology? History of Parasitology The history of parasitology encompasses a rich tapestry of discoveries and advancements that highlight humanity’s ongoing struggle to understand and combat parasitic organisms. This narrative intertwines with the broader history of medicine, particularly in the context of tropical diseases, where many parasites are prevalent. Below is a structured overview ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Intron? Origin of Introns Types of Introns Group I introns, Group II introns, Nuclear pre-mRNA introns, and Transfer RNA itrons are the four types of introns. 1. Group I introns 2. Group II Introns 3. Spliceosomal introns/Nuclear pre-mRNA Introns 4. Transfer RNA introns Intron Structure Intron Function Splicing Steps of Splicing Splicing occurs ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Introns are non-coding DNA DNA sequences in a gene. They are removed through RNA splicing during maturation of the product of RNA.

What is Inverted Fluorescent Microscope? Ever peeked into the world of living cells? Scientists use a nifty tool called an inverted fluorescent microscope for this. Unlike regular microscopes, this one flips the script—literally. Imagine the lenses sitting above the sample and the light source shining from below. This upside-down setup makes it perfect for studying cells chilling at the bottom ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is an Inverted Microscope? An inverted microscope is literally an inverted microscope. The lights and lenses are positioned above the specimen stage and the objective lenses are below. This allows the user to critically observe the samples from below; this is important because many living specimens and cells to be observed are in petri ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Iodine testing is a chemical test that distinguishes mono- or diaccharides from polysaccharides such as amylase, glycogen, and dextrin. Starch-iodine is a variant of this test. It's used to determine if there is glucose in the leaves.

What is Ion Exchange Chromatography? Definition of Ion Exchange Chromatography Ion exchange chromatography is a separation technique that separates ions and polar molecules based on their affinity to ion exchangers. It involves the reversible exchange of ions between the target ions in the sample solution and ions attached to an ion exchanger. Working Principle of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Ion exchange chromatography (IEC) is a chromatographic method that exploits the charge properties of the molecules. It employs an insoluble matrix, which is covalently bonded with a charged group, as a stationary phase. These groups will then also have the ability to attract and bind ions that have the opposite charge and that are in the mobile phase, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Ion exchange chromatography (IEC) is a chromatographic technique that allows for the separation of ions and polar molecules based on their charge. It utilizes a stationary phase composed of an insoluble matrix with covalently bonded charged groups. These charged groups can attract and bind ions of the opposite charge present in the mobile phase, which ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Importance Iron Cycle Manganese and Mercury Cycles Couple Iron-Manganese cycle References

Hematoxylin is extracted from a leguminous plant, known as Haematoxylon campechianum, thus it is a natural dye. It forms hematein by oxidation (Ripening).

The microbial content of the outer atmosphere is changing with the season, it contains various pollen, algae, mosses, grains, spores of fungi, ferns, bacteria, and viruses.

Soil contain different types of microorganisms which are listed below; Principle of Isolation of Microorganisms from Soil During this process, the soil sample is collected from the study site. After that, the soil sample is dissolved in distilled water and then serial dilution is performed. Then the spread-plate/streak plate method is performed on the sample ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Isomerism Definition Isomerism refers to the phenomenon where more than one compound has identical chemical formulas, but different chemical structures. Chemical compounds with identical chemical formulae, but differ in the properties and arrangement of the atoms within the molecule are known as isomers. Thus, compounds with isomerism are referred to as isomers. The term “isomer” ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Isomerism? Definition of Isomerism Isomerism is the phenomenon in chemistry where molecules or ions have the same molecular formula but differ in their spatial arrangement or bond connectivity. Different Types of Isomerism Isomerism, a fundamental concept in chemistry, can be classified into two primary types: structural isomerism and stereoisomerism. Let’s delve into these ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Japanese Encephalitis (JE) Virus Structure of Japanese Encephalitis (JE) Virus Genome of Japanese Encephalitis (JE) Virus Epidemiology of Japanese Encephalitis (JE) Virus Transmission of disease Replication of Japanese Encephalitis (JE) Virus Signs and symptoms of Japanese Encephalitis (JE) Virus Japanese encephalitis (JE) is a viral infection that can cause inflammation of the brain. Symptoms of JE virus infection can range from mild ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What do you mean by jaw suspensorium? Jaw suspension in vertebrates refers to the way the lower jaw is attached to the upper jaw or the skull, enabling efficient biting and chewing. This attachment is achieved through modifications in the visceral arches, which are part of the splanchnocranium in the vertebrate skull. The vertebrate skull ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Karyotyping? Definition of Karyotyping Karyotyping is a laboratory technique used to visualize and analyze the number, size, and shape of chromosomes in an individual’s cells, aiding in the detection of genetic abnormalities and chromosomal disorders. What is Idiogram? An idiogram is a diagrammatic representation of a karyotype, which showcases all the morphological features ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Karyotyping? Karyotyping: What’s the Deal? Definition of Karyotyping Karyotyping is a diagnostic technique that examines an individual’s chromosomes to identify genetic abnormalities, structural changes, and chromosome number variations. What is a karyotype?  Karyotyping Procedure/Steps of Karyotyping Staining and banding Staining and Banding techniques used in karyotyping: Applications of Karyotyping Medical Genetics: Prenatal Diagnostics: ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Keto Enol Tautomerization? Keto Enol Tautomer Structure The structure of a molecule plays a significant role in determining the favorability and stability of keto and enol forms during keto enol tautomerization. In general, ketones are more favored over enols in many common molecular structures. However, the presence and nature of the α-carbon (the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Ketone Bodies? Definition of Ketone Bodies Ketone bodies are water-soluble molecules produced by the liver during periods of low glucose availability, serving as alternative energy substrates for various tissues. The primary ketone bodies include acetoacetate, beta-hydroxybutyrate, and acetone. Structure of Ketone Bodies For detailed visual representations of these structures, you may refer to ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Keystone Species? Characteristics of Keystone Species Keystone species are vital to the functioning and stability of ecosystems, exhibiting several distinct characteristics that set them apart from other species. Their influence on ecological dynamics is profound, and understanding these traits is essential for appreciating their role in maintaining biodiversity and ecosystem health. Types of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Kidney? Features of Kidney The kidney is a remarkable organ with several notable features. Here are some key features of the kidney: These features highlight the vital role of the kidneys in maintaining homeostasis and overall health. Structure of Kidney The structure of the kidney is characterized by its bean-like shape and various ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Overview of Kingdom Animalia The Kingdom Animalia is a large group of multicellular eukaryotic organisms that are heterotrophic in their nature. They get their food from outside sources. While they cannot create their own food and this is among the most characteristic traits of plant cells, animal cells do not have a cell wall like ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Monera? Definition of Monera Monera is a historical biological kingdom encompassing prokaryotes, which are unicellular organisms lacking a distinct nucleus. This kingdom primarily included bacteria and archaea, and its members are characterized by the absence of membrane-bound organelles. Over time, taxonomic classifications have evolved, and the term “Monera” is less commonly used today. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Kingdom Protista? Definition of Protista Protista: A diverse group of eukaryotic microorganisms, not belonging to animals, plants, or fungi Protists The scientific name of protists Amoeba Amoeba proteus Paramecium Paramecium pentaurelia Stentor Stentor coeruleus Euglena Euglena gracilis Volvox Colonial volvox Slime mold Physarum polycephalum How do they Look? – Protista Under Microscope History ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Kinyoun method also known as Kinyoun stain (cold method), was first developed by Joseph J. Kinyoun.

What is Kirby Bauer Disk Diffusion test? The Kirby-Bauer disk diffusion test is a laboratory method used to determine the effectiveness of antibiotics against bacterial strains. The test is named after its inventors, Drs. Paul Kirby and Robert Bauer, who developed it in the 1960s. In the Kirby-Bauer test, a bacterial culture is spread evenly ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Purpose of Kligler’s Iron Agar Test Principle of Kligler’s Iron Agar Test Composition of Kligler Iron Agar Ingredients Gram/Liter Beef extract 3 gm Yeast extract 3 gm Peptone 15 gm Proteose peptone 5 gm Lactose 10 gm Glucose 1 gm Ferrous sulfate 0.2 gm Sodium chloride 5 gm Sodium thiosulfate 0.3 gm Agar 12 gm ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

A KOH pre-test is a quick, non-invasive procedure to diagnose fungal infections that affect the nails or skin. The cells are collected from the affected region and put on a slide using an acid composed of potassium hydroxide. They are looked at under a microscope in order to determine if there are evidence of the presence of a mold.

What is Kranz Anatomy? Kranz Anatomy in C4 Plants Kranz anatomy represents a unique structural adaptation in the leaves of C4 plants, specifically designed to enhance the efficiency of photosynthesis in challenging environmental conditions, such as high temperatures and aridity. This specialized arrangement allows these plants to concentrate carbon dioxide (CO₂) around the enzyme ribulose ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Ever wondered how your cells turn the food you eat into usable energy? Let’s break down the Krebs cycle—a cornerstone of cellular respiration—and answer the questions you’ve been searching for. Also known as the citric acid cycle, this process is a series of chemical reactions that extract energy from nutrients. But where does this critical ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

L-form bacteria Definition “L-form” bacteria are also referred to as L-phase bacteria or L-phase variants, and cell wall deficient (CWD) bacteria are bacteria with no cell walls. They were first identified around 1935, by the scientist Emmy Klieneberger Nobel who identified them as “L-forms” after the Lister Institute in London which she was working at. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Dr. K. Ikeda, a Japanese scientist, extracted glutamic acid from kelp, a marine alga, by means of acid hydrolysis and separation in 1908. In addition, he observed that when glutamic acid was neutralised with caustic soda, it acquired a totally new, exquisite flavour. This marked the beginning of using monosodium glutamate (MSG) as a flavour ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Diagnosis of viral infections Importance of Viral Diagnosis The Viral diagnosis will be particularly helpful in different clinical situations such as; Diagnosis Methods 1.  The Direct Examination of Specimen The direct method is accomplished by these following processes; 2. Indirect Method or cell cultures (Virus Isolation) The Cytopathic Effect (CPE) is present in both HSV ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Laboratory flask? Purpose of Laboratory flask Materials used to construct Lab Flask Features of Laboratory flask Types of Laboratory Flask Essential glassware in scientific environments, laboratory flasks are made for mixing, heating, chilling, and chemical compound storage. Each shaped and sized to fit particular uses, they are rather diverse. Here are some typical ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Hot Plate? Definition of Hot Plate A hot plate is a portable heating device with a flat surface used to heat samples or materials in a controlled manner without the need for an open flame. Principle of Hot Plate The principle of a hot plate involves the use of electric current and magnetic ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Laboratory Refrigerators and Freezers? Definition of Laboratory Refrigerators and Freezers Laboratory refrigerators and freezers are specialized equipment used in scientific and medical settings to store and preserve samples, specimens, vaccines, pharmaceuticals, and biological materials at specific temperatures. They ensure hygienic conditions, precise temperature control, and reliable performance to maintain the integrity and viability ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

A well-established microbiology laboratory is necessary for the work of microorganisms. The students/researchers/scientists must follow the basic rules while working with microorganisms.

What is the Test Tube? Types of test tubes Material Used for Test Tube Laboratory Tube Collection Based on Color Yellow, Pink, and Blue Light Blue Red Green Lavender Grey In actual hospital and clinical practise, additional coloured collection tubes (gold, tiger, pink, gold, etc.) are also employed. The use of these tubes and the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

A water bath is laboratory equipment consisting of a heated water-filled container. It is utilised to incubate water samples at a steady temperature for an extended period of time. Some water baths have their temperature controlled by a current going through a reader. The majority of water baths allow users to specify a desired temperature ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is lac Operon? Jacques Monod (1910–1976) began studying bacterial growth and regulation in the late 1930s. He selected E. coli as a model bacteria and eventually concentrated on genes involved in E. coli’s growth on lactose. Francois Jacob joined him in his studies roughly 15 years later (1920–2013). As a result of their research, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Lactic acid is manufactured commercially by both synthetic and fermentation processes. It is made synthetically in Japan and the United States. European manufacturers, on the other hand, make lactic acid by fermentation. European producers account for between 28,000 and 30,000 tonnes per year of the world’s estimated lactic acid production capacity. Pharmaceutical industries (e.g. iron ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Lactic acid bacteria Genera Leuconostocs Genera Streptococcus Genera Lactobacillus Genera Lactococcus Metabolic activity of lactic acid bacteria

MRS Broth was developed by deMan, and co. in order to facilitate the most abundant growth of lactobacilli derived from feces, oral and other samples. Lactobacilli MRS Broth is a better media for lactobacilli. It allows for healthy growth and is especially suitable for several very discerning strains that grow poorly in other media.

What is Lactobacillus acidophilus? Classification of Lactobacillus acidophilu Habitat of Lactobacillus acidophilus Morphology of Lactobacillus acidophilus Metabolism of Lactobacillus acidophilus Genomics of Lactobacillus acidophilus Cultural Characteristics of Lactobacillus acidophilus Biochemical Characteristics of Lactobacillus acidophilus The biochemical characteristics of Lactobacillus acidophilus can provide valuable information about its metabolic capabilities. Here are some of the key biochemical characteristics: Fermentation of Various Substrates: Enzymatic Reactions: These ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The MRS formulation was made by de Man, Rogosa, and Sharpe to replace a variable product (tomato juice) and give lactobacilli in general a good place to grow.

The lactophenol cotton blue (LPCB) wet mount preparation is the most used method for staining and viewing fungus, and its preparation is straightforward. The formulation contains the following ingredients: As a mounting medium and staining agent, lactophenol cotton blue solution is used to prepare slides for microscopic study of fungus. Elements of fungi are dyed ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

lactophenol cotton blue definition Lactophenol Blue Solution or Lactophenol cotton blue is a wet mounting medium and staining agent which is used for the preparation of microscopic slides of fungi for examination. Fungal elements are stained intensely blue. You might be thinking, why should we learn this technique or what is the purpose of this ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Lamarck’s Theory? Postulates of Lamarckism’s Theory Lamarckism, formulated by Jean-Baptiste de Monet Lamarck, is based on four fundamental postulates that form the core of his evolutionary theory: Lamarck’s theory can be summarized by four main propositions: While Lamarckism has been largely superseded by modern evolutionary theory, it played a significant role in shaping ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Lamina Propria? Definition of Lamina Propria The lamina propria is a layer of loose connective tissue found beneath the epithelium in mucous membranes, providing structural support, facilitating nutrient passage, and serving as a protective barrier against foreign substances and organisms. Lamina Propria Structure Lamina Propria Functions The lamina propria, an integral component of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Laminar flow hood/cabinet? A laminar flow hood, or laminar flow cabinet, is a type of work environment used in pharmaceutical, medical, and research laboratories that creates a well regulated, sterilised environment when working with delicate material or processes. The main job of a laminar flow hood is to maintain an area free of contaminates by ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Land? “Land” generally refers to the solid surface of the Earth that is not covered by water. It encompasses various aspects, including: Overall, land is a multifaceted concept that plays a vital role in various fields, including geography, law, economics, and environmental science. Utilization of Land Land Land utilization refers to the various ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Landscape Gardening? Landscape gardening is a specialized field that integrates art and science to enhance the aesthetic and functional aspects of outdoor spaces. It involves the systematic planning and design of gardens while considering various environmental factors, plant selections, and local conditions. The goal is to create a harmonious landscape that reflects the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The development of echinoderms is characterized by a unique and intricate process of metamorphosis, which is unlike any other group of animals. Echinoderms exhibit two primary modes of development: direct and indirect. In direct development, there are no distinct larval stages, and the organism proceeds directly from egg to adult. In contrast, indirect development involves ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Lassa virus is an RNA virus that is spread to humans through contact with the urine or feces of an infected Mastomys rat. It is a type of virus known as an arenavirus, and it is endemic in West Africa. The virus is named after the town of Lassa, in Borno State, Nigeria, where it ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

CSIR NET, or the Council of Scientific and Industrial Research National Eligibility Test, is a national-level exam conducted in India to determine eligibility for lecturership and for awarding Junior Research Fellowship (JRF) to Indian nationals in the field of science. The exam is conducted in five subjects, including Life Sciences, Physical Sciences, Chemical Sciences, Mathematical ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is the latex agglutination test? Types of Latex Agglutination The latex agglutination test can be categorized into two main types based on the processes of detection: Latex Agglutination Test (LAT) for Antibody Detection and Latex Agglutination Test (LAT) for Antigen Detection. These two types of latex agglutination tests provide valuable diagnostic information in different ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Leaf Structure The leaf is a vital plant organ responsible for photosynthesis, transpiration, and gas exchange. It is typically thin and flat to maximize its surface area, which enhances the absorption of light and carbon dioxide while allowing efficient release of oxygen and water vapor. The structure of a typical leaf consists of several key ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Learning Behaviour? Learning by Animals Learning in animals is a fascinating subject that has captivated the attention of animal behaviorists. Understanding how animals learn and the mechanisms involved has been a topic of extensive research. Heyes (1994) has identified three commonly recognized types of experiences that can result in learning. The first type ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

An Overview of Complement System What is Lectin Pathway of Complement Activation? Components of Lectin Pathway 1. Mannose-binding lectin Structural subunits of mannan-binding lectin (MBL) and ficolins 2. MBL serum levels and MBL2 gene polymorphisms 3. Ficolins Ficolin-1 Ficolin-2 Ficolin-3 4. MBL-associated serine proteases Steps, Mechanism, Process of Lectin Pathway The lectin pathway, also known ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Leishmania donovani? Classification of Leishmania Domain: Eukaryota Phylum: Euglenozoa Class: Kinetoplastid Order: Trypanosomatida Genus: Leishmania History and Distribution of Leishmania Donovani The history and distribution of Leishmania donovani, the causative agent of visceral leishmaniasis or kala-azar, trace back over a century and reflect its significant public health impact globally. Understanding this history provides ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Lentiviral transfection is a method for introducing genetic material into cells. It involves the use of lentiviruses, a type of retrovirus, to deliver the desired DNA into the target cells. Lentiviral transfection has a unique advantage over other transfection methods, in that it can infect both dividing and non-dividing cells, making it useful for a ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Leptospira interrogans Complex? Classification of Leptospiraceae The family Leptospiraceae, part of the order Spirochaetales, includes three primary genera: Leptospira, Leptonema, and Turneriella. Only the genus Leptospira includes species that are pathogenic to both animals and humans. Scientific classification of Leptospira interrogans Domain: Bacteria Phylum: Spirochaetota Class: Spirochaetia Order: Leptospirales Family: Leptospiraceae Genus: Leptospira ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Lethal Allele? Definition of Lethal Allele A lethal allele is a gene variant that causes the death of an organism carrying it, either during embryonic development or later in life. Types of Lethal Allele Lethal alleles are genetic variations that result in the death of an organism carrying them. They can be categorized ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Leucine aminopeptidase (LAP) is an enzyme used to distinguish catalase-negative, gram-positive cocci of Aerococcus and Leuconostoc (LAP test negative) from other organisms in the group, such as Streptococcus, Enterococcus, Lactococcus, and Pediococcus (almost always positive).

Ecological levels of organization Organism → Population → Community → Ecosystem → Biome → Biosphere Ecological Level 1 – Organisms Ecological Level 2 – Population Ecological Level 3 – Biological Community Types of Community Depending on how big they are and how independent they are, communities can be put into two groups: Major Community Minor ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

For the cultivation of Haemophilus, Levinthal's Medium can be used. Although there are many species in the genus Haemophilus that can cause infections, they all share a common morphology. They also require blood-derived factors for growth. This is what gave the genus its name. The Haemophilus Genus is a large grouping of gram-negative rods, which can grow on agar-containing human blood. Two factors are required for Haemophilus species to grow: factor-X, and factor-V.

Life cycle of Algae Sequential changes of the different pages through which an organism completes the life process, starting from zygote to the zygote of the next generation is called the life cycle. There are four types of life cycle in algae such as; 1. Haplontic Life Cycle 2. Diplontic Life Cycle 3. Diplohaplontic Life ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Fasciola Hepatica Life Cycle of Fasciola Hepatica Fasciola hepatica completes its life cycle in two hosts. The definitive or primary host is a sheep or cow, while the intermediate or secondary host is a small of the genus Limnaea. Its life cycle consists of a number of larval stages that reproduce asexually (polyembryony). Copulation, Fertilization ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Plasmodium vivax? The life cycle of Plasmodium vivax The life cycle of Plasmodium vivax is divided into two phage; 1. Asexual cycle or Life Cycle of Plasmodium vivax in Man or Schizogony in man Below is a detailed explanation of the asexual cycle of Plasmodium vivax in Man; 2. Sexual Cycle or Life cycle Plasmodium ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

This reflects the seemingly marvelous developments that have occurred from the history of microbiology to the present day. Advances in technology and subsequent research in the field over the years have meant that once we learned how to study these tiny creatures, we only grew in appreciation for these vital little agents. But in 1590, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Difference Between Light Microscope and Electron Microscope

What is Lineweaver–Burk plot? The Lineweaver–Burk plot, commonly referred to as the double reciprocal plot, stands as a foundational concept within the domain of biochemistry. Stemming from the renowned Michaelis–Menten equation, which pertains to enzyme kinetics, this plot was innovatively introduced by Hans Lineweaver and Dean Burk in the year 1934. Delving into its essence, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Linkage? Definition of Genetic Linkage Genetic linkage is the tendency for genes located on the same chromosome to be inherited together due to their physical proximity. Exploring Terms Related to Genetic Linkage Characteristic of Linked Genes Linked genes are genes that are located close together on the same chromosome and tend to be ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Linkage isomerism? – Linkage isomerism Definition Ligands  Ligands That Can Form Linkage Isomers ligand Lewis structure name donor atoms CN– cyanide ion C or N SCN– thiocyanate ion S or N NO2– nitrite ion N or O Ambidentate Ligand An ambidentate ligand is a type of ligand that possesses two different potential sites ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is a lipase test? Lipase is a digestive enzyme that might be thought of as “digestive juice.” It aids in the breakdown of fatty tissue. To produce lipase, your body relies primarily on the pancreas, an organ situated behind and below the stomach. Salivary (spit) glands and the stomach both produce lipase. A trace ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Lipid Hydrolysis Test of Objectives Principle of Lipid Hydrolysis Test Media Used in Lipid Hydrolysis Test Tributyrin agar: Tributyrin agar is a differential medium that tests an organism’s ability to make lipase, an exoenzyme that breaks down tributyrin oil. Lipases break up fats and oils (fats). Tributyrin oil is a triglyceride, which is a type ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Lipids? Definition of Lipids Lipids are a group of organic compounds, insoluble in water but soluble in non-polar organic solvents, that serve as energy storage molecules, cell membrane components, and play roles in signaling and insulation. Properties of Lipids Physical Properties of Lipids Chemical Properties of Lipids Physical Properties Chemical Properties Soluble in ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Structure and Composition of Lipopolysaccharide (LPS) It is composed of three components like; O-antigen Core Structure of Core or Core oligosaccharide (or Core-OS) The core domain always contains an oligosaccharide component which attaches directly to lipid A and commonly contains sugars such as heptose and 3-deoxy-D-mannooctulosonic acid (also known as KDO or keto-deoxyoctulosonate). It is ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Liposome? Liposomes, derived from the Greek words “lipo” (fat) and “soma” (body), are spherical vesicles characterized by at least one lipid bilayer. These structures are primarily composed of phospholipids, notably phosphatidylcholine, and often incorporate cholesterol. Other lipids, such as those present in eggs and phosphatidylethanolamine, can also be integrated, provided they are congruent ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Liquid Chromatography? Types of Liquid Chromatography Liquid chromatography can be classified into four main types based on the components involved in the chromatographic process: These different types of liquid chromatography offer versatility in separating and analyzing diverse compounds, catering to various research and industrial applications. Researchers select the appropriate type of liquid chromatography ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Fluid wastes consisting of sewage and residential wastewater, or treated water or other liquids, generated by industrial operations, particularly in the pulp and paper industry, the food processing industry, and the chemical manufacturing industry. What is Liquid Waste Management? Characteristics of Sewage/Liquid Waste In sewage, the death of oxygen-dependent organisms such as aerobic microbes, plants, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is a Mini Centrifuge? A mini centrifuge is a small, portable device that is used to separate substances in a liquid mixture by spinning the mixture at high speeds. Mini centrifuges typically have a capacity of 1.5 to 2.0 mL and are used to quickly and efficiently separate small amounts of liquid samples, such ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Principles Of Biotechnology Biotechnology has grown and changed a lot over the years. The old way of doing it was to use microbes to make products that people could use. Now, the new way is to use genes to make vaccines. So, the European Federation of Biotechnology (EFB) has come up with a new definition ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is the Litmus Milk Test? Litmus Milk Medium is a liquid medium suggested for use in qualitative tests for determining the activity of bacteria on milk and maintaining lactic acid bacteria. Acid Reaction Alkaline Reaction Redox Reaction Principle of Litmus Milk Test Purpose of Litmus Milk Test Media Required This test utilises Litmus Milk ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Liverworts? Habitat of Liverworts Liverworts, being bryophytes, exhibit a preference for moist environments due to their susceptibility to desiccation. Their plant bodies lack complete protection against drying out, necessitating habitats that provide abundant moisture. Consequently, liverworts thrive in shady, humid areas where the soil remains consistently damp. Common habitats for liverworts include: Types ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Loa loa? Epidemiology of Loiasis Morphology of Loa loa Loa loa Life Cycle The life cycle of Loa loa is a complex process involving two hosts: humans as the definitive host and Chrysops flies as the intermediate host. The cycle begins with the transmission of the parasite through the bite of an infected ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Protista? – Protista Definition Different Locomotion organs of Protista Protists are a heterogeneous group of unicellular eukaryotic creatures with a vast array of movement techniques. Certain protists utilise flagella, cilia, or pseudopodia for locomotion. 1. Flagella Some protists have long, whip-like appendages called flagella that protrude from their surface. They are utilised for ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Types of locomotion Different species utilize distinct methods of movement, influenced largely by their body structure and ecological niches. The primary types of locomotion observed in fish include anguilliform, carangiform, and ostraciform locomotion, each characterized by specific movements and anatomical adaptations. Locomotion by body movements The locomotion of fish through body movements is a complex ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Loeffler Medium, a modified version of the 1887 Loeffler formula, is now called Loeffler Medium. Loeffler medium is a modified formula that Loeffler developed in 1887. It enhances primary and secondary isolation, and cultivates fastidious pathogenic microorganisms. After prolonged subculturing or prolonged incubation, Loeffler medium restores virulence as well as other identifying properties (microscopic/colonial). High serum levels are useful in determining organisms' proteolytic activity. It can also be used to demonstrate pigmentation and ascospores.

The history of the Lotka-Volterra predator-prey model can be traced back to the early 20th century. Alfred J. Lotka, an American mathematician and biophysicist, first proposed the model in 1910 in the context of autocatalytic chemical reactions. The model was essentially a logistic equation, initially derived by Pierre François Verhulst. In 1920, Lotka extended the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Lowenstein Jensen Medium (LJ Medium) is a highly selective medium. Solid media that are used to isolate as well as cultivation of Mycobacteria can be egg-based or Agar-based.

What is Lung? Location of Lungs The lungs are essential respiratory organs located symmetrically on either side of the thoracic cavity. Their specific positioning and anatomical features enable efficient gas exchange within the body. Structure of Lung The lungs are vital organs characterized by their roughly cone-shaped structure. They exhibit a unique anatomy that facilitates ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Lymph Nodes? Definition of Lymph Nodes Lymph nodes are small organs in the lymphatic system that filter lymph and play a critical role in the body’s immune response. Location of Lymph Nodes Size of Lymph Nodes The size of lymph nodes can vary depending on their location within the body. Here are some general guidelines ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Lymphocytes? Lymphocytes are a specialized type of white blood cell that plays a crucial role in the immune system’s adaptive response. They are the key mediators of both humoral and cellular immunity. Here are some important points about lymphocytes: Definition of Lymphocytes Lymphocytes are specialized white blood cells that are crucial for the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Lysine decarboxylase test relies on the capability of certain bacteria to degrade L-lysine into caverine after the release of carbon dioxide.

Lysine iron Agar (LIA), a differential medium, is used to test organisms' ability to deaminate or decarboxylate Lysine. Lysine deamination, an aerobic process, occurs in the media. Lysine decarboxylation, an anaerobic process occurring in the media's butt, is also known as Lysine decarboxylation. Edwards and Fife created LIA in 1961 in order to presumptively determine Salmonella species. This includes Salmonella arizonae that is lactose fermenting, which has been linked to foodborne gastroenteritis outbreaks.

What is the Lysine Iron Agar (LIA) Test? The solid medium Lysine Iron Agar (LIA) is indicated for use in qualitative techniques for the differentiation of microorganisms based on the generation of lysine decarboxylase and hydrogen sulphide. Purpose of Lysine Iron Agar (LIA) Test Principle of Lysine Iron Agar (LIA) Test Lysine Iron Agar Composition ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Lysogenic Cycle? Definition of Lysogenic Cycle The lysogenic cycle is a viral replication process in which a virus integrates its genetic material into the host cell’s genome, allowing it to remain dormant and propagate without immediately destroying the host. This dormant viral DNA, known as a prophage, can later be activated to initiate ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

LB is the most widely used bacterial culture medium but its roots lie in the area of genetics of bacteriophage. Guiseppi Bertani developed the LB recipe when he was trying to increase the amount of plaque that formed on an indicator strain of Shigella (Bertani 1952). As per Bertani, LB has been often misinterpreted to mean "Luria Broth", "Luria-Bertani" medium, or "Lennox Broth"; however the original acronym stood as "Lysogeny Broth" (Bertani, 2004). The agar version of the medium is identified as LA however, it is frequently called LB. While initially developed to study bacteriophage in addition to Shigella growth, LB subsequently became the most preferred medium to grow Escherichia bacteria and other species of the enteric.

Lysosomes are membranous, spherical sacs that are made up of enzymes. They are acidic hydrolase enzymes that are capable of digesting cellular macromolecules. The membrane of the lysosome helps keep its internal compartments acidic, and also separates the digestion enzymes and the cells' other components. Lysosome enzymes are created by the proteins of the endoplasmic reticulum , which is then enclosed in vesicles created by the Golgi system. Lysosomes are created by budding out of in the Golgi complex.

Lysosomes are membrane-boundand dense granular structures that contain hydrolytic enzymes that are responsible for digestion in extracellular and intracellular cells. The term "lysosome" is composed of two words "lysis" which means breakdown, and "soma" which means body. It is a crucial cell organelle, responsible for inter- and extracellular breakdown of various substances.

What is Lytic Cycle? Definition of Lytic Cycle The lytic cycle is a phase of viral reproduction wherein a virus infects a host cell, utilizes the cell’s machinery to replicate, and subsequently causes the cell to burst (lyse), releasing new virions to infect other cells. Bacteriophage(virus) Life cycle of bacteriophage Steps of the Lytic Cycle ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

MacConkey Agar is a selective and differentiated culture medium widely used to isolate of Gram-negative enteric bacteria. It is selective since it allows for the growth of gram-negative bacteria , and differentiating the bacteria that are gram-negative based on their metabolic process of lactose.

What is Macroevolution? Definition of Macroevolution Macroevolution refers to the large-scale evolutionary changes that occur above the level of species, involving the emergence of new taxa (genera, families, orders, etc.) and the diversification of life forms over long periods of time. It encompasses the study of patterns and processes that shape the biodiversity and relationships ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Macronutrients? The human organism is a complex system that relies on specific nutritional elements to ensure its proper functioning, growth, and maintenance. Within the realm of nutrition, there are two primary categories of nutrients that the body necessitates: macronutrients and micronutrients. This discourse will focus on the former, elucidating its significance, types, and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Macrophages? Definition of Macrophage A macrophage is a type of white blood cell found in the immune system, known for its ability to engulf and digest cellular debris, foreign substances, and pathogens. It plays a crucial role in both innate and adaptive immunity, aiding in defense against infections and in tissue repair. Structure ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Magnetic Stirrer? Definition of Magnetic Stirrer A magnetic stirrer is a laboratory device that uses a rotating magnetic field to spin a stir bar immersed in a liquid, allowing for efficient mixing and stirring of solutions. Magnetic Stirrer Principle Types of Magnetic Stirrers Different kinds of magnetic stirrers have evolved to meet certain ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Class I MHC (Major Histocompatibility Complex) molecules? Cellular Distribution of Major Histocompatibility Complex I (MHC I) Major Histocompatibility Complex I (MHC I) Structure The majority of nucleated cells have an assortment of MHC class I proteins. The peptides bound by these MHC class I molecules are typically endogenous, or derived from the breakdown ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Major Histocompatibility Complex II (MHC II molecules)? Cellular Distribution of Major Histocompatibility Complex II (MHC II molecules) Structure of Major Histocompatibility Complex II (MHC II molecules) As stated previously, MHC class II molecules are nearly exclusively located on APCs. The peptides bound by MHC class II are produced from the breakdown of proteins ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Malaria? Classification of Malaria parasite Malaria, a significant global health challenge, is caused by parasitic organisms that belong to the genus Plasmodium. These parasites are classified under the Phylum Apicomplexa, which encompasses various protozoans known for their complex life cycles. A comprehensive understanding of the classification of malaria parasites is essential for educators ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The purpose of the malonate test is to see if the organism can get all of its energy from malonate.

Mammals (Mammalia) Mammals Scientific Classification Characteristics Of Mammals Mammals possess several distinct characteristics that set them apart from other classes of animals: These characteristics collectively define mammals and contribute to their unique position within the animal kingdom. Classification Of Mammals Mammalia is further classified into many taxonomic ranks. Mammalia is divided into three broad categories, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Mannitol Salt Agar (MSA) is utilized as a differential and selective medium to isolate and detect Staphylococcus aureus in clinical and non-clinical samples. It is recommended for identification and enumeration of coagulase positive Staphylococci that are present in milk, food as well as other specimens. MSA also promotes an increase in the number of particular group of specific bacteria, while limiting the growth of other bacteria.

What is Mantoux Test? Principle of Mantoux Test The Mantoux test operates on the principle of delayed-type hypersensitivity, specifically Type IV hypersensitivity. This test is designed to assess a person’s cell-mediated immunity against the bacterium Mycobacterium tuberculosis. To conduct this test, a substance known as Purified Protein Derivative (PPD) is used, which is essentially a ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Marchantia Marchantia is a genus of liverworts belonging to the family Marchantiaceae and the order Marchantiales. These liverworts are non-vascular plants that thrive in damp, shady environments. The thallus of Marchantia is differentiated into two distinct layers. The upper layer is photosynthetic and features a well-defined epidermis with pores. These pores facilitate gas exchange, crucial ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Thayer Martin Medium? Composition of Martin Lewis Agar Ingredients Gms/L Casein Peptone 7.5 Meat Peptone 7.5 Corn Starch 1.0 Potassium Phosphate, dibasic 4.0 Potassium Phosphate, monobasic 1.0 Sodium Chloride 5.0 Agar 10.0 Hemoglobin 10.0 Dextrose 1.5 Enrichment Bio-X 10 ml Antibiotics V.C.A.T 10 ml pH 7.2 +/- 0.2 at 25º C Enrichment Bio-X ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Mass Selection Method? Definition of Mass Selection Method Mass selection is a plant breeding method where a large number of plants with desirable traits are selected based on observable characteristics, and their seeds are pooled together to create a new variety. This method aims to improve the population’s uniformity for these traits while ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Mass Spectrometry (MS)? Definition of Mass Spectrometry (MS) Mass Spectrometry (MS) is an analytical technique used to identify the chemical composition of a sample by measuring the mass-to-charge ratio of its ions, resulting in a mass spectrum that reveals the molecular and structural information of the sample. Mass Spectrometry Principle Mass Spectrometry operates ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Trichrome stains, such as Masson’s Trichrome, derive its name from the three dyes utilised in the staining process. These three dyes are used to selectively stain muscle, collagen fibres, fibrin, and erythrocytes using acid-base chemistry. Initial placement of tissue slices in Bouin’s solution. As a mordant, Bouin’s solution links the dye to the specific tissue ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are mast cells? Definition of mast cells Mast cells are a type of immune cell found in connective tissue that are involved in allergic reactions, immune responses, inflammation, and wound healing. They contain granules rich in histamine and play a crucial role in the body’s defense against pathogens. Structure of Mast cell Types of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

This “Mayer’s hemalum solution - for microscopy” is used for human-medical cell diagnosis and serves the histological and clinico-cytological investigation of sample material of human origin.

What is McIntosh and Fildes’ Anaerobic Jar? Designed to provide an oxygen-free environment required for growing bacteria unable of surviving in the presence of oxygen, McIntosh and Fildes’ anaerobic jar is a specialist piece of laboratory equipment. Usually built from strong metal or glass, the jar has a firmly closing lid and has input and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Structure of Measles Virus Genome Structure of Measles Virus Epidemiology of Measles Virus Transmission of Measles Virus Replication of Measles Virus Pathogenesis of Measles Virus Clinical manifestations of Measles Virus Complications If not properly treated, measles can result in chronic complications such as pneumonia, encephalitis, etc. Other possible complications include: Laboratory diagnosis Methods of Measles ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Measurement of Bacterial Growth Why Should We Measure Bacterial Growth? The following are reasons we measure bacterial growth: Methods used for Measurement of Bacterial Growth There are many methods available to measure bacterial growth. Each one is discussed below. Cell Number count The cell number counting is done by two following methods; A. Direct Method ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

A microscope comes with an objective of 10X (low power) 45X (high power) and 100X (oil immersion). and the ocular lens with 5X, 10X and 15X. In general, an 10-X ocular lens is used in most cases. If an animal can be clearly seen with 10X ocular lens and 45X objective, this means that the size is 10x45, which is 450 times larger than the standard one. We don't know the exact measurement is ? It could be determined using an calibrated scale. Thus the calibration of all lenses (eyepieces) is performed.

Digestion is a complex process that allows our bodies to break down the food we consume into smaller, more manageable components. This crucial process enables the absorption of nutrients and energy necessary for our overall health and well-being. Digestion occurs through a combination of mechanical and chemical processes, working together harmoniously to ensure the efficient ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Antiviral Drugs? Antiviral drugs represent a category of therapeutic agents specifically designed to counteract viral infections. Viruses, which are obligate intracellular parasites, are a predominant cause of morbidity and mortality in humans, animals, and plants. Their pathogenicity ranges from self-limiting conditions to severe, life-threatening diseases. Unlike other microorganisms, viruses are devoid of the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Hormones are biochemical messengers produced by glands in the endocrine system and secreted into the bloodstream to regulate various physiological processes in the body. They play a crucial role in maintaining homeostasis and influencing a wide range of functions, including: Hormones exert their effects by binding to specific receptors on target cells, initiating a cascade ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Animal Behaviour? Mechanisms of Behaviour Mechanisms of behavior play a crucial role in understanding how animals respond to their environment. Here are some key mechanisms: Understanding these mechanisms helps researchers unravel the intricate ways in which behavior is shaped and regulated in animals. By studying innate behaviors, instincts, stimulus filtering, sign stimuli, and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Protein Synthesis Regulation? Protein synthesis regulation refers to the various mechanisms by which cells control the production of proteins. Protein synthesis is the process by which cells generate proteins, which are essential molecules for the structure, function, and regulation of various cellular processes. The regulation of protein synthesis allows cells to adjust protein ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Protein synthesis regulation is the intricate process by which cells control the production of proteins, which are essential for nearly all biological functions. This process involves the precise regulation of gene expression to ensure the synthesis of specific proteins at the right time and in the right amounts. Protein synthesis regulation plays a vital role ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The most commonly used gram-negative cocci of medical significance fall under the category of Neisseriaceae which comprises the genera Neisseria, Moraxella, Kingella, Acinetobacter etc. Medical Significance of Gram Negative Cocci Neisseria species  The genus Neisseria contains 12 species, two of which, N.meningitidis and N. gonorrhoeae, are commonly pathogenic in humans. Both may cause infections in ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Meiosis? Definition of Meiosis Meiosis is a specialized form of cell division in sexually reproducing organisms that results in four non-identical haploid cells (gametes) from a single diploid parent cell, ensuring genetic diversity and maintaining consistent chromosome numbers across generations. Types of Meiosis  Meiosis occurs in the germ cells of organisms that reproduce ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Root knot nematode? Life cycle of Meloidogyne incognita The life cycle of Meloidogyne incognita, a root-knot nematode, follows a highly specialized sequence of stages that allows it to effectively parasitize plant roots. The process begins with the egg and progresses through four juvenile stages (J1, J2, J3, J4) before reaching adulthood. Understanding these ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Combining a biological process with membrane filtration, a membrane bioreactor (MBR) wastewater treatment device separates particulates from treated water. It combines microfiltration or ultrafiltration membranes retaining biomass and pollutants with an activated sludge process—where microorganisms break down organic pollutants. MBRs successfully remove suspended particles, bacteria, and viruses by substituting membranes for traditional secondary clarifiers, therefore ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Membranes are made up composed of proteins, carbohydrates, and lipids that are held together with the help of binding forces.

In this article, we will learn about the Membrane filtration methods, definition, applications, advantages, disadvantages. Before heading towards Membrane Filtration, you have to understand what is filtration? Membrane filtration is a method of separating particles or molecules from a liquid or gas stream using a semi-permeable membrane. The membrane acts as a barrier, allowing some ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Lipids? What is Membrane Lipid? Characteristics of Membrane Lipids Membrane lipids have several key characteristics, including: Overall, the characteristics of membrane lipids are important for the structure, function, and regulation of cell membranes, and can have significant impacts on cellular processes and signaling pathways. Composition of Membrane Lipid 1. Glycerol‐based lipids Glycerol-based lipids ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Membrane Permeability? Cell Membrane Structure The cell membrane, often referred to as the plasma membrane or biological membrane, plays a crucial role in maintaining the integrity of the cell by separating its interior from the external environment. Its structure is vital for selective permeability and fluidity, allowing the cell to regulate its internal ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Membrane Protein? Membrane proteins are proteins that are embedded within or attached to the lipid bilayer of a cell membrane. These proteins play crucial roles in various cellular functions, including cell signaling, transport of molecules, and structural support. Location of Membrane Proteins Membrane proteins are connected with the cell membrane, the lipid bilayer ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

In the 1860s, Gregor Mendel, an Austrian monk, revolutionized the field of genetics with his foundational work on inheritance patterns. His experiments with pea plants led to the development of Mendelian inheritance, which is based on the concept that heredity operates through discrete units called genes. These genes, according to Mendel, act independently within an ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Mendel’s Law of Dominance? Mendel’s Law of Dominance is one of the foundational principles of genetics, formulated by Gregor Mendel through his experiments with pea plants. It asserts that when two homozygous organisms, each possessing contrasting traits for a specific character, are crossed, only one of the traits will appear in the first ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Mendel’s Law of Independent Assortment? Definition of Mendel’s Law of Independent Assortment Mendel’s Law of Independent Assortment states that genes for different traits are distributed to gametes independently of one another, meaning the inheritance of one trait does not affect the inheritance of another. Characteristics of Mendel’s Law of Independent Assortment Examples of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Mendel’s Law of Segregation? Mendel’s Law of Segregation Definition Mendel’s Law of Segregation states that alleles for a trait separate during gamete formation, ensuring each gamete carries only one allele, randomly inherited from the parent. What is segregation? Principle of Segregation and its Importance Characteristics of Mendel’s Law of Segregation Examples of Mendel’s ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Mendelian Inheritance/Mendel’s Laws of Inheritance? Genetics Terminology of Mendelian inheritance These terms clarify how genes operate, how traits are inherited, and the relationship between genetic information and observable characteristics. Download the Cheat sheet pdf Mendel’s Experiment Gregor Mendel’s experiments between 1856 and 1863 laid the foundation for our understanding of genetic inheritance. Using ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Menstrual Cycle? Definition of Menstrual Cycle The menstrual cycle is a monthly series of physiological changes in the female reproductive system, characterized by the maturation and release of an ovum from the ovaries and the preparation of the uterine lining for potential implantation of a fertilized egg. If fertilization does not occur, the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Meristematic Tissue? Definition of Meristematic Tissue Meristematic tissue is a type of plant tissue made up of actively dividing, undifferentiated cells that are responsible for the growth and development of new tissues and organs in plants. Characteristics of a meristematic tissue Structure of Meristematic Tissue Below is a detailed exploration of the structural ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Mesenchymal stem cell (MSCs) are also referred to as mesenchymal stromal cell (also known as medicinal signaling cells) are stromal cells with multi-potency which can transform into a variety of cells, including osteoblasts (bone cells) as well as the chondrocytes (cartilage cells) and myocytes (muscle cells) and Adipocytes (fat cells that contribute to the adipose tissue of the marrow).

What are Mesophiles? Habitat of Mesophiles Mesophiles are microorganisms that prefer moderate temperatures, typically thriving in environments ranging from 20°C to 45°C (68°F to 113°F). Their habitats are diverse and include a variety of natural and human-made settings. Adaptations of Mesophiles Mesophiles, organisms that thrive in moderate temperature environments, have developed specific adaptations that allow ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Definition of Mesophyll Cells The mesophyll cell is a group of highly differentiated cells which make up the mesophyll layer in plant leaves. The mesophyll layer in the leaves of dicotyledonous plant species is made up two types of cells: the spongy, and the palisade. This makes the mesophyll a site of photosynthesis. These are ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Mesosomes and chondrioids are foldable into invaginations of the plasma membranes of bacteria. They are made through chemical fixation techniques that are used to prepare samples for electron microscopy.

What is Metamorphosis? Metamorphosis is a biological process characterized by a profound transformation in the form, structure, or physiology of an organism as it progresses through distinct stages of its life cycle. It involves significant changes that are often irreversible and result in the emergence of a new developmental stage or life form. Stages of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Metaphase is a stage of the cell cycle that occurs in both mitosis and meiosis cell division. During this stage, individual chromosomes cannot be observed in the cell nucleus.

What is Metazoa? Characteristics of metazoa Metazoa, or multicellular animals, exhibit a range of distinctive characteristics that differentiate them from other life forms. Understanding these features provides insight into their complex biological organization and functional diversity. The following points outline the key characteristics of metazoans: Levels of body Organisation The levels of body organization in ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The most frequent tasks in the microbiology area is the determination of the weight or mass of desired substances, chemicals. Another important aspect to be considered is the preservation of substances. Thus, the powders, as well as other granular or paste-like substances should Chamber not be placed directly on the platform for weighing of the balance. It is recommended that glazed paper or a small weigh boats is the best choice to weigh. It is recommended to use glazed papers if the material is 15 grams or less needs to be weighed. A the weigh boat pan or small beaker must be utilized if you are weighing a larger amount. Because of the the light weight of glazed papers its weight is subject to a minimal. If the weight is less of 1 gram an electronic balance is recommended. The larger amount (above 1 grams) is not to be considered using electronic balances.

Discover essential techniques for the Maintenance and Preservation of Pure Cultures, focusing on bacterial and fungal preservation methods. This comprehensive guide covers best practices to ensure the longevity and purity of microbial cultures, making it an invaluable resource for researchers and laboratory professionals. The following points highlight the top 7 methods used for maintenance and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Food preservation methods have resulted in increasing the duration or shelf time of food items through using a variety of preservation methods.

Ethnobotany is a specialized field of biology dedicated to understanding the intricate relationships between human societies and plants. This discipline focuses on the knowledge and practices of indigenous and rural communities concerning plant use, encompassing their medicinal, nutritional, and cultural significance. By delving into these interactions, ethnobotany aims to uncover valuable plant-based resources that can ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Methyl Red (MR) Test? Objectives of Methyl Red (MR) Test The objectives of the Methyl Red (MR) Test can be outlined as follows: Principle of Methyl Red test The principle of the Methyl Red (MR) test is based on assessing the ability of an organism to produce and maintain stable acid end products through ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Methylene Blue Reduction Test also known as mbrt test. It is a qualitative test for milk, it used to check the quality of raw and pasteurized milk. The Methylene Blue Reduction Test is based on the fact that in the presence of oxygen the methylene blue solution forms blue color, and it will lose the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is HLA Complex? What is H-2 Complex? Detailed Organization Of The H-2 Complex 1. Murine MHC Class I Genes  2. Murine 2-Microglobulin Gene 3. Murine MHC Class Ib Genes  4. Murine MHC Class II Genes  5. Murine MHC Class IIb Genes  6. Murine Non-MHC Genes in the MHC  7. Murine MHC Class III Genes ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Major Histocompatibility Complex (MHC Molecules)? Definition of Major Histocompatibility Complex (MHC Molecules) The major histocompatibility complex (MHC) molecules are a set of cell surface proteins encoded by a cluster of genes that play a crucial role in intercellular recognition and immune responses. They present antigens derived from self-proteins or pathogens on the cell ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The Minimum Inhibitory Concentration (M.I.C.) of antimicrobial drugs against bacteria and the detection of resistance mechanisms can be found with the help of a MIC Test Strip, a quantitative assay.

Various sorts of positive and negative interactions between microorganisms and plants/animals have been described previously. Similar to humans, microorganisms communicate with one another and result in both beneficial and detrimental connections. In this context, the following interactions and interrelationships have been discussed: 1. Symbiosis between Alga and Fungus (Lichens) Classification Based on the nature of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Microbe-Plant interaction Plants are immobile, but they are continuously subjected to both biotic and abiotic stress. Constant warfare exists between harmful microorganisms and the host plant, with the outcome determining resistance or disease. Plants exude a variety of organic substances, resulting in a nutrient-rich environment that is conducive to microbial growth. Therefore, plants are highly ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Microbial Control Methods Types of Microbial Control Methods There are present four distinct methods which are used to control the growth of microbes such as; Different terms used in Microbial Control Methods The following terms are used to describe the processes and chemical agents employed in controlling microorganisms. What is Sterilization? What is Disinfection? What ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is cellulose? (C6H10O5)n Cellulose Molecular Weight/ Molar Mass 162.1406 g/mol Density 1.5 g/cm³ Appears White powder Melting Point 260–270 °C Properties of cellulose Structure of cellulose Commercial applications of cellulose What are cellulases? Factors affecting cellulose degradation Microorganisms involved in cellulose degradation/cellulolytic microorganisms Cellulose degradation is primarily carried out by cellulolytic microorganisms, which are ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is chitin? Structure of chitin What are Chitinases? Factors affecting chitin degradation Chitin degradation can be influenced by several factors, including: Microorganisms Involved in Chitin Degradation Chitin, a complex polysaccharide found in the cell walls of fungi, insects, and other invertebrates, is an important source of carbon and nitrogen for many microorganisms. Several types ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Hemicellulose is a complex carbohydrate that is found in plant cell walls. It is a heterogeneous mixture of polysaccharides comprising, among others, xyloglucans, xylans, and glucomannans. In contrast to cellulose, which consists of long chains of glucose molecules, hemicellulose is composed of a variety of sugar molecules, including xylose, arabinose, mannose, galactose, and glucuronic acid. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is lignin? Structure of lignin Biological function of lignin Factors affecting lignin degradation The degradation of lignin is influenced by a variety of factors. Some of the important factors that affect lignin degradation are: Lignin-degradating Microorganisms The biological breakdown of lignin is an extremely crucial component of the intricate carbon and oxygen cycle that ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Pectin is a carbohydrate that occurs naturally in plant cell walls. Long chains of galacturonic acid molecules are joined together to form this complex polysaccharide. Apples, citrus fruits, and berries are good sources of pectin since it is a natural gelling factor in food. Pectin’s gel-forming properties make it ideal for use in the preparation ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Food spoilage is the result of a metabolic process which causes food products to become unpalatable or inedible for human consumption because of changes in the sensory attributes.

Microbial interaction is a biological interaction in which the effect of microorganisms on other biotic components of an ecosystem can be investigated. Microbiology is the study of microorganisms, and microbial ecology is the study of microbial interactions within an ecosystem. Positive and negative microbial interactions are possible, and microbes can affect (positively or negatively) other ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Microbial spoilage of beverages poses a significant challenge in the beverage industry, as it can lead to the degradation of taste, quality, and safety of the products. Beverages, apart from water, encompass a wide range of drinkable liquids, including hot drinks, milk drinks, soft drinks, and alcoholic beverages. These beverages can be further classified into ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Canning is a highly regarded method for packaging food, ensuring its long-term storage and preservation. Typically, food is packed into metal containers and subjected to appropriate heat treatments, the specifics of which vary depending on the type of food being canned. While the incidence of food spoilage in cans is generally low, there is always ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Contamination of Fish and Other Seafoods Contamination of fish and other seafood can occur through various factors throughout the harvesting, handling, and processing stages. Understanding these potential sources of contamination is crucial for ensuring the safety and quality of seafood products. Here are some key factors that contribute to the contamination of fish and other ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Microbial Spoilage of Milk and Milk Products? Contamination Source for Spoilage of Milk and Milk Products Contamination sources for the spoilage of milk and milk products can originate from various points within the production and processing chain. Here are some key sources of contamination: Spoilage of milk Spoilage of milk refers to the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Microbodies? Historical Microbodies: Structure And Types Peroxisomes Structure of Peroxisomes Functions of Peroxisomes  Peroxisomes have been found to engage in two types of biochemical processes: 1. Hydrogen peroxide metabolism H2O2and aging 2. Glycolate cycle Photorespiration CH2OH. COOH + O2 → CHO – COOH + H2O2  CHO — COOH + H2O2 → HCOOH + ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The oxidase enzyme is a key factor in distinguishing Staphylococcus from Micrococcus, and the Microdase Disk is a reagent-impregnated disc recommended for use in qualitative procedures.

What is Microevolution? Definition of Microevolution Microevolution refers to small-scale changes in allele frequencies within a population over a relatively short period of time, driven by mechanisms such as mutation, selection, gene flow, and genetic drift. Causes of Microevolution 1. Mutation 2. Selection 3. Genetic drift 4. Gene flow Difference between microevolution and macroevolution Microevolution ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Microfilaments? Definition of Microfilaments Microfilaments, or actin filaments, are slender protein fibers that form a vital part of a cell’s cytoskeleton, contributing to cell shape, movement, and structural support. Distribution of Microfilaments Chemical Composition of Microfilaments (Structure of Microfilaments) Associated Proteins with Microfilaments The proper formation and regulation of actin filaments, also known ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Microinjection? Definition of Microinjection Microinjection is a precise technique used to introduce DNA or other genetic materials directly into a cell using a micropipette or fine glass needle. It is widely employed in genetic engineering, genome editing, and various biomedical research areas. Principle of Microinjection Microinjection operates on the fundamental principle of directly ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Microorganism? Definition of Microorganism A microorganism, or microbe, is a tiny living organism that is invisible to the naked eye and can exist as single-celled entities or colonies of cells. Discovery of Microorganisms Microorganisms, despite their minuscule size, have had a profound impact on our understanding of life and disease. The journey of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Chemical reactions that produce sensual changes that are offensive in food are controlled by a wide range of microbes that utilize food as a source of carbon and energy source. The organisms that cause these changes comprise prokaryotes (bacteria) as well as single-celled organisms that lack defined nuclei and organelles, as well as eukaryotes unicellulated (yeasts) as well as multicellular (molds) organisms that possess organelles and nuclei.

What is a micropipette? A micropipette is a precision laboratory instrument designed to measure and transfer extremely small volumes of liquid, typically ranging from 0.1 microliters to 1,000 microliters. Commonly used in molecular biology, chemistry, and medical labs, it operates like a highly accurate eyedropper, enabling researchers to handle samples with meticulous control. The device ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Microprojectile Bombardment? Definition of Microprojectile Bombardment Microprojectile bombardment, also known as biolistics or gene gun delivery, is a method used to introduce foreign genetic material into cells or tissues by accelerating microscopic particles coated with the desired DNA, RNA, or proteins at high velocities, facilitating direct gene transfer. This technique is commonly employed ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Micropropagation? Micropropagation Definition Micropropagation is a method of rapidly multiplying plants by growing plant tissues, typically from the apical meristem, in sterile, controlled conditions to produce genetically identical clones. It is used for large-scale plant production, crop improvement, and maintaining genetic uniformity. Stages of Micropropagation – Steps of Micropropagation Micropropagation is a technique used ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

A microscope condenser is an integral optical component in the realm of microscopy, designed to focus and direct light onto the specimen being examined. This specialized lens system is strategically positioned beneath the microscope stage, a placement crucial for optimal illumination. The primary function of the condenser is to gather light from the microscope’s light ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Ever peered through a microscope and marveled at the microscopic universe it unveils? It’s like being Alice in her Wonderland, but instead of falling down a rabbit hole, you’re diving into the magical world of cells, bacteria, and more. Yet, have you ever wondered about the parts of this wonder-making machine and their functions?  Let’s focus (pun ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Objects are magnified under compound microscopes are mounted onto microscope slides. Made from plastic or glass Slides measure approximately 1x3 inches in size and range from 1mm-1.2 millimeters thick.

What is Microsporogenesis? Definition of microsporogenesis Microsporogenesis is the process in which diploid microspore mother cells undergo meiosis to form haploid microspores, which eventually develop into pollen grains in plants. Where does microsporogenesis occur? Structure of Stamen Structure of microsporangium Process of Microsporogenesis in Plants In flowering plants, microsporogenesis is the process by which precursors ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Hey, if you’re a student of microbiology then you’re familiar with the term Microsporum spp. but if you’re from another field I don’t think you’re familiar with the term. If you are familiar then let me know in the comment section.  Now, let me explain you in a brief; There are some skin infections in ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

A microtome is a scientific instrument used to cut very thin slices of material, typically for use in microscopy. The material being sliced can be a variety of things, including biological tissue, plant specimens, or materials for industrial or electronic purposes. The microtome works by holding the material in place and then moving a blade ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Microtubules Definition (What are microtubules?) Occurrence of Microtubules Microtubules Structure Chemical Composition of Microtubules Intracellular Organization of Microtubules Microtubule-Associated Proteins (MAPs) Microtubule Organizing Centres (MTOCs)  Assembly and Disassembly of Microtubules  Function of Microtubules Microtubules serve multiple purposes in eukaryotic cells, including the following: 1. Mechanical function 2. Morphogenesis 3. Cellular polarity and motility 4. Contraction ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Microvilli are tiny, finger-like projections found on the surface of epithelial cells throughout the body, particularly in the small intestine. These structures significantly increase the surface area of the cells, enhancing their ability to absorb nutrients and other substances. The primary functions of microvilli include facilitating nutrient absorption, aiding in the process of fertilization, supporting ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Over the years, many media have been developed for mycobacteria cultivation. Early ones included egg-based formulations such as Lowenstein-Jensen Medium or Petragnani Medium. Later, Dubos, Middlebrook and Middlebrook created a variety of formulations that contained oleic and albumin as key components. These ingredients protect Mycobacterium against toxic agents and allow for the growth and development of tubercle bacteriailli. Cohn and Middlebrook improved the formulations of oleic acids-albumin agar to achieve a faster and more luxurious growth of Mycobacterium strains.

What is Bird’s Migration? Why do Birds Migrate? – Reason for migration in birds Factors Influencing Migration Stimulus: What are Migratory Species? Migratory species are defined as wild animals, including birds and mammals, whose populations or specific geographic portions of their populations regularly and predictably cross national jurisdictional lines. Here are some key points about ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Fish migration? Fish migration is the active, regular movement of fish populations from one place to another, often over long distances and various environments. This behavior is critical to the survival of fish and is a function of varied ecological, environmental, and biological factors. Fish migration is specific to different fish species, ranging ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Pasteurisation was developed by an French Scientist known as Louis Pasteur during the nineteenth century. Pasteur realized that warming milk up to a high temperature , then cooling it quickly prior to packaging or bottling could preserve it for a longer time.

illon's test can be described as an analytical test for the identification that the amino acid tyrosine which is the sole amino acid with the phenolic group.

What is Mineral Nutrition? Criteria for Essential Minerals in Plants The following points outline the criteria used to determine the essentiality of an element: Criteria for Determining Essential Elements Types of Essential Nutrients Below are the primary types of essential nutrients: Essential Mineral Elements in Plants Below is a detailed explanation of these categories and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Micro-RNAs (miRNAs) are a family of non-coding RNAs (ncRNAs) that regulate gene expression post-transcriptionally. Since their discovery in 1993, they have been the topic of extensive research due to their role in numerous crucial biological processes. Unlike other noncoding RNAs, microRNAs are created from transcriptional units that are processed by a particular group of endonucleases. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Missense Mutation? Definition of Missense Mutation A missense mutation is a type of point mutation in which a single nucleotide change results in the substitution of one amino acid for another in the protein sequence, potentially altering the protein’s function. Types of Missense Mutation There are two Types of Missense Mutation; Causes of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Mites? Definition of Mites Mites are tiny arachnids, usually less than 1 mm in size, that belong to the Acariformes and Parasitiformes orders. They live in various environments, such as soil, water, plants, and animals, and can be decomposers, predators, or parasites. While most mites are harmless, some can cause allergies or transmit ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Mitochondria? Definition of Mitochondria Mitochondria are membrane-bound organelles in eukaryotic cells responsible for producing adenosine triphosphate (ATP), the primary energy currency of the cell. Organization and Distribution Mitochondria, often termed the cellular powerhouses, are intricate organelles that play a pivotal role in energy production. Their organization and distribution within cells are both diverse ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

HSP heavy strand promoter LSP light strand promoter MGME1 mitochondrial genome maintenance exonuclease 1 mtSSB mitochondrial single-stranded DNA-binding protein NCR noncoding region TAS termination-associated sequence What is Mitochondrial DNA (mtDNA)? Structure of Mitochondrial DNA (mtDNA) General Features of the Mitochondrial Genome Factors for mtDNA replication  Mitochondrial DNA (mtDNA) replication is a critical process distinct from ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Mitochondrial transporter The mitochondria contain different types of transporter proteins within the intermembrane. These transporters transfers ADP, Pi, and H atom(Substrate) from Inter membrane space to matrix and ATP (Product) from matrix to inner membrane space. There are presently three transporter protein in the inner mitochondrial membrane such as; Adenine Nucleotide Translocase It is an ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Mitosis? Definition of Mitosis Mitosis is a cellular process in which a single eukaryotic cell divides to produce two genetically identical daughter cells, each maintaining the same number of chromosomes as the parent cell. Features of Mitosis In essence, mitosis is a meticulously regulated process that ensures genetic consistency, facilitates growth, and aids ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Mode of action of antibiotics Antibiotics are used in medicine and agriculture to prevent bacterial infection. The mode of action of antibiotics is varied based on the types of antibiotics. Some of them act by limiting the growth of bacteria and some of them act by killing the bacterial cell by inhibiting cell wall synthesis. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Types of Membrane Transport Membrane transport refers to the movement of molecules across cell membranes. This process is essential for maintaining cellular homeostasis and involves multiple mechanisms, which can be classified based on energy requirements. The types of membrane transport are broadly categorized into passive and active transport. Passive transport It is a sort of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Energy Flow in Ecosystem Energy flow in an ecosystem refers to the movement of energy through various trophic levels, from producers to consumers, and eventually to decomposers. It represents the transfer of energy from one organism to another and is a fundamental process that sustains life within an ecosystem. Here are some key points about ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is contraceptive? Definition of contraceptive A contraceptive is a method or device used to prevent pregnancy by intentionally interfering with the natural process of reproduction. Modern Contraceptive Technologies There are various modern contraceptive technologies available to individuals and couples for effective family planning. Here is a list of commonly used modern contraceptive technologies: Disadvanatages ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Protists are a varied category of eukaryotic creatures that are unicellular or multicellular, and can be free-living or parasitic. They have a simple cellular structure, with a nucleus and other membrane-bound organelles, and are capable of a wide variety of metabolic operations, including as photosynthesis, digesting, and locomotion. Protists are found in nearly all habitats ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

In this article we will learn about different Modes of Reproduction and Pollination in Crop Plants. Modes of Reproduction in Crop Plants Crop plants exhibit two primary modes of reproduction: asexual and sexual. Each mode has distinct mechanisms and implications for plant breeding and agriculture. A. Asexual Reproduction Asexual reproduction does not involve the fusion ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Modified Kirby-Bauer disc diffusion test is a standard method that can be used as a regular method to assess the susceptibility test to a bacterial isolate in the clinical laboratory. 

Thayer and Martin have reported improvement of the Chocolate Agar formulation that contained antimicrobics vancomycin and colistin, Nystatin. These ingredients were added to limit the growth of contaminants, inhibit the development of the saprophytic Neisseria sp. and to enhance the development of the pathogenic Neisseria. Martin and Lester have added an antibiotic, trimethoprim, which made them more selective. They also demonstrated to be effective in the fight against Proteus spp. Trimethoprim lactate refrains Proteus swarming. The resultant medium is known as Modified Thayer Martin. It's a suitable and rich medium to isolate as well as cultivation of the Neisseria species. from mixed flora and suppression of other Gram-negative diplococci and gram-negative bacilli yeast and other gram-positive organisms.

What is Mohr Pipette (graduated pipette)? Parts of Mohr Pipette (graduated pipette) A Mohr pipette, widely used in laboratories for liquid measurement, consists of several components designed to enable accurate and efficient operation. Below are the main parts and their functions: How to Use a Mohr Pipette (graduated pipette) A Mohr pipette is commonly used ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Of all the options to sterilize (killing or eliminating all microorganisms, which includes the spores of bacterial growth) moist heat that is saturated steam with pressure has been the most frequently utilized and most reliable method. Moisture has more penetrating power than dry heat, and at a certain temperature, causes a greater reduction in the quantity of live microorganisms. Steam sterilization is safe cheap, low-cost, quickly microbicidal, as well as sporicidal. It quickly heats and penetrates into fabrics.

The early detection of diseases is crucial for effective treatment, and molecular diagnostics serves as a pivotal tool in this regard. This term encompasses a range of diagnostic techniques that assess an individual’s health at a molecular level. Specifically, molecular diagnostics focuses on the identification and quantification of genetic sequences—often referred to as biomarkers—found in ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Molecular biology is a branch of biology that focuses on understanding biological processes at the molecular level, particularly the interactions between various cellular systems involving DNA, RNA, and proteins. It combines principles from genetics, biochemistry, and cell biology to explore the mechanisms that govern the function and regulation of genes and how they translate into ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Molecule? A molecule is a fundamental unit in the realm of chemistry, representing a group of two or more atoms bound together by chemical bonds. These bonds arise due to interactions between the electrons of the participating atoms. Delving deeper into the nature and significance of molecules: In essence, molecules are the building ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

This is a test that is common for all carbohydrate larger than the tetroses. The test works on the basis that pentoses as well as hexoses can be dehydrated using conc. sulfuric acid, resulting in furfural or hydroxyl-methyl furfural or hydroxyl methyl furfural. These compounds condense with a-naphthol to create a purple condensation product. Molisch’s ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is monkeypox virus? Classification of Monkeypox Virus Morphology of Monkeypox Virus/Structure of Monkeypox Virus Genome Structure of Monkeypox Virus Genome Structure Replication Cycle of Monkeypox Virus The cycle of replication for poxviruses is different from that of other DNA viruses, is carried out in the cytoplasm within the cell that hosts them. Poxviruses infiltrate ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Monoclonal Antibodies? Definition of Monoclonal Antibodies Monoclonal antibodies are artificial antibodies produced in a laboratory by fusing immune cells with cancer cells. They are highly specific in targeting and binding to specific antigens on cells, making them valuable tools in medical research and treatment of diseases, including cancer. Types of monoclonal antibodies based ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Monocot Flower? Characteristics of Monocot Flower Monocot flowers, belonging to the group of flowering plants known as monocotyledons, exhibit several distinctive characteristics that set them apart from dicot flowers. Here are the key features of monocot flowers: What is Dicot Flower? Characteristics of Dicot Flower Dicot flowers, found in the group of flowering ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Monocot Leaves? Characteristics of Monocot Leaf Monocot leaves exhibit a range of distinct characteristics that contribute to their unique structural and functional attributes. Understanding these features is essential for students and educators who seek to grasp the differences between monocots and other plant types, such as dicots. What are Dicot Leaves? Characteristics of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Monocot Root? What is Dicot Root? Characteristics of Monocot and Dicot Roots Monocot and dicot roots exhibit distinct structural and functional characteristics that differentiate them from each other. Here’s a comparison based on key features: Characteristics of Monocot Roots: Characteristics of Dicot Roots: Structure of Monocot and Dicot Root The structure of both ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Monocot Seed? What is Dicot Seed? Characteristics of Monocot and Dicot Seeds Below is a detailed comparison based on key traits: Structure of Monocot and Dicot Seed The structure of monocot and dicot seeds can be understood by examining their major components. These components serve distinct roles in the development and protection of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The essential component of sexual reproduction in plants is the seed. It is the end product of sexual reproduction and is only found in angiosperms or gymnosperms. Gymnosperms do not produce fruits or flowers, so their seeds are “naked”. Angiosperms on the other hand, have mature ovules which develop within the fruit after fertilization. Angiosperms ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Monocytes? Definition of Monocytes Monocytes are a type of white blood cell that serves as an immune effector cell. They are part of the innate immune system and play a critical role in phagocytosis, antigen presentation, and cytokine secretion. Monocytes differentiate into macrophages and dendritic cells, contributing to immune defense against pathogens and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is a Monohybrid Cross? A monohybrid cross is a genetic cross between individuals who differ in only one trait or allele set. It is the study of inheritance patterns for a single trait, typically with a focus on a single gene with two opposing alleles. In a monohybrid cross, two heterozygous (having two distinct ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Monosaccharides? Definition of Monosaccharides Monosaccharides are single sugar molecules that are the basic units of carbohydrates. They are simple sugars with a variety of structures and functions in biological systems. Vant Hoff’s Rule of ‘n’ The number of imaginable isomers of any delivered compound relies upon the digit of the molecule’s asymmetric carbon ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are bacteria? Characteristics Features of bacteria Bacteria, as microscopic entities, exhibit a unique assemblage of features that distinguish them from eukaryotic organisms, fundamentally setting them apart within the vast expanse of biological taxa. These features are emblematic of their evolutionary lineage and functional adaptability, encapsulating their cellular architecture, metabolic pathways, and ecological roles. Size ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Moss? Definition of Moss Mosses are small, non-vascular plants belonging to the division Bryophyta that typically form dense green mats or clumps in damp or shaded environments, lacking seeds and reproducing through spores. Habitat of Mosses Mosses, representing a diverse group within the plant kingdom, exhibit a wide range of habitat preferences. Their ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Mosses (Bryopsida)? Definition of Mosses (Bryopsida) Mosses (Bryopsida): Bryopsida, or mosses, are a class of non-vascular plants comprising around 15,000 species. Characterized by jointed teeth in their spore capsules, they reproduce through spores and thrive in damp, shady environments. Mosses play crucial roles in soil formation, moisture retention, and ecological habitats. Habit and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Bacterial Diseases The worldwide issue of deadly and infectious infections due to bacteria are fast becoming one of the biggest medical and scientific concerns at this moment.

What is Most Probable Number (MPN) Test? Definition of Most Probable Number (MPN) Test The Most Probable Number (MPN) test is a statistical method used to estimate the concentration of microorganisms, particularly indicator organisms, in a sample by analyzing positive and negative reactions in a series of tests. It is commonly employed in water quality ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Motility? Definition of Motility Motility refers to the ability of an organism or cell to move autonomously by utilizing metabolic energy. Types of Motility Motility, a fundamental biological phenomenon, is exhibited through various mechanisms across different organisms. The mechanisms underlying motility are intricate, reflecting the evolutionary adaptations of organisms to their environments. Here, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is mouth pipette​? Principle of Mouth Pipette​ The working principle of mouth pipetting is based on the creation of a pressure differential, which allows for the movement of liquid into a pipette through suction. This method involves the use of a glass capillary tube, where one end is submerged in the liquid to be ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is plant Movement? Classification of plants Movements Most of movements exhibited by plant can be classified as – A. Movement of locomotion The concept of locomotion encompasses the various ways in which organisms, including plants, move from one location to another. In plants, locomotion can occur at different levels—ranging from the movement of the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is mRNA? This sort of RNA acts by transferring genetic material into ribosomes and transmitting instructions regarding the types of proteins that body cells require. Based on their roles, these RNA types are known as messenger RNA. Therefore, mRNA plays an essential function in the transcription process or during protein synthesis. History of mRNA ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

mRNA Degradation in Prokaryotic Cells Bacterial Ribonucleases Bacteria use a vast arsenal of ribonucleolytic enzymes to degrade messenger RNA (mRNA), many of which are exclusive to certain bacterial clades. Endoribonucleases RNase E, RNase Y, and RNase III are the most prominent endonucleases implicated thus far in bacterial mRNA turnover. Exoribonucleases In order to supplement the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Mucic acid test tests for lactose and galactose. The sugar is transformed into carboxylic acid using hot nitric acid. In order to produce dicarboxylic acids, aldoses are oxidized on each end of the open ring form. Chain fragmentation triggers ketoses to oxidize and produce a range of dicarboxylic acid. Galactraric acid (mucic acid) created by ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Mucosa Associated Lymphoid Tissues (MALT)? Features of Mucosa Associated Lymphoid Tissues (MALT) Mucosa-associated lymphoid tissue (MALT) exhibits several distinctive features: MALT’s unique features highlight its role in mucosal immunity, allowing it to mount specific immune responses at the mucosal surfaces of different tissues. By generating and secreting IgA antibodies and facilitating various immune ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Mueller Hinton Agar (MHA)? Why MHA is used for antibiotic susceptibility testing (AST)? Mueller Hinton Agar (MHA) is commonly used for antibiotic susceptibility testing due to several key reasons: Mueller Hinton Agar (MHA) Principle The principle of Mueller Hinton Agar (MHA) revolves around its composition and the controlled levels of various components to ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Multichannel Pipette? Key Features of Multichannel Pipettes Multichannel pipettes are invaluable in laboratory settings, allowing users to transfer liquids across multiple channels simultaneously. Their design and functionality provide significant advantages for a range of tasks, particularly when handling large numbers of samples. Below are the core features that make multichannel pipettes essential tools ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Multiphoton microscopy is a cutting-edge imaging technique widely used in biology and medicine to study living tissues with minimal harm. Instead of relying on single high-energy photons like conventional microscopes, this method harnesses multiple low-energy photons that act together to produce a fluorescent signal. The trick lies in timing—when these photons strike a molecule simultaneously, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Multiple Alleles? Definition of Multiple Alleles Multiple alleles are different forms of the same gene that exist at a specific locus on homologous chromosomes, resulting in more than two possible variations of that gene within a population. While an individual organism can have only two alleles for a gene, multiple alleles contribute to ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The predominant clinical manifestation of mumps is parotitis-related salivary gland enlargement. This symptom is so distinctive that the disease was immediately distinguished from other pediatric illnesses that cause skin rashes. In the fifth century B.C., Hippocrates identified measles as a distinct disease. Additionally, he mentioned orchitis as a common complication of mumps. In some cases ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Muscle? Definition of Muscle A muscle is a specialized tissue in animals that contracts to produce force and movement, composed of fibers containing proteins that enable contraction. Structure of Muscle Types of Muscle Muscles, integral to the vertebrate anatomy, are categorized into three primary types based on their structural and functional attributes: skeletal, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Muscle Cell? Definition of Muscle Cell A muscle cell, or myocyte, is a specialized animal cell designed for contraction, facilitated by organized motor proteins, primarily actin and myosin. These cells can be found in various forms, including skeletal, cardiac, and smooth muscle tissues, each serving distinct functions within the body. Structure of Muscle ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Muscular Tissue? Definition of Muscular Tissue Muscular tissue is a specialized type of tissue found in animals that consists of muscle fibers capable of contracting and generating force, allowing for movement and control of body functions. Properties/Characteristics of Muscular Tissue Muscular tissue possesses several distinct properties that enable its functions and contribute to ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Mutarotation? Properties of Carbohydrates Carbohydrates exhibit various properties influenced by their structural arrangements. Understanding these properties is essential to grasp concepts like mutarotation and distinguish between different isomers. Anomers, optical rotation, polarized light, optical activity When a compound is optically active, it means it has the capability to rotate the plane of linearly ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Mutation? Definition of Mutation Mutation is a permanent change in the DNA sequence of a gene or chromosome, which can result from errors in replication or environmental factors and can affect an organism’s traits. Terminology of Mutation Characteristics of Mutation Classification and types of Mutation Causes and Mechanisms of Mutation Understanding the causes ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Mutations play a significant role in crop improvement by introducing genetic variability, which can be harnessed to develop new and improved crop varieties. A mutation is defined as a sudden and heritable change in an organism’s characteristics. This definition implies that the change must be inheritable, though it does not specify the genetic mechanisms underlying ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Mutualism? Mutualism is simply a partnership between two animals that benefits both. This link may exist either inside the species or between species. The organisms involved in this connection are known as symbionts. All living species, including humans, animals, birds, plants, and microbes such as bacteria, viruses, and fungi, exhibit interdependence. Mutualism resembles ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Mycobacterium leprae? Scientific classification of Mycobacterium leprae Domain: Bacteria Phylum: Actinomycetota Class: Actinomycetia Order: Mycobacteriales Family: Mycobacteriaceae Genus: Mycobacterium Species: M. leprae Geographical Distribution and Habitat of Leprosy Leprosy is a disease with a varied global presence. It is most commonly found in specific regions, with a significant concentration in Southeast Asia, Africa, and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Classification of Mycobacterium tuberculosis The genus Mycobacterium comprises over 70 species, several of which are pathogenic to humans. The most notable among these is Mycobacterium tuberculosis, the bacterium responsible for tuberculosis (TB). Understanding the classification of M. tuberculosis and its related species is crucial for medical research and public health. Culture of Mycobacterium tuberculosis The ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Mycology? Definition of Mycology Mycology is the scientific study of fungi, encompassing their genetic, biochemical, and ecological attributes, as well as their classification, benefits, and potential threats to other organisms. History of Mycology Careers Options in Mycology Mycology, the study of fungi, offers a plethora of career opportunities due to the diverse roles ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Mycoplasma pneumoniae? Domain: Bacteria Phylum: Mycoplasmatota Class: Mollicutes Order: Mycoplasmatales Family: Mycoplasmataceae Genus: Mycoplasma Species: M. pneumoniae Geographical Distribution and Habitat of Mycoplasma pneumoniae Infections M. pneumoniae infections are found worldwide, with varying rates of occurrence depending on the region. This bacterium is a leading cause of community-acquired pneumonia, contributing to up to 20% ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Mycorrhiza? Definition of Mycorrhiza Mycorrhiza refers to the symbiotic association between specific fungi and plant roots, where the fungus aids in nutrient and water uptake for the plant, and in return, the plant provides the fungus with essential nutrients produced through photosynthesis. Types of Mycorrhizae Mycorrhizae represent diverse symbiotic associations between fungi and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Myeloperoxidase is a lysosomal enzyme that can be found in the azurophil granules of neutrophils and monocytes.

What is Myocardium? Definition of Myocardium The myocardium is the thick, muscular middle layer of the heart wall, located between the epicardium and endocardium. It is primarily composed of cardiac muscle cells (cardiomyocytes) that enable the heart to contract and pump blood throughout the body. Layers in the Walls of the Heart The heart, a ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Nagler's Reaction or Lecithinase test is a test in biochemistry used to detect organisms that produce the phospholipases (lecithinases) e.g. Clostridium perfringens. Its alpha (a) toxin from C. perfringens exhibits the phospholipase enzyme activity, which aids in the distinction between C. perfringens and the other Clostridium species that generate the enzyme lecithinase (C.baratti, C.absonum, C.bifermantans, C.sordelli, and C.novyi) through neutralization of lecithin C activity with an antitoxin.

DNA has long been regarded as a critical component in gene therapy. A recent discovery, however, has thrown light on a strange type of DNA that persists in its surrounding environment without any protein or lipid bonds. Because of its possible applications in gene therapy trials, this phenomenon, known as “naked DNA,” has piqued the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Native Polyacrylamide Gel Electrophoresis? Principle of Native Polyacrylamide Gel Electrophoresis (PAGE) An analytical technique called SDS-PAGE (Polyacrylamide Gel Electrophoresis) separates protein mixture components according to size. The method is predicated on the idea that a charged molecule would migrate in an electric field toward an electrode of opposite sign. Since the mobility of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Natural Killer (NK) Cells? Definition of NK Cells NK cells, short for Natural Killer cells, are a type of lymphocyte that is part of the innate immune system. They have cytotoxic activity against virus-infected cells and stressed cells like tumor cells. NK cells can recognize and eliminate abnormal cells without the need for ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Natural Resources? Definition of Natural Resources Natural resources are materials and elements found in the environment, such as air, water, soil, plants, and minerals, that exist independently of human activity and are essential for sustaining life and supporting economic production. Types of Natural Resources Natural resources are categorized based on various criteria, such ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Natural Selection? Definition of Natural Selection Natural selection is the process by which organisms with traits better suited to their environment tend to survive, reproduce, and pass those beneficial traits to future generations, leading to gradual evolutionary changes in a population. History of Natural Selection Natural selection, the central concept of Darwin’s theory ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The National Center for Biotechnology Information (NCBI) is a part of the U.S. National Library of Medicine, which is itself a branch of the National Institutes of Health (NIH). It provides access to a wealth of information in the fields of biotechnology and biomedicine. Some key resources offered by NCBI include: NCBI’s resources are widely ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Necrosis refers to irreversible cell damage and subsequent cell death resulting from pathogenic processes. It is an uncontrolled cell death that leads to enlargement of the cell organelles, plasma membrane rupture and final lysis of the cell, and intracellular contents leaking into the surrounding tissue, resulting in tissue injury. Unlike programmed cell death known as ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The NEET exam, or National Eligibility cum Entrance Test, is an entrance examination in India for students aspiring to pursue undergraduate medical and dental courses such as MBBS (Bachelor of Medicine and Bachelor of Surgery), BDS (Bachelor of Dental Surgery), and BAMS, BSMS, BUMS, and BHMS (Ayurvedic, Siddha, Unani, and Homeopathic Medicine courses). It is ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Negative Feedback? Definition of Negative Feedback Negative feedback is a regulatory mechanism in biological systems where the final product of a process inhibits its own production, ensuring stability and homeostasis. Negative Feedback Mechanism Importance of Negative Feedback In summary, negative feedback is a cornerstone mechanism in both biological and man-made systems. Its importance ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

In negative staining method, an acidic dye is used known as India Ink or Nigrosin. When the bacterial cells are exposed to this stain, due to the presence of acidic nature it readily gives up a hydrogen ion (proton) and the chromophore. As a result, the dye becomes negatively charged, now the bacterial cell surface deflects the stain.

Negative staining is a method used to visualize viruses and other small particles under a microscope. In this method, a drop of the sample is placed on a flat surface and a small amount of a negatively charged stain is added to the sample. The stain surrounds the virus particle, but does not adhere to ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Neisseria gonorrhoeae? Morphology of Neisseria gonorrhoeae Neisseria gonorrhoeae is a Gram-negative bacterium that presents a distinctive morphology. It exhibits unique structural features that help in its identification and understanding of its pathogenic mechanisms. These structural features give N. gonorrhoeae the tools it needs to infect and persist in the human body, leading to ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Neisseria meningitidis? Geographical Distribution of Neisseria meningitidis Neisseria meningitidis, the bacteria responsible for meningococcal disease, is a global threat. However, its impact varies across different regions, with certain serogroups causing more significant outbreaks and epidemics than others. The distribution of this pathogen is not uniform, and the occurrence of cases is often influenced ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Nelson-Somogyi method can be used to quantify the reduction of sugar using arsenolmolibdat and copper reagents. The principle behind the Nelson Somogyi method is the quantity of deposro oxide deposits which react with arsenomolibdate, which reduces to molybdine blue. The blue hue is determined by as absorbance. The keto and aldehyde free groups are regularly ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Nematodes? Definition of Nematodes Nematodes are elongated, unsegmented, thread-like worms, found in various environments such as soil and water. They can be free-living or parasitic, affecting plants, animals, and humans. General Characteristics of Nematodes Nematodes, often referred to as roundworms, exhibit distinct morphological and physiological features that set them apart from other organisms. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Neo-Darwinism Theory? Neo-Darwinism is an integration of Charles Darwin’s theory of evolution by natural selection with Gregor Mendel’s theory of genetics. It arose from the recognition that Darwin had not adequately explained the existence of variations within species. In 1901, the Dutch botanist Hugo de Vries proposed the mutation theory of evolution, which ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Nephron? Definition of Nephron A nephron is the basic functional unit of the kidney responsible for filtering blood and producing urine. It consists of a glomerulus (a cluster of capillaries) and a tubule, which processes the filtrate by reabsorbing water and essential substances while excreting waste products. Types of Nephron Nephrons, the functional units ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Nervous System? Definition of Nervous System The nervous system is a complex network of cells and tissues that coordinates and regulates the activities of an organism by transmitting electrical signals between different parts of the body. Cells of the Nervous System Neurones Glial Cells Astrocytes Oligodendrocytes Microglia Ependymal cells Nervous System Structure and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The earthworm, a common annelid found in gardens and soil worldwide, possesses a simple yet effective nervous system that serves as a model for understanding basic neural functions in more complex organisms. Unlike vertebrates with centralized brains, the earthworm’s nervous system is segmented and decentralized, reflecting its elongated, cylindrical body structure. At the anterior end, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The nervous system of a frog is a complex structure that controls and coordinates the various functions and activities of the frog’s body. It can be broadly divided into two main parts: the central nervous system (CNS) and the peripheral nervous system (PNS). The nervous system of the frog is adapted for its amphibious lifestyle. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Nervous tissue? Definition of Nervous tissue Nervous tissue is the specialized tissue that makes up the nervous system. It is composed of neurons and glial cells, and its main function is to transmit and process electrical signals, allowing for communication and coordination within the body. Location of Nervous Tissue Characteristics Of Nervous Tissue ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Neuroglia? Definition of Neuroglia Neuroglia, or glial cells, are non-neuronal cells in the nervous system that provide support, insulation, and protection for neurons. They play crucial roles in maintaining homeostasis, facilitating communication, and responding to injury or disease within the central and peripheral nervous systems. Classification of Neuroglia Neuroglia, or glial cells, are ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Neuromuscular junction? Definition of Neuromuscular junction A neuromuscular junction is a specialized connection between a motor neuron and a muscle fiber, where signals from the nervous system are transmitted to the muscle, resulting in muscle contraction. Structure of a Neuromuscular Junction The structure of Neuromuscular junction can be broadly divided into three parts: ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Neuron? Definition of Neuron A neuron is a specialized cell in the nervous system that receives, processes, and transmits information through electrical and chemical signals. How Do Neurons Work? Neurons communicate through a combination of electrical impulses and chemical signals, ensuring efficient information transfer throughout the body. By facilitating the rapid transmission of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Neuronal Membrane? Components of Neuronal Membrane Cytosol and Extracellular Fluid The cytosol and extracellular fluid are essential environments for neuronal function, as they provide the medium for the movement of ions, which generate the electrical signals vital to neuron activity. The presence of water, along with ions dissolved in it, plays a critical ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Neuroscience? Neuroscience is the scientific study of the nervous system, with a central focus on the brain. It explores how the brain and the network of nerves function at both the cellular and system-wide levels. Neuroscience is a multidisciplinary field, integrating approaches from molecular biology, physiology, cognitive psychology, engineering, and artificial intelligence. The ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Neurotransmitters? Definition of Neurotransmitters Neurotransmitters are chemical messengers that transmit signals between neurons or from neurons to other target cells, such as muscle or gland cells, across synapses, helping regulate various functions in the nervous system. Properties of Neurotransmitter Below are key properties that define neurotransmitters and their role in neural communication. Types ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Neutralization Test? Principle of Neutralization  The neutralization principle is based on the understanding that certain antibodies or antitoxins can reduce or neutralize the various biological effects caused by enzymes, toxins, and viruses. There are two main types of neutralization tests: In both types of neutralization tests, the goal is to assess the ability ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Neutrophils? Neutrophils Definition Neutrophils are a type of white blood cell that plays a crucial role in the immune system’s defense against infections. They are highly mobile and act as phagocytes, engulfing and destroying bacteria and other harmful substances. Neutrophils are characterized by their multi-lobed nuclei and stainable cytoplasmic granules. They are part ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

NYC Agar Base medium was initially created by Fauer, Weisburd and Wilson at the New York City Department of Health to isolate the pathogenic Neisseria strains from human samples. NYC medium, designed primarily to isolate pathogenic Neisseria is also able to support the growth of mycoplasmas with large colonies or mycoplasmas T (Ureaplasma). It is a translucent medium, highly selective, allowing direct microscopic observations and presumed identification of mycoplasmas and Neisseria gonorrhoeae.

Next-Generation Sequencing (NGS) is a technology for high-throughput DNA and RNA sequencing. It allows for the rapid and simultaneous analysis of millions of DNA fragments, enabling comprehensive genomic studies such as genome sequencing, transcriptome analysis, and epigenetic profiling. NGS has revolutionized the field of genomics, providing a faster and more cost-effective way to study the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Next-Generation Sequencing (NGS)? Next-Generation Sequencing (NGS), also known as high-throughput sequencing, has revolutionized the field of genomics and molecular biology by allowing the sequencing of thousands to millions of DNA molecules simultaneously. It encompasses a range of different sequencing technologies, all aimed at producing large amounts of sequence data at a lower cost ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is the Ninhydrin Test? The ninhydrin chemical test is used for determining whether an analyte contains any amines or amino acids. In this test, ninhydrin (a chemical compound with the formula C9H6O4; IUPAC name: 2,2-dihydroxyindane-1,3-dione) is added to a test solution of the analyte. The formation of a deep blue color within the test ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Nipah virus (NiV) is a zoonotic virus, which means it can be transmitted between animals and humans. Fruit bats, often known as flying foxes, serve as the natural reservoir for NiV. The Nipah virus is also known to infect humans and pigs. NiV infection is related with encephalitis (brain swelling) and can result in mild ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Nitrate Reduction Test? Purpose of Nitrate Reduction Test Principle of Nitrate Reduction Test Reactions of Nitrate Reduction Test Use of Zinc powder Use of  A Durham tube Requirements Composition of Nitrate broth (medium) Ingredients Gms / Litre Peptic digest of animal tissue 5.000 Meat extract 3.000 Potassium nitrate 1.000 Sodium chloride 30.000 Final ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Principle of Nitrite Reduction Test Nitrites combine with an acidic solution of sulfanilic acid and alpha-naphthylamine to produce a red azo dye. In each test reaction, the appearance of the red dye shows the presence of NO2- in the test tube, either as an unreduced main substrate, a product of the test organism’s reduction of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The nitrocefin biochemical test is a sensitive technique for detecting beta-lactamase-producing strains of N. gonorrhoeae, H. influenzae, Staphylococcus spp, Enterococcus spp, and Moraxella (Branhamella) catarrhalis. Nitrocefin is the only reliable test for detecting beta-lactamase-producing Enterococcus spp.

What is Nitrogen Cycle? Nitrogen Cycle Definition The nitrogen cycle is a biogeochemical process that transforms atmospheric nitrogen into usable forms for living organisms and then returns it to the atmosphere through a series of biological and chemical reactions. Stages of Nitrogen Cycle Nitrogen fixation, nitrification, assimilation, ammonification, and denitrification are the steps in the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Nitrogen Fixation? Nitrogen fixation is the fundamental biological process and the first step in the nitrogen cycle. Certain bacterial species, such as Rhizobium, Azotobacter, etc., and other natural phenomena convert atmospheric nitrogen into ammonia (another type of nitrogen) throughout this process. Why is Nitrogen Fixation Necessary? It serves the following functions in nature: ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is NMR Spectroscopy (Nuclear Magnetic Resonance Spectroscopy)? NMR spectroscopy, commonly known as Magnetic Resonance Spectroscopy (MRS), is a strong analytical method used to analyze the local magnetic fields around atomic nuclei. It is based on the absorption of electromagnetic radiation by atom nuclei in the radiofrequency area, which generally ranges from 4 to 900 ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Nodule? Root Nodule Types In legumes, two major forms of nodules have been identified: determinate and indeterminate. Determinate nodules Indeterminate nodules Symbiosis Leguminous family Non-leguminous Root Nodule Formation Steps – Nodulation Briefly Describe When the soil contains a low concentration of nitrogen, root nodule development begins. The two symbiotic partners rely on cell ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Non-communicable disease? Types of Non-Communicable Diseases Non-communicable diseases (NCDs) are chronic health conditions that do not spread from person to person. These diseases are typically long-lasting and progress slowly. They can severely impact an individual’s quality of life and contribute to high mortality rates. NCDs are divided into several categories, each affecting different ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Non-Specific Immune Response? Protection Mechanisms that Anticipate Infection 1. Anatomical Barriers 2. Physiological Barriers 3. Cellular Barriers 4. Complements Infection-Induced Defensive Mechanisms 1. Fever 2. Inflammation Response 3. Interferons FAQ References

What is Nondisjunction? Types of Nondisjunction Nondisjunction is a critical genetic error that can occur during cell division, specifically during both mitosis and meiosis. Understanding the types of nondisjunction is essential for grasping how chromosomal abnormalities arise. Below are the primary types of nondisjunction, detailing their mechanisms and consequences. In both mitotic and meiotic nondisjunction, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Nonsense Mutation? Definition of Nonsense Mutation A nonsense mutation is a genetic alteration that introduces a premature stop codon into the coding sequence of a gene, leading to the production of a truncated and often nonfunctional protein. Causes of nonsense mutation Nonsense mutations are a specific type of genetic mutation where a change ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Nonsporing anaerobes? Classification of Non-Sporing Anaerobes Non-sporing anaerobes are microorganisms that thrive without the need for oxygen and do not produce spores. Based on their morphology and staining properties, these bacteria are classified into several categories. Here’s a breakdown of how they are classified according to their Gram reaction and structure: Gram-Negative Bacilli: ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The normal flora, or microbiota, in the mouth and gut refers to the community of tiny organisms—like bacteria, fungi, and viruses—that naturally live in these areas without causing harm. In the mouth, hundreds of species thrive, especially in warm, moist spots like the tongue, teeth, and gums. Common bacteria include Streptococcus, which helps break down food ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Northern blotting? Northern blotting is a technique in molecular biology that allows for the detection of specific RNA sequences in a complex mixture, offering valuable insights into gene expression patterns. ​ In 1977, James Alwine, David Kemp, and George Stark at Stanford University introduced a method that was cleverly named “Northern blot,” referencing ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Northern blotting or Northern hybridization is a widely used technique in molecular biology to determine the molecular weight of mRNA and to measure relative amounts of mRNA present in different samples and for identifying alternatively spliced transcripts and multigene family members.

Norovirus, an RNA-based virus belonging to the family Caliciviridae is an enteric pathogen that can cause significant morbidity and mortality in health medical and communities.

A nosocomial infection, also known as a hospital-acquired infection, is an infection that a patient contracts during the course of receiving treatment for another condition in a healthcare setting such as a hospital, nursing home, or clinic. Nosocomial infections have been a significant problem throughout history, with reports of healthcare-associated infections dating back to the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Nostoc? Classification of Nostoc Nostoc belongs to the group of cyanobacteria, which are known for their ability to photosynthesize and fix nitrogen. The classification of Nostoc follows a systematic hierarchy that categorizes it at different taxonomic levels. Domain: Bacteria Phylum: Cyanobacteria Class: Cyanophyceae Order: Nostocales Family: Nostocaceae Genus: Nostoc Definition of Nostoc Nostoc ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The novobiocin (antibiotic) differentiation disc can be used in the Novobiocin Susceptibility Test to help make a preliminary distinction between Staphylococcus saprophyticus and other coagulase-negative staphylococci (CoNS) in clinical (urinary) specimens.

This dye has been used as a counterstain in saturated aqueous potassium alum and in a counterstain solution of 0.1% (w/v) with 5% aluminum sulfate for a Prussian Blue Stain for ferric iron. It has been used as a reagent for calcium in tissue where it forms a scarlet lake.

Bacterial cells contain nuclear material, made of single-stranded circular DNA, in contrast to eukaryotes. This genetic material is present within the membrane-bounded structure known as the nucleus. In case of prokaryotes the nuclear material is present within the nucleoid which lacks the nuclear membrane and does not follow the mitosis or miosis cell division. Some ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Fungi are eukaryotic and contain well-organized nuclei. The fungal nucleus is membrane bound and consist of two membranes of characteristic pores, a nucleolus and chromatin strand that becomes organized into chromosome during nuclear division. The fungal nuclei are extremely minute, therefore study with the light microscope is very difficult. The cells of fungal hypae are ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The Nucleoid (meaning it's like a nucleus) is an irregularly-shaped part of the prokaryotic cell which is home to all or most part of the gene material. The chromosome of a protokaryote is circular and its length is big in comparison to cell dimensions, which is why it has to be compressed to be able to fit. Contrary to the nucleus in a prokaryotic cell, it's not protected by the nuclear membrane.

The nucleolus is a structure within a cell’s nucleus that plays a critical role in the life of a cell. This small but mighty organelle is responsible for several important functions, including the synthesis and assembly of ribosomes. In this article, we will explore the nucleolus, its structure and function, and its role in maintaining ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Nucleoside? A nucleoside is a molecule composed of a pentose sugar linked to a nitrogenous base or glycosylamine. It can be considered as a nucleotide without a phosphate group. Nucleosides are essential components of DNA and RNA, playing a vital role in the storage and transmission of genetic information. In DNA, the nucleosides ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is a Nucleotide? A nucleotide is a fundamental component of nucleic acids, such as DNA and RNA. It is composed of three main parts: a pentose sugar, a nitrogenous base, and a phosphate group. Nucleotides are often referred to as the building blocks of DNA due to their crucial role in forming the DNA ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Welcome to the fascinating world of nucleotide databases, where the intricacies of genetic information come to life! Nucleotide databases are invaluable resources that house a vast collection of nucleotide sequences from various organisms, providing a wealth of information about DNA and RNA molecules. These databases serve as essential tools for scientists, researchers, and students delving ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Nucleotide? Nucleotide Structure The structure of a nucleotide is simple, but the structure they can make when they come together is complicated. This molecule is made up of two strands that wrap around each other. Hydrogen bonds hold the structure together in the middle. Each nucleotide has a specific shape that makes this ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Cell biology describes the nucleus is the big organelle, with a membrane-bounded structure that holds the genetic material form of numerous linear DNA molecules arranged into chromosomes, which are the structures that make up the nucleus. In the field of cell biology, the nucleus's function is to serve as the central point of control for the cells. This is due to the fact that it holds the genetic material that code for the essential functions of cells. 

Nutrient agar is an essential culture medium that is commonly used for the cultivation of non-fastidious microorganisms. It can also be used to ensure quality control and quality prior to serological or biochemical tests.

Nutrient transport in plants is a crucial process that ensures the distribution of essential minerals and organic compounds necessary for growth, development, and metabolic functions. This transport occurs through various tissues, primarily the xylem and phloem, each serving distinct roles in the movement of nutrients. The following points outline the key mechanisms and pathways involved ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Nutritional Requirement All forms of life, from microorganisms to human beings, share certain nutritional requirements for growth and normal functioning. The following observations substantiate this statement and also illustrate the great diversity of nutritional types found among bacteria. Energy Electron Carbon Nitrogen Oxygen Sulfur  Phosphorus  Metal Ions Vitamins and vitamin-like compounds Water Classification of bacteria ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Nylander’s Test? Nylander’s Test, a renowned chemical assay, is primarily employed to ascertain the presence of reducing sugars within a given sample. Reducing sugars, as the name suggests, possess the inherent ability to act as reducing agents. Therefore, when these sugars, such as fructose and glucose, are subjected to alkaline conditions, they can ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

o-Nitrophenyl-b-D-Galactopyranoside (ONPG) Test Overview ONPG Test Purpose ONPG Test Principle Requirements for ONPG Test ONPG broth Composition Ingredients Gms / Litre Casitose (Equivalent to Casein Peptone) 7.500 O-Nitrophenyl-β-D-galactopyranoside 1.500 Disodium hydrogen phosphate 0.350 Sodium chloride 3.750 Final pH ( at 25°C) 7.5±0.2 ONPG Test Procedure ONPG broth method ONPG disk method Discs made of ONPG-impregnated ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Sea fur is an alternative term for Obelia. Obelia has a delicate, semitransparent, pale to light-brown hydroid colony. It consists of stems with vertical branches called hydrocauli and root-like branches called hydrorhiza. In order to complete its life cycle, Obelia’s asexual and sexual generations alternate. The life cycle of Obelia regularly alternates between hydroid and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Objective Lens? Purpose of Objective Lenses Objective lenses serve several key purposes in optical instruments, playing a critical role in magnification, image formation, and resolution. The primary purposes of objective lenses include: Specification of Objective Lens The specification of an objective lens encompasses several key parameters that define its performance and suitability for ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Obligate Anaerobes? Definition of Obligate Anaerobes Obligate anaerobes are microorganisms that exclusively thrive in oxygen-deprived environments and are adversely affected or killed by the presence of oxygen. Oxygen sensitivity of Obligate Anaerobes How Obligate Anaerobes are identified? The identification of obligate anaerobes is achieved through a systematic approach involving the use of thioglycollate ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Ocular Micrometer? Working Principle of Ocular Micrometer The principle of an ocular micrometer revolves around using a calibrated scale to accurately measure the size of objects viewed through a microscope. This scale, typically divided into 100 divisions, each measuring 0.01 millimeters (µm), is an essential component placed within the eyepiece of the microscope. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Purpose of OF Test Principle of OF Test Hugh and Leifson’s OF basal medium Composition of Hugh and Leifson’s OF basal medium Ingredients g/l Peptone (tryptone) 2.0 g Sodium chloride 5.0 g Glucose (or other carbohydrate) 10.0 g Bromthymol blue 0.03 g Agar 3.0 g Dipotassium phosphate 0.30 g Preparation Procedure of OF (Oxidation-Fermentation) Test ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The oil immersion method enhances the resolving power of a microscope, enabling light microscopy to distinguish finer details. Immersion oil—clear and colorless, having a refractive index of about 1.515—is placed in between the lens and the specimen. The refractive index is higher; therefore, less light is refracted. If less light is refracted, then less is ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Okazaki Fragments? Okazaki Fragments Definition Okazaki fragments are short DNA sequences synthesized discontinuously on the lagging strand during DNA replication, which are later joined together to form a continuous strand. Why do okazaki fragments form? Why okazaki fragments are formed? Okazaki fragments form due to the inherent nature of DNA polymerase and the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Omega-3 Fatty Acid? Definition of Omega-3 Fatty Acid Omega-3 fatty acids are essential polyunsaturated fatty acids (PUFAs) characterized by a double bond three atoms away from the terminal methyl group in their chemical structure, crucial for human health, found in plants (as α-linolenic acid, ALA) and marine sources like algae and fish (as ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The One Step Growth Curve was first described by Max Delbriick and Emory Ellis in 1939 and started modern bacteriophage research.

The Onion Peel Cell Experiment is a popular and educational activity used to observe and understand the structure of plant cells. This experiment focuses on the onion, a eukaryotic plant known for its multicellular composition. As we delve into this experiment, we explore the essential components that make up a cell, the building blocks of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Operon? Definition of Operon An operon is a functional unit of DNA in prokaryotes that contains a cluster of genes under the control of a single promoter, allowing for coordinated expression of related genes. General structure of Operon The operon is a fundamental genetic regulatory system found in prokaryotes, consisting of several key ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Opsonization? Definition of Opsonization Opsonization is the process of coating antigens with molecules called opsonins, which mark them for recognition and engulfment by immune cells, enhancing the efficiency of the immune response. Antibody-mediated Opsonization Complement-mediated Opsonization What are Opsonins? Types of Opsonins Opsonins involved in the immune system are diverse and include several ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Streptococcus pneumoniae can be distinguished from other viridans streptococci by showing that it is sensitive to optochin, dissolves in bile, reacts with a specific DNA probe, or has species-specific capsular polysaccharides. 

Organic waste adds to greenhouse gas emissions, soil and water contamination, and other environmental problems. Composting, anaerobic digestion, and vermicomposting are among the methods that can be used to manage organic waste. What is Organic waste? Organic waste refers to any waste material that originates from living organisms or their byproducts. This waste can be ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Shoot Apex? Structure and Organisation of Shoot Apex The shoot apex, located at the tip of the stem, serves as a critical region for growth and development in plants. This structure is composed of meristematic cells, which are responsible for the formation of lateral branches, leaves, flowers, and other vital components. The organization ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Organism? Definition of Organism An organism is a living entity composed of one or more cells, capable of growth, reproduction, and response to stimuli, functioning as an individual life form. Structure of an Organism Every organism, whether unicellular or multicellular, is fundamentally composed of cells, the basic structural and functional units of life. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is root apex? Root Apical Meristem (RAM) The root apical meristem (RAM) represents a vital component in the growth and development of plant roots. Situated at the sub-apical region of the root’s apex, this area is responsible for generating the internal tissues of roots, which are crucial for their function. The RAM is characterized ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Overview of Immune System Innate Immune System Adaptive (Acquired) Immune System a. Active Immunity b. Passive Immunity Organs of the Immune System Organs that function as barriers The skin and mucous membranes are the first line of protection against pathogens entering the body from the outside. They serve as a physical barrier with the assistance ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Molds are used in the manufacture of the majority of the Oriental fermented dishes listed here. In the starter, known as koji in Japan and chou in China, moulds serve as suppliers of hydrolytic enzymes, including amylases to hydrolyze the starch in the grains, proteinases, lipases, and several more. For the most part, starters are ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Orientation? In animal behavior, orientation refers to the ability of an animal to determine and maintain a specific direction or position in relation to its environment. It involves the animal’s ability to perceive and respond to various stimuli, such as light, gravity, magnetic fields, landmarks, and chemical cues, in order to navigate and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Origin and Evolution of Man Features of Man The evolution of humans has brought about several distinctive features that set them apart from other primates. These progressive features have contributed to the unique characteristics and capabilities of human beings. Let’s explore these features in more detail: One of the most remarkable features distinguishing humans from ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The origin of chordates, the early ancestors of vertebrates, is a subject that has fascinated zoologists for many years. While the exact details of their emergence remain elusive due to the absence of fossil remains, it is widely accepted that chordates evolved from invertebrates. The early chordate ancestors were soft-bodied organisms, leaving no tangible evidence ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Tetrapoda: Evolution from Fish to Land-Dwelling Vertebrates Tetrapods are a group of vertebrates that includes amphibians, reptiles, birds, and mammals. The first tetrapods evolved during the Devonian period from crossopterygian fishes, which were adapted to shallow, marshy environments. These fishes already possessed some features that made their transition to land possible. The transition from aquatic ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Ornamental plants? Characteristics features of Ornamental Plants  Below are the key characteristics and features that define ornamental plants: Classification / Types of Ornamental plants Ornamental plants are classified into several categories based on various criteria, such as growth habit and structure. This classification aids in understanding their features and cultivation requirements, ultimately enhancing ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is the ornithine decarboxylase test? Objectives of Decarboxylase Test Principle of Ornithine decarboxylase test/Principle of Decarboxylase Test Requirement The combination of these specific media, reagents, and supplies facilitates the accurate execution of the Decarboxylase Test. Each component plays a distinct role, from providing essential nutrients and pH indicators in the medium to ensuring the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Osazone Test? The Osazone test is a biochemical method used to identify reducing sugars. This test is also known as the Phenylhydrazine test, referring to the reagent employed in the procedure. It distinguishes reducing sugars based on the time it takes for the osazone complex to form. Carbohydrates, or sugars, are defined chemically ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Osmoregulation? Definition of Osmoregulation Osmoregulation is the process by which organisms regulate the balance of water and electrolytes in their body to maintain homeostasis, ensuring that their fluids are neither too diluted nor too concentrated. This process is essential for proper cellular function and overall stability in various environmental conditions. How Osmoregulation Works? ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Osmosis? Definition of Osmosis Osmosis is the spontaneous movement of solvent molecules, typically water, through a selectively permeable membrane from a region of lower solute concentration to a region of higher solute concentration, aiming to equalize solute concentrations on both sides. How Does Osmosis Work? Osmosis is a fundamental process that facilitates the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Osmotic Pressure? Definition of Osmotic Pressure Osmotic pressure is the force required to prevent the flow of solvent molecules through a semi-permeable membrane due to differences in solute concentrations between two solutions. Osmotic Pressure Equation Osmotic pressure, a fundamental concept in the study of solutions, can be quantitatively described using a specific equation. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Ossification? Definition of Ossification Ossification, also known as osteogenesis, is the process of bone formation, where mesenchymal cells differentiate into osteoblasts that lay down new bone tissue. There are two types of ossification: intramembranous, which directly converts mesenchymal tissue into bone, and endochondral, which involves the transformation of mesenchymal tissue into a cartilage ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Kingdom Animalia Phylum Chordata Subphylum Vertebrata Division Gnathostomata Superclass Pisces Class Osteichthyes General Characteristics of Osteichthyes Osteichthyes, or bony fishes, exhibit a range of general characteristics that define this diverse class of vertebrates: These general characteristics contribute to the diversity and adaptability of bony fishes, allowing them to thrive in various aquatic habitats and play ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Classification of Immunodiffusion  The process of immuno-diffusion allows the determination or detection of antigens and antibodies through their precipitation that involves diffusion through a substance, such as gel agarose or agar. Simply, it denotes precipitation in a gel. It’s one of the many methods to create a precipitate from an antibody and a specific antigen. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Ovary? Definition of Ovary The ovary is a reproductive organ in females that produces eggs and secretes hormones like estrogen and progesterone, essential for regulating the menstrual cycle and fertility. Anatomy of the Ovary The ovary is a crucial organ in the female reproductive system, responsible for producing eggs and secreting hormones essential ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Bacillus anthracis the most well-known pathogen in the Genus Bacillus is the cause of a severe zoonotic illness known as anthrax. Anthrax is a primary disease that affects domestic and wild herbivores. It is among the most frequently encountered bioterrorism agents that has been implicated before in the Sverdlovsk the anthrax outbreak of 1979 as ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Ovule? Definition of Ovule An ovule is a small structure within the ovary of a plant that contains the female gamete (egg cell) and develops into a seed after fertilization. Location of Ovule The location of ovules in flowering plants is intricately tied to their role in reproduction and is defined by various ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Ovule Culture? Principle of Ovule Culture Protocol of Ovule Culture The following detailed steps provide a comprehensive guide for executing ovule culture effectively. Importance of Ovule Culture Below are specific aspects detailing the importance and applications of ovule culture.

The oxidase test is a biochemical reaction that assays for the presence of cytochrome oxidase, an enzyme sometimes called indophenol oxidase. In the presence of an organism that contains the cytochrome oxidase enzyme, the reduced colorless reagent becomes an oxidized colored product .

What is Oxidation Pond? Mechanism of Waste Treatment Understanding the following processes will facilitate comprehension of the oxidation pond’s mechanism or operation. Based on the two mechanisms described above, it is evident that algae and bacteria fulfil one other’s needs. The bacteria oxidise the biodegradable organics with the oxygen generated by the algae. The bacterial ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Oxidative Phosphorylation? Definition of Oxidative Phosphorylation Oxidative phosphorylation is a metabolic process that occurs in the mitochondria, where energy derived from the electron transport chain is used to produce adenosine triphosphate (ATP) from adenosine diphosphate (ADP) and inorganic phosphate, with oxygen acting as the final electron acceptor. Sites of oxidative phosphorylation in ETC ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Oxidizing Agent? An oxidizing agent, scientifically termed as an oxidant or oxidizer, is a pivotal component in redox (reduction-oxidation) chemical reactions. It functions by accepting or gaining electrons from another substance, known as the reducing agent or reductant. This electron transfer results in the oxidizing agent undergoing a reduction, which is characterized by ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Oxygen Toxicity Formation of reactive oxygen species (ROS) Various cellular enzymes catalyze chemical reactions involving molecular oxygen; some of these reactions can result in addition of a single electron to an oxygen molecule, thereby forming superoxide radical. Superoxide radicals can inactivate vital cell components. However, recent studies suggest that their greatest detrimental action is through ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Ozone Treatment? Properties of ozone Ozone, with the chemical formula O3, is a molecule consisting of three oxygen atoms bonded together. It possesses several unique properties that contribute to its wide range of applications and effects: These properties make ozone a valuable tool in various industries, including water treatment, air purification, food preservation, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Pyramid of Number? The Pyramid of Numbers is a graphical representation used in ecology to illustrate the distribution of various species in different trophic levels of a food chain. This pyramid provides a quantitative analysis, showing the number of individual organisms present at each trophic level. Unlike other ecological pyramids which might consider ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Definition of p-value  The p-value, or estimated probability represents the most reliable probability of providing the lowest amount of significance, that the null hypothesis isn’t the case. Formula of p-value  How to find p-value? P-values can be determined through comparing test results against the table of p-values for various scores. The scores calculated by the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is PAM Sequence (Protospacer adjacent motif)? Protospacer Adjacent Motif, or PAM, is a type of two-factor authentication that tells Cas to only cut the foreign DNA that is invading. Properties of PAM sequence Spacers/protospacers PAM sequences Functions of PAM Sequence 1. Role of PAM in spacer acquisition 2. Role of PAM in interference 3. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Pancreas? Definition of Pancreas The pancreas is a vital organ in the human body that serves dual functions: it acts as an endocrine gland by producing hormones such as insulin and glucagon to regulate blood sugar levels, and as an exocrine gland by secreting digestive enzymes and bicarbonate into the small intestine to ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Papanicolaou stain can also be referred to as the pap stain, and the process that causes the stain is referred to as a pap smear.

What is Paper Chromatography? Types of Paper chromatography There are two main types of paper chromatography: paper adsorption chromatography and paper partition chromatography. Both paper adsorption chromatography and paper partition chromatography are valuable techniques for separating and analyzing mixtures of compounds. They rely on the principles of adsorption or partitioning to achieve separation, and the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Human Papillomaviruses  Classification On the basis of DNA homology, tissue tropism, and relationship with oncogenesis, the HPVs have been categorised into 16 groups (A–P), encompassing at least 70 kinds, containing a total of at least 100 types. Human infections caused by papovaviruses Papillomavirus Polyomavirus Morphology of Human papillomaviruses  Human papillomaviruses have the following characteristics: Viral ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Paramecium? Definition of Paramecium Paramecium is a microscopic, single-celled organism with hair-like structures called cilia, found in various aquatic environments, often studied for its role as a model organism in biological research. Paramecium Scientific classification Paramecium is divided into this following phylum and subphylum; Domain: Eukaryota Clade: SAR Infrakingdom: Alveolata Phylum: Ciliophora Class: ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Paramecium? Requirement for Observation of Paramecium Under Microscope The observation and study of Paramecium, a type of microscopic organism, require specific tools and materials to ensure accurate and detailed examination. These components play a crucial role in microscopy, allowing scientists and researchers to gain insights into the biology and behavior of Paramecium. Here ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The Parasexual Cycle is defined as a cycle in which plasmogamy, karyogamy and meiosis (haploidisation) take place but not at a specified time or at specified points in the life-cycle of an organism.

The term “helminthes,” originating from the Greek word helmins, translates to “worms.” However, this classification is somewhat misleading, as it encompasses a range of elongated, unsegmented invertebrates that possess bilateral symmetry. Helminthes is specifically restricted to a select group of phyla within the animal kingdom, despite the superficial resemblance these organisms share. Helminths are divided ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Parasitic Vertebrates? Cookiecutter shark (Isistius brasiliensis) Domain: Eukaryota Kingdom: Animalia Phylum: Chordata Class: Chondrichthyes Subclass: Elasmobranchii Subdivision: Selachimorpha Order: Squaliformes Family: Dalatiidae Genus: Isistius Species: I. brasiliensis The cookiecutter shark (Isistius brasiliensis) is a distinctive species of deep-sea shark known for its unique feeding behavior and wide geographic range. Primarily found in tropical and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Parasitism? Definition of Parasitism Parasitism is a symbiotic relationship between two species in which one organism, the parasite, derives benefits at the expense of the other organism, the host, often causing it harm. Mechanisms of Dispersal Types of Parasitism  Parasitism, a multifaceted biological interaction, can be classified based on various criteria, ranging from ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Production of parasporal crystals is a unique ability (among Bacillus species) of Bacillus thuringiensis. This stain is a means of rapid identification of the species.

What is Parathyroid Gland? Definition of Parathyroid Gland The parathyroid glands are small endocrine glands located behind the thyroid gland that regulate calcium levels in the blood by secreting parathyroid hormone (PTH). This hormone helps maintain calcium balance by influencing the bones, kidneys, and intestines. Anatomical Location of Parathyroid Gland The parathyroid glands are small, flattened, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Parenchyma Tissue? Characteristics of Parenchyma Parenchyma tissue is a crucial component in plant biology, characterized by its living cells that play significant roles in various physiological processes. The following points outline the main characteristics of parenchyma tissue, highlighting its functions and structural attributes. Structure of Parenchyma Cells Parenchyma cells represent a fundamental component ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Parental Care in Amphibia 1. Protection by Nests, Nurseries, or Shelters in Amphibians Amphibians have evolved a variety of innovative strategies to protect their vulnerable eggs and larvae from predation. These methods often involve creating safe microhabitats that shield offspring until they are capable of defending themselves. The protection by nests, nurseries, or shelters can ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Different Types Of Parental Care In Fishes Include 1. Deposition of Eggs Into Self-Made Nest Certain fish species exhibit the behavior of preparing nests to ensure the safe deposition and protection of their eggs, as well as the development of their young ones. The construction of these nests involves the participation of either males or ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is parthenogenesis? – Parthenogenesis Definition Natural Parthenogenesis  The regular, continuous, and natural occurrence of parthenogenesis in the life cycles of certain animals is known as natural parthenogenesis. There are two types of natural pathogenesis: complete and incomplete. (i) Complete parthenogenesis (ii) Incomplete parthenogensis Complete and incomplete type of natural parthenogenesis The two forms of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Microscopes? Parts of a Microscope The microscope parts are divided into two main categories,  such as; Structural parts of a microscope and their functions Structural parts of a microscope Location Function Head (Body Tube) Situated at the microscope’s apex. Serves as a pivotal connector, linking the eyepiece to the objective lenses, ensuring a ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Parvovirus? Classification of Parvovirus Parvovirus B19  Parvovirus B19, or B19 virus, is the causal agent of erythema infectiosum (“fifth disease”; it was fifth of the six identified exanthematous disorders of childhood), a minor viral sickness of children, as well as polyarthralgia–arthritis syndrome in immunocompetent adults. Morphology of Parvovirus B19  B19 viruses manifest the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Passive Immunity? Definition of Passive Immunity  Passive immunity is the temporary protection against infectious diseases provided by the introduction of pre-formed antibodies from an external source, rather than the body’s own immune response. Characteristics of Passive Immunity Passive immunity possesses several distinct characteristics that differentiate it from active immunity: Types of Passive Immunity ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Passive Immunization? Definition of Passive Immunization Passive immunization refers to the direct administration of pre-formed antibodies or immune cells from another individual to provide immediate protection against infectious agents or toxins. Process of Passive Immunization Passive immunization involves the direct transfer of pre-formed antibodies or immune cells from a donor to an individual ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Passive Transport Definition What is Diffusion? Factors affects the rate of Diffusion Characteristics of Passive Transport Overall, passive transport allows for the movement of molecules or ions across the cell membrane without requiring the cell to expend energy. Types Of Passive Transport There are four types of passive transport: 1. Simple Diffusion Factors affecting on ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Pasteurization? Definition of Pasteurization Pasteurization is a process of treating food and beverages with mild heat to eliminate pathogens and extend shelf life while minimizing changes to nutritional quality and sensory characteristics. History of Pasteurization  Purpose of Pasteurization The purpose of pasteurization is to achieve several important objectives in food preservation and safety. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Patent? Definition of Patent A patent is a government-granted right that allows an inventor to exclude others from making, using, or selling an invention for a specified period, typically 20 years, in exchange for publicly disclosing the details of the invention. Historical Background of Patents The concept of patents has evolved significantly over ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Virulence Definition Virulence define the intensity of a pathogen to cause disease. The Virulence varies among different microbial species. Virulence enables the microorganism to carry a specific character which can damage the tissue of the host cell. Virulence helps the microorganism to better survive its residency in the host. The virulence property of an organism varies ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Pauly’s Test? Purposes of Pauly’s Test Principle of Pauly’s Test The presence of tyrosine and histidine can be determined with this test with high sensitivity. Sulphanilic acid is dissolved in hydrochloric acid and used as the reagent in this test. When being exposed to sodium nitrite and hydrochloric acid, sulphanilic acid forms a ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

A PCR machine is a common tool found in labs, especially if you’ve ever dealt with DNA testing or medical diagnostics. At its core, it’s designed to create millions of copies of a specific DNA segment, which sounds simple but is incredibly powerful for tasks like identifying infections, studying genetic mutations, or even solving crimes. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Pearls are organic gemstones produced by certain bivalve mollusks, such as oysters and mussels. These remarkable structures form in response to irritants that enter the mollusk’s shell. When an irritant, such as a parasite or grain of sand, enters the mollusk, it triggers a defensive mechanism. The mollusk secretes layers of aragonite and conchiolin, substances ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Pediculus Humanus (Lice)? Lice are small, parasitic insects that belong to the order Phthiraptera and are known for their obligatory ectoparasitic lifestyle. Over 550 species of lice have been identified worldwide, and they typically infest humans, cattle, and other animals. These insects are dorsoventrally flattened and wingless, making them well-adapted to their parasitic ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Pedigree? What is Pedigree Analysis? Pedigree Analysis Definition Pedigree analysis is a genetic tool used to trace the inheritance patterns of traits or disorders through generations of a family, helping to predict the likelihood of their occurrence in offspring based on familial history. Basic Steps of Pedigree Analysis Pedigree analysis involves several systematic ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Pedigree Method? Definition of Pedigree Method The pedigree method is a plant breeding technique where individual plants from segregating generations are selected and documented through detailed pedigree records. This method aims to develop genetically uniform pureline varieties by maintaining and selecting plants until progenies exhibit no further genetic variation. Procedure for the Pedigree ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

In 1929, Alexander Flemming found that the mould Penicillium notatum secreted penicillin. However, the lytic agent appeared to be too unstable to be useful. In 1939, however, when Chain refined the active ingredient, termed penicillin, it proved to be extraordinarily powerful against some illnesses. Penicillin is not a single chemical entity, but rather a series ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Penicillium? Requirements for Penicillium Microscopy Procedure of Penicillium Microscopy General Tips When embarking on the fascinating journey of Penicillium microscopy, there are some essential tips to ensure a successful and rewarding experience. By following these guidelines, researchers and enthusiasts can unlock the hidden world of mold and delve into the intricate details of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Kingdom: Fungi Division: Ascomycota Class: Eurotiomycetes Order: Eurotiales Family: Trichocomaceae Genus: Penicillium Species: P. chrysogenum Characteristics and significance Habitat of Penicillium chrysogenum Morphology of Penicillium chrysogenum Genome structure Cultural characteristics of Penicillium chrysogenum Penicillium chrysogenum has distinct cultural characteristics that can help identify it in a laboratory setting. Here are some of its cultural characteristics: Life Cycle of Penicillium chrysogenum ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Pentose Phosphate Pathway? Pentose Phosphate Pathway Definition The Pentose Phosphate Pathway (PPP) is a metabolic pathway parallel to glycolysis that produces NADPH, pentoses (5-carbon sugars), and ribose 5-phosphate, a precursor for nucleotide synthesis. It plays a crucial role in both cellular biosynthesis and the defense against oxidative stress. Location of Pentose Phosphate Pathway ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What Is a Peptide Bond? Definition of Peptide Bond A peptide bond is a covalent bond formed between the α-carboxyl group of one amino acid and the α-amino group of another, resulting in the release of a water molecule. This bond links amino acids together in a peptide or protein chain and is characterized by ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Peptone Water is a type of broth medium. This media is mainly used to grow the organism and is also used as a base for determining carbohydrate fermentation patterns of non-fastidious organisms. It is also used to detect indole production by the organism.

Peptone Yeast Extract Broth Based Media are enriched nonselective media which include hemin and vitamin K to aid in the recovery of aggressive organisms like Prevotella Spp., Porphyromonas species, as well as the Bacteroides fragileis group. 

What is Periderm? Structure of Periderm The periderm is a secondary tissue that replaces the epidermis during secondary growth in plants, providing a protective barrier. It consists of three main components: the phellogen (cork cambium), phellem (cork), and phelloderm. These three layers arise through a sequential process and perform distinct functions in the plant’s protective ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Periodic Acid-Schiff (PAS) Staining? Periodic Acid-Schiff (PAS) staining is a laboratory staining technique used to detect the presence of specific sugars and carbohydrates in tissue samples. The PAS stain highlights the presence of sugars, glycoproteins, and mucopolysaccharides in biological tissues and cells. The staining process is often used in the diagnosis of diseases ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Peripheral Nervous System? The peripheral nervous system acts as a bridge between the brain, spinal cord, and the rest of the body. Think of it as a network of pathways that carry messages back and forth. While the brain and spinal cord form the central command center, the peripheral system handles communication with ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Peripheral Protein? Structure of Peripheral Proteins Several peripheral proteins are marked in the picture below. A peripheral protein doesn’t have a clear structure, but it does have a few important features that make it what it is. Example of Peripheral Proteins Alternative Oxidase Cytochrome c Type-II NADH Dehydrogenase Dihydroorotate Dehydrogenase Functions of Peripheral ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Permanent Tissue? Definition of Permanent Tissue Permanent tissue is a type of plant tissue composed of mature, differentiated cells that have lost the ability to divide and have specific functions, such as support, storage, or transport. Characteristics of Permanent Tissue Types of Permanet Tissue A. Simple Permanent Tissue Simple permanent tissues are a ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Unsaturated fish oils are especially vulnerable to oxidation, resulting in peroxides when stored in cold or freezing conditions for storage. Peroxides are precursors to breakdown products that can cause rancid taste in fat. Peroxide levels are an indicator of oxidation in the initial stages of lipid degradation. The index is less reliable in the latter ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Peroxisomes? Peroxisomes, identified as membrane-bound cell organelles in eukaryotic cells, were first described by J. Rhodin in 1954 and subsequently recognized as cell organelles by Christian de Duve in 1967. These organelles, small vesicles containing digestive and oxidative enzymes, play a pivotal role in cellular metabolism. They are integral in converting hydrogen peroxide ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Pest? Definition of Pest A pest is an organism that is harmful to humans, crops, livestock, or the environment and causes damage or nuisance. Types of pests There are various types of pests that can cause damage and nuisance in different settings. Here are some common types of pests: These are just a ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is a Petri dish? – Petri dish Meaning Petri dish definition A Petri dish is a shallow, transparent container used in laboratories to cultivate and observe microorganisms and cells. It consists of a flat-bottomed dish with vertical sides and a lid, typically made of clear glass or plastic. Purpose of Petri Dish History of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is pH Meter? A pH meter is a critical instrument used for measuring the acidity or alkalinity of aqueous solutions, quantified in terms of pH. The pH scale ranges from 0 to 14, where a value of 7 denotes neutrality, values below 7 indicate acidity, and values above 7 denote alkalinity. This scale reflects ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Phaeophyta (Brown Algae)? General Characteristics of Brown Algae (Phaeophyta) Brown algae, or Phaeophyta, exhibit a variety of unique structural, cellular, and reproductive features that make them an important group within the marine ecosystem. The following points detail the essential characteristics of this group: Classification of Phaeophyta Phaeophyta, or brown algae, are classified based ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Phagocytosis refers to the process in which cells consume large particles (>0.5 micrometers) and vesicle-bound membrane vesicles known as phagosomes. These vesicles are then directed to the lysosomes where they will be subjected to enzymatic degrading. Optonization of bacteria can greatly enhance phagocytosis. Although phagocytosis may occur without the attachment of an IgG or complement fragment (C3), it can be greatly enhanced by attaching a specific IgG.

What is phase contrast microscopy? Okay, so picture this: back in the 1930s, scientists were struggling to study things like living cells or bacteria under a microscope. Why? Because those tiny critters are practically see-through! You couldn’t get a clear look without dunking them in harsh dyes—which, you know, kinda killed them. Not exactly helpful if you ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Phenol-Sulfuric Acid Method for Total Carbohydrates? Objective of Phenol-Sulfuric Acid Method Principle of Phenol-Sulfuric Acid Method The principle of the Phenol-Sulfuric Acid Method centers on the reaction of carbohydrates with strong acid and heat, leading to the production of detectable compounds. This method involves the breakdown of carbohydrates—such as simple sugars, oligosaccharides, or ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Phenotype? Definition of Phenotype The phenotype is the observable set of characteristics or traits of an organism, resulting from the interaction of its genetic makeup (genotype) with the environment. What is Extreme Phenotype? In the intricate domain of genetics, the concept of an “extreme phenotype” is pivotal in understanding the variations that can ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Objective of Phenylalanine Deaminase Test Principle of Phenylalanine Deaminase Test Requirements For the test Composition of Phenylalanine agar DL-Phenylalanine: 2 gm Yeast extract: 3 gm Sodium chloride: 5 gm Disodium phosphate: 1 gm Agar: 12 gm Distilled water: 1000 ml pH: 7.3 Preparation of Phenylalanine agar slant Note: Following autoclaving, the medium should appear lighter ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

A selective medium called phenylethyl alcohol (PEA), is used to cultivate Gram positive organisms, especially cocci, in a sample containing pathogens. Phenylethyl alcohol is the active ingredient that inhibits or significantly reduces growth of Gram-negative organisms.

Do you think phosphorus is important? This depends on whether you want DNADNAtexttextend text"D,N, End cell membranes, text or bones within your body? It's a good bet that the likelihood is that yes!

Photo bioreactor is an innovative type of reactor that has the advantages of biofilm reactors and photobioreactors that can be utilized to cultivate microalgae in wastewater treatment facilities (WWTPs). The major benefit of this type of system is its capacity to use sunlight as a source of energy for photosynthesis, which reduces the requirement for carbon from external sources.

What is Photoautotroph? Definition of Photoautotroph A photoautotroph is an organism that synthesizes its own organic compounds using light energy and inorganic carbon, primarily through the process of photosynthesis. Examples include plants, algae, and certain bacteria. How does Photoautotrophs Get Their Nutrition? Photoautotrophs obtain their nutrition through a process called photosynthesis. Here’s a detailed explanation ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Photomorphogenesis? Definition of Photomorphogenesis Photomorphogenesis is the process by which plants use light as a signal to regulate growth and development, influencing stages such as seed germination, seedling growth, and flowering. Photoreceptors and Photomorphogenesis Photomorphogenesis in plants is regulated by specialized light-sensitive molecules known as photoreceptors. These photoreceptors are crucial for interpreting light signals ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Photoperiodism? Classification of plants based on Photoperiodism Plants are classified into several categories based on their response to the length of light and dark periods. These categories reflect how different species time their flowering and growth in accordance with seasonal day-length variations. The primary classifications include: Photoperiodic Induction Photoperiodic induction refers to the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Photosynthesis? Definition of Photosynthesis Photosynthesis is the biological process by which plants, algae, and certain bacteria convert light energy into chemical energy, producing oxygen and organic compounds, primarily glucose, from carbon dioxide and water. Experimental History The intricate process of photosynthesis, which underpins life on Earth, has been the subject of extensive scientific ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Photosynthetic bacteria Definition Photosynthetic bacteria Examples There are many types of bacteria that can photosynthesize, as we have already mentioned. They can be divided into five main groups, which include: Cyanobacteria Cyanobacteria, also known as “blue green algae”, are Gram-negative bacteria that are commonly found in aquatic ecosystems. While there have been more than 2000 ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Photosystem I (PS1)? Definition of Photosystem I (PS1) Photosystem I (PSI) is a crucial protein complex in oxygenic photosynthesis, primarily found in algae, plants, and cyanobacteria. It functions by capturing light energy to drive the transfer of electrons across the thylakoid membrane, from plastocyanin to ferredoxin. This process contributes to the synthesis of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Phototropism? Definition of Phototropism Phototropism is the directional growth of an organism, especially plants, in response to a light stimulus. Phototropism Lecture Video Phototropism Discovery – Early Experiments The phenomenon of phototropism, where plants grow directionally in response to light, has been a subject of scientific intrigue for centuries. Pioneering experiments by eminent ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

In microbiology, the phyllosphere is the complete above-ground plant surface seen as a microorganism habitat. Other subdivisions of the phyllosphere include the caulosphere (stems), phylloplane (leaves), anthosphere (flowers), and carposphere (roots) (fruits). The rhizosphere and laimosphere are the below-ground microbial habitats (i.e., the thin volume of soil surrounding root or subterranean stem surfaces). The majority ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

A phylogenetic tree (also phylogeny or evolutionary tree) is a branching diagram or a tree that illustrates the evolutionary relationships between various biological species or other entities based on similarities and differences in their physical or genetic characteristics. All life on Earth belongs to a singular phylogenetic tree, indicating a shared ancestry. In a rooted ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Phylogeny? Definition of Phylogeny Phylogeny is the study of the evolutionary history and relationships among species or groups of organisms, represented visually by a phylogenetic tree. What is Molecular Phylogeny? Molecular phylogeny, a specialized subset of phylogeny, harnesses the power of molecular sequencing to decipher evolutionary relationships and histories among various organisms. Traditional ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Phylum? Definition of Phylum A phylum is a high-level taxonomic rank in biology, ranking below kingdom and above class, used to categorize and group organisms with shared fundamental characteristics and evolutionary relationships. Examples of Phylum 1. Phyla in Kingdom Monera Within the taxonomic realm of Kingdom Monera, encompassing both Eubacteria and Archaea, the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Kingdom: Animalia Clade: Bilateria Clade: Nephrozoa (unranked): Protostomia (unranked): Spiralia Superphylum: Lophotrochozoa Phylum: AnnelidaLamarck, 1809 Morphology of Annelida Below is a detailed description of the key morphological traits of annelids: Anatomy of Annelida General Characters of Phylum Annelida Organ System of Phylum Annelida Below is an overview of the major organ systems found in annelids, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Kingdom: Animalia Subkingdom: Eumetazoa Clade: ParaHoxozoa Clade: Bilateria Clade: Nephrozoa (unranked): Protostomia Superphylum: Ecdysozoa (unranked): Panarthropoda (unranked): Tactopoda Phylum: Arthropoda What is Phylum Arthropoda? Definition of Arthropoda (Arthropods) The Arthropods belong to the bilaterally symmetrical, metamerically separated, triploblastic creatures with a coelom that is diminished and altered. Their body is externally covered in an exoskeleton ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Phylum Aschelminthes Definition Aschelminthes are pseudocoelomate. They are bilaterally symmetrical, triploblastic, non-segmented, vermiform, organ-system grade construction that includes full digestive tubes. Characteristics of Phylum Aschelminthes  Classification of phylum Aschelminthes The phylum is a heterogeneous collection of animals, which is why it is classified differently by various Zoologists. The classification here is based on and on ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The Ascomycota sac fungi is monophyletic and comprises about 75% of the described fungi. It comprises the majority of fungi that mix together with algae to create lichens as well as the vast majority of fungi do not have morphological evidence for sexual reproduction. Among the Ascomycota are some famous fungi: Saccharomyces cerevisiae, the yeast of commerce and foundation of the baking and brewing industries (not to mention molecular developmental biology), Penicillium chrysogenum, producer of penicillin, Morchella esculentum, the edible morel, and Neurospora crassa, the "one-gene-one-enzyme" organism. 

What is Chordata? Characteristics of Chordates Below are the main characteristics of chordates: In addition to the primary characteristics listed above, chordates share several other notable features: Anatomy of Chordates The anatomy of chordates encompasses a unique set of features that distinguishes them from other animal phyla. These anatomical characteristics manifest at various life stages ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Phylum Chordata Definition “The chordates are a class of animals that have four anatomical characteristics, which are (1) nochord (2) dorsal cord of nerves, (3) post-anal tail and (4) Pharyngeal slits, at the very least, during a portion of their growth into maturity.” Or A phylum within the animal kingdom, which includes all animals that ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Cnidaria comes from the Greek word cnidos, which means stinging thread. The existence of cnidae characterises these creatures. Cnidaria is a phylum within the Kingdom Animalia that contains 10,000 known species, including corals, sea anemones, jellyfishes, and hydras. These organisms are found in both marine and freshwater environments. It is an additional ancient group with ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Definition of Phylum Coelenterata (Cnidaria)  The Coelenterata can be described as a diploblastic metazoa that has a the tissue grade having one nematocyst, and one gastrovascular cavity, or coelenteron. Characteristics of Phylum Coelenterata (Cnidaria)  Classification of Phylum Coelenterata (Cnidaria)  The phylum Coelenterata contains more than 11,000 species of which half are extinct. The classification used ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Phylum Ctenophora? Kingdom Animalia Subkingdom Eumetazoa Phylum Ctenophora Phylum Ctenophora, commonly referred to as comb jellies, encompasses a group of marine invertebrates known for their distinctive, jelly-like appearance and unique locomotive mechanisms. These creatures, often mistaken for jellyfish, play a significant role in marine ecosystems across the globe. Below is an exploration of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Phylum Echinodermata? Phylum Echinodermata Definition Phylum Echinodermata encompasses marine organisms characterized by a calcareous endoskeleton, pentamerous radial symmetry in adulthood, and a specialized water vascular system, with notable members including starfish, sea urchins, and sea cucumbers. Characteristics of Phylum Echinodermata  In essence, Phylum Echinodermata represents a diverse group of marine organisms, distinguished by ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Definition of Phylum Hemichordata Phylum Hemichordata is a small marine phylum of worm-like animals known as Acorn Worms. They are distinct from chordates and serve as important connecting links between vertebrates and invertebrates. Characteristics of Phylum Hemichordata Phylum Hemichordata exhibits the following characteristics: Some examples of Hemichordata include Balanoglossus, Saccoglossus, Rhabdopleura, Atubaria, and Dendrograptus. In ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Phylum Mollusca? Definition of Mollusca (Mollusks) Mollusca, commonly known as mollusks, is a large phylum of invertebrate animals characterized by a soft body that is often protected by a hard shell. This diverse group includes species such as snails, slugs, clams, octopuses, and squids. Mollusks are known for their unsegmented bodies, bilateral symmetry, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Phylum Nemathelminthes General Characteristics of Nemathelminthes Phylum Nemathelminthes, also known as Nematoda or roundworms, exhibit several general characteristics that define their biology and classification. Here are some key characteristics of nematodes: Structure of Nemathelminthes Nemathelminthes, also known as roundworms or nematodes, exhibit a unique structure that distinguishes them within the animal kingdom. Here are the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Definition of Phylum Nematoda Nematodes (Gr. nema thread+ form) are often referred to by various names, such as threadworm, non-segmented roundworm or pinworm. They are distinct from flatworms and higher segmented anelids. Characteristics of Phylum Nematoda  Classification of Phylum Nematoda  Nematoda is one of the most diverse phyla. At present, there are approximately 15,000 species. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Kingdom: Animalia Subkingdom: Eumetazoa Clade: ParaHoxozoa Clade: Bilateria Clade: Nephrozoa (unranked): Protostomia Superphylum: Ecdysozoa (unranked): Panarthropoda Phylum: OnychophoraGrube, 1853 Class: Udeonychophora General Characteristics of Phylum Onychophora Phylum Onychophora, commonly known as velvet worms, is a unique group of invertebrates that share characteristics of both arthropods and annelids. Here are some general characteristics of the phylum ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Phylum Platyhelminthes? Definition of Phylum Platyhelminthes Phylum Platyhelminthes, also known as flatworms, comprises bilaterally symmetrical, triploblastic, dorsoventrally flattened invertebrates lacking circulatory, respiratory, and skeletal systems, characterized by a simple digestive system with a single opening and a protonephridial excretory system. Characteristics of Phylum Platyhelminthes Classification of Phylum Platyhelminthes Class 1- Turbellaria (L., turbella= a little ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Phylum Porifera? – Definition of Phylum Porifera Phylum Porifera refers to a group of simple, sessile aquatic animals commonly known as sponges. Sponges lack true tissues and organs and have a porous body structure with numerous channels and chambers that allow water to flow through them. They feed by filtering small particles from ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Sterilization? Physical methods of sterilization Physical methods of sterilization involves the control of microbial growth by using Sunlight, Heat, Filtration, Radiation, etc. Physical methods of sterilization include the following: A. Heat Sterilization Heat sterilization is a fundamental technique in microbiology and medical sterilization, notable for its efficiency in destroying microorganisms through thermal means. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Tyrode’s Solution, Acidic Preparation To prepare 1L of Tyrode’s Solution, Acidic, the following components are required; Component Amount Concentration NaCl (mw: 58.44 g/mol) 8 g 0.1368 M KCl (mw: 74.55 g/mol) 200 mg 0.0027 M CaCl2•2H2O (mw: 147.01 g/mol) 240 mg 0.0016 M MgCl2•6H2O (mw: 203.3 g/mol) 100 mg 0.0005 M Glucose (mw: 180.16 g/mol) ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Respiration is a vital physiological process that encompasses the cyclic movement of air into and out of the lungs. This mechanism is crucial for facilitating the exchange of gases, specifically oxygen and carbon dioxide, between the external environment and the bloodstream. The efficiency of respiration directly influences the partial pressures of oxygen (PaO2) and carbon ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Digestion? Organ Systems Involved in gastrointestinal system The gastrointestinal (GI) system is a complex network of organs responsible for the digestion and absorption of nutrients, as well as the elimination of waste. It encompasses several key organs, each with specific functions that contribute to the overall digestive process. Digestion Process The digestion process ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Ear? Definition of Ear The ear is a sensory organ responsible for hearing and maintaining balance in the body. It consists of the outer ear, middle ear, and inner ear, and it converts sound waves into electrical signals that can be interpreted by the brain. Anatomy of Ear – Structure of Ear The ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Respiration? What is Respiration System? Respiratory organs The respiratory system consists of several critical organs that work together to facilitate breathing and gas exchange. These organs are structured to ensure the proper flow of oxygen into the body and the removal of carbon dioxide. Below is a detailed breakdown of the primary respiratory ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Eye? Definition of Eye The eye is an organ of the visual system that detects light and enables organisms to see by converting light into electrical signals that are sent to the brain for processing. Anatomy Of Eye – Structure of Eye The eye is typically round in shape, but it appears convex ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Phytochrome? Structure of Phytochrome Phytochrome is a complex protein pigment that plays a crucial role in plant photoreception and signaling. Here are the key aspects of its structure: Types of Phytochrome Phytochromes are classified into different types based on their genetic encoding and functional roles in plants. The main types of phytochrome include: ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Phytoplankton? Definition of Phytoplankton Phytoplankton are microscopic, photosynthetic organisms found in aquatic environments that serve as the foundation of marine and freshwater food chains and contribute significantly to global oxygen production and carbon cycling. Characteristics Features of Phytoplankton Phytoplankton are a diverse group of microscopic photosynthetic organisms that inhabit aquatic ecosystems, and they ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Phytoplankton? Definition of Phytoplankton Phytoplankton are microscopic, photosynthetic organisms found in aquatic environments that serve as the foundation of marine and freshwater food chains and contribute significantly to global oxygen production and carbon cycling. Characteristics Features of Phytoplankton Phytoplankton are a diverse group of microscopic photosynthetic organisms that inhabit aquatic ecosystems, and they ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Phytoremediation? Types of Phytoremediation There are three varieties of phytoremediation: 1. In situ phytoremediation Advantages of In situ phytoremediation Disadvantages of In situ phytoremediation 2. In-vivo phytoremediation with relocated contaminants 3. In vitro phytoremediation Processes Of Phytoremediation Phytoremediation is based on certain natural processes carried out by plants, such as:  Mechanisms of phytoremediation ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Picric acid test is used for reducing sugars, and is a highly sensitive chemical tests. Picric acid reactions (toxic yellow crystal solid) which is also referred to chemically as 2,4 6-trinitrophenol (TNP) reacts with sugars that are reduced to create Picramic Acid that is red-colored. The Picric Acid test is made up of a sugar ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Pineal Gland? Definition of Pineal Gland The pineal gland is a small, pea-shaped endocrine gland located in the brain, responsible for producing the hormone melatonin, which regulates sleep-wake cycles and circadian rhythms. It responds to light exposure, influencing various biological processes in the body. Location of Pineal Gland Structure of Pineal Gland The structure ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Kingdom Plantae Division (Phylum) Pinophyta (Coniferophyta) Class Pinopsida Order Pinales Family Pinaceae Genus Pinus What is Pinus? Pinus Habitat and Distribution Pines, belonging to the genus Pinus, are among the most recognizable evergreen trees globally, found naturally across both hemispheres. Their adaptability to a wide range of climates and elevations makes them prominent in diverse ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Pipette? Definition of Pipette A pipette is a laboratory tool used to measure and transfer small volumes of liquid with precision. Principle of Pipette The principle of a pipette is based on two main mechanisms: the air displacement method and the positive displacement method. These mechanisms determine how the pipette functions and transfers ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Pipette (Glass Pipettes)? Features of Pipettes (Glass Pipettes) Pipettes are essential tools for measuring and dispensing liquids in a wide range of laboratory settings. The features of pipettes can vary based on design, construction, and intended use. Below are the key features that define pipettes: Principle of Pipette (Glass Pipettes) The principle behind ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Pipette Dropper? Components of Dropper Pipettes A dropper pipette consists of several key components, each serving a specific purpose in the process of transferring small amounts of liquid. Understanding the function of these parts is crucial for ensuring accurate and efficient liquid dispensing. Types of Dropper Pipettes Dropper pipettes come in several variations, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Pipette Filler? Components of a Pipette Filler A pipette filler is designed to simplify and ensure the safe transfer of liquids using pipettes. Its components work in unison to create a precise and controlled mechanism. Below is a detailed breakdown of its key parts: Types of Pipette Fillers Pipette fillers are available in ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Pipetting Definition Pipetting is the process of using a pipettor to measure and dispense small volumes of liquid. It is a fundamental technique used in many laboratory procedures, including preparing solutions, dispensing samples for analysis, and performing various types of assays. When pipetting, the user first sets the desired volume on the pipettor by adjusting ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Pits? What are primary pit fields? Structure of Pits Pits are vital components of plant cell walls, playing a crucial role in intercellular communication and the transport of water and nutrients. Their structural complexity allows for efficient functioning, contributing to the overall physiological processes of plants. The following points outline the key structural ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Pituitary Gland? Definition of Pituitary Gland The pituitary gland is a small, pea-sized endocrine gland located at the base of the brain, beneath the hypothalamus. It is often termed the “master gland” because it produces and secretes hormones that regulate various bodily functions, including growth, metabolism, and reproduction, and controls the activity of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Placenta? Definition of Placenta The placenta is a temporary organ that develops during pregnancy and connects the developing baby to the mother’s uterus. It provides oxygen, nutrients, and eliminates waste products from the baby’s blood. Types of Placenta There are several types of placenta, characterized by different factors and arrangements. Here are the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Life supporting characteristics and biological importance of water to plants The life-supporting characteristics of water stem from its unique physical and chemical properties, which play an essential role in biological systems, particularly in plants. The significance of water in plants can be attributed to its role in chemical reactions, germination, nutrient transport, temperature regulation, and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

In this article we will learn about Plant Breeding Introduction and objectives. Breeding systems: modes of reproduction in crop plants. Important achievements and undesirable consequences of plant breeding. What is Plant Breeding? History of plant breeding The history of plant breeding is deeply intertwined with the earliest human agricultural practices. As humans began to cultivate ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Animals, fungi and protists are composed of at least one eukaryotic cell. However archaea and bacteria are composed of only one prokaryotic cell. Plant cells differ from cells belonging to other organisms due to their cell walls, chloroplasts and the central vacuole.

The fact that they are both cells that are eukaryotic, meaning they have a real nucleus that is enclosed and separate from other organelles through a nuclear membrane is a key element which determines their ways of multiplication. They share the same reproduction process of meiosis and mitosis by using their DNA, which is stored in the cell's nucleus.

What are Plant communities? Definition of Plant community A plant community is a group of plant species that coexist and interact within a specific geographical area, forming a distinct and relatively uniform vegetation patch. Examples of Plant community Characteristics of Plant Communities Plant communities exhibit various characteristics that can be broadly categorized into analytic and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Diagnosis of Plant Diseases The diagnosis of plant diseases is a systematic process that requires careful observation, analysis of symptoms, and consideration of various environmental factors. An accurate diagnosis is critical for effective management and control strategies, as it enables the identification of the underlying causes of plant distress. The following steps outline the essential ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Plant Growth Promoting Rhizobacteria (PGPR)? Mechanism of action of Plant Growth Promoting Rhizobacteria (PGPR) The synthesis of different chemicals alters the entire microbial community in the rhizosphere niche to facilitate PGPR-mediated plant growth promotion. In general, PGPR stimulates plant growth either directly by enabling resource acquisition (nitrogen, phosphorus, and critical minerals) or indirectly ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Plant growth regulator? Types of Plant Growth There are several distinct types of plant growth, each characterized by specific processes and outcomes. These growth types define how plants develop in size, form, and function throughout their life cycle. Below is a detailed breakdown of the main types of plant growth: Factors Affecting Plant ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Plant Introduction? Types of Plant Introduction Plant introduction, a crucial aspect of crop improvement and agricultural development, can be categorized into two main types: primary introduction and secondary introduction. Each type serves distinct purposes and involves different processes to enhance crop varieties. 1. Primary Introduction 2. Secondary Introduction History of Plant Introduction The ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Plant Metabolism? What is Catabolism? Catabolism is a fundamental metabolic process that plays a crucial role in living organisms, including plants and animals. The primary aim of catabolism is to extract energy from biomolecules, converting it into adenosine triphosphate (ATP), which serves as an energy currency for cellular activities. Additionally, catabolism generates essential ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Plant Tissue Culture? Plant tissue culture Definition Plant tissue culture is a biotechnology technique that involves growing plant cells, tissues, or organs in a controlled, sterile environment on a nutrient medium. This method exploits the totipotency of plant cells, allowing for the rapid propagation of plants, production of disease-free specimens, and conservation of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Plant Tissues? Plant tissues are organized cell groups within a plant that collectively enable essential life functions, like growth, protection, and nutrient transport. There are two main categories of plant tissues: meristematic and permanent. Meristematic tissues contain actively dividing cells that promote growth. Found in regions like root and shoot tips, these cells ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Plant Transformation? What is Pollen Tube-Mediated Gene Transfer? Requirement for Pollen Tube-Mediated Gene Transfer The pollen tube pathway method requires several key components and conditions to be effective in transforming cotton plants. Here are the main requirements: Steps for Pollen Tube-Mediated Gene Transfer Pollen tube-mediated gene transfer (PTT) is a cutting-edge technique that ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Sugar? Sugars Yielding Plants Sugars Yielding Plants The study of plants that yield sugars highlights key species cultivated for their sugar content, spanning tropical and temperate regions. These plants, which vary in terms of geography and method of cultivation, form the foundation of sugar production across the globe. Here is a detailed look ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are plasmids? In addition to the chromosome (nucleoid) of bacteria, the cytoplasm of bacterial cells typically contains genetic components. These genetic components live independently of the chromosome and proliferate as plasmids. or Plasmids are double-stranded, self-replicating DNA segments with a few kilobases that are often found in gram-negative and gram-positive bacterial strains, as well ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Plasmids? Definition of Plasmids Plasmids are small, circular, extrachromosomal DNA molecules found primarily in bacteria that can replicate independently of the main chromosomal DNA and often carry genes beneficial to the host organism, such as those conferring antibiotic resistance. Properties/Characteristics of Plasmids Bacterial plasmids are extrachromosomal DNA fragments that exist within bacterial cells. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Plasmodesmata? Definition of Plasmodesmata Plasmodesmata are microscopic channels that traverse the cell walls of plant and algal cells, allowing for direct transport and communication between adjacent cells. These structures enable the movement of water, proteins, small RNAs, and other metabolites, playing a crucial role in cellular connectivity and plant physiology. Structure of Plasmodesmata ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Plasmodium is also known as the malaria parasite and is the genus of intracellular parasitic protozoa. They are digenetic parasites because Plasmodium are obligate parasites of insects (such as mosquitoes) and vertebrates.

What is Plasmodium Vivax? Epidemiology of Plasmodium Vivax The epidemiology of Plasmodium vivax, a significant human malaria parasite, reveals crucial insights into its global distribution, risk factors, and unique characteristics. Understanding these aspects is essential for developing effective control strategies and mitigating the burden of this disease. In the United States, malaria remains a public ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Plasmolysis? Definition of Plasmolysis Plasmolysis is the process in which plant cells contract or shrink due to the loss of water when exposed to a hypertonic solution. Stages of Plasmolysis Plasmolysis is a complex process that occurs in plant cells when exposed to hypertonic solutions, leading to water loss and cellular contraction. This ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Plastid is a two-membrane-bound organelle that is involved in the synthesis and preservation of nutrients. typically found in the photosynthesis cells of plants. Plastids were first discovered and identified in the work of Ernst Haeckel, but A. F. W. Schimper was the first to offer an accurate definition.

PCA, also known as plate count (PCA) is an bacteriological medium that is used to determine the total amount of aerobic live bacteria present in a sample. This is not considered to be a specific medium. The quantity of bacteria is expressed in units of colony-forming units per Gram (CFU/g) in solid samples, and per milliliter (CFU/ml) for liquid samples. The preferred method is to use the pour plate method. The samples are dilute and the appropriate dilutions added to Petri plates. Sterile molten Agar is added to the plates. The plates are rotated with care to ensure an even mixing of the sample with the agar. The plates are then incubated at 20 or 30degC over three days. After incubation, the amount of colonies counted is recorded on the plate using 25-250 colonies, which is believed to provide the most precise results. When calculating the amount of bacteria present within the specimen, the dilution factors is to be considered.

What are Platelets (Thrombocytes)? Platelets (Thrombocytes) Definition Platelets, also known as thrombocytes, are anucleated cells derived from megakaryocytic cells in the bone marrow. They are the second most abundant cells in the blood circulation and play a crucial role in maintaining hemostasis by initiating blood clotting. Platelets also have non-hemostatic immune functions and can release ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Pleiotropism? Short Definition of Pleiotropism Pleiotropism refers to the phenomenon where a single gene or mutation affects multiple, seemingly unrelated traits or physiological processes. This occurs when one genetic change leads to a range of different effects across various aspects of an organism’s phenotype. Types of pleiotropy Examples of Pleiotropism Significance of Pleiotropism

Properties  There are three unique morphological phases in this organism: Pathogenesis and Immunity  Clinical Syndromes  Epidemiology  Laboratory Diagnosis Treatment Prevention and Control 

It is designed in a way that is compact and portable which is why it's called a pocket'. They're pocket-sized however some are bigger. Their size is not enough to be able to hold a mirror in order to put the image in the proper place. However, they contain a small stage where one can place an object to observe.  They're portable so that they can be utilized by both professionals and amateurs according to the task they're designed to fulfill.

What is Point mutation? Definition of Point mutation A point mutation is a genetic mutation involving a change in a single nucleotide base in the DNA or RNA sequence, which can affect the sequence of amino acids in a protein. Causes of Point mutation Point mutations are primarily caused by various mechanisms that affect the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Poison Apparatus of Snake Poisonous apparatus of snakes include the following parts; 1. Poison Glands 2. Poison Ducts of Snakes 3. Fangs Fangs are specialized teeth found in certain species of snakes that have evolved to inject venom into their prey. These elongated, curved, sharp, and pointed teeth serve as a mechanism for delivering venom ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Polarizing Microscope? A polarizing microscope is an optical microscope that allows one to see birefringent materials—materials that give off two rays of light moving at varying speeds and indices of refraction—and contains certain added components for enhanced viewing contrast and more precise structural detail. As for the components of the microscope procedure that ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Polio Virus Structure of Polio Virus In summary, the poliovirus is a small, simple virus that contains a naked RNA genome enclosed in a protein shell. The capsid is composed of four structural proteins that form the basic building blocks of the capsid. The virus does not have a lipid envelope and is insensitive to ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Pollen? What are Pollen Grain? Characteristics of Pollen Grain Structure of Pollen Grain The structure of pollen grains, also known as microspores, is a fundamental aspect of plant reproduction and offers insights into evolutionary and taxonomic relationships among plant species. Pollen grains are minute, unicellular structures with complex features that can be categorized ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Pollen? Requirements for Pollen Microscopy Sample Collection for Pollen Microscopy Observation of Pollen Under Stereo Microscope Requirements Procedure for Observation of Pollen Under Stereo Microscope Observing pollen grains under a stereo microscope is a captivating journey into the hidden world of botanical wonders. With its ability to provide a three-dimensional view, the stereo ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Pollen-pistil interaction is a critical phase in plant reproduction, acting as a sophisticated biological dialogue between male pollen grains and the female reproductive structure, the pistil. When pollen lands on the stigma—the sticky tip of the pistil—it doesn’t immediately guarantee fertilization. Instead, the pistil initiates a series of biochemical checks to assess compatibility. These interactions ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Pollination? Definition of Pollination Pollination is the transfer of pollen from the male part (anther) of a flower to the female part (stigma) of the same or another flower, enabling fertilization and seed production. Process of Pollination Pollination is a critical phase in the reproductive cycle of flowering plants, involving several key steps: ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Polyacrylamide Gel Electrophoresis (PAGE)? Definition of Polyacrylamide Gel Electrophoresis (PAGE) Polyacrylamide Gel Electrophoresis (PAGE) is a technique used to separate and analyze proteins or nucleic acids based on their mobility in a porous polyacrylamide gel matrix under the influence of an electric field. Types of Polyacrylamide Gel Electrophoresis (PAGE) There are several types ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Polyculture of Fishes? Indian Polyculture System In India, the polyculture system has evolved significantly over time, primarily focusing on the integration of various fish species to optimize production in aquaculture. Initially, this system prominently featured Indian major carps such as rohu (Labeo rohita), catla (Catla catla), and mrigal (Cirrhinus mrigala). Subsequently, the practice ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Polyembryony? Definition of Polyembryony Polyembryony is the development of multiple embryos from a single ovule or seed, resulting in several embryos within the same seed, which are genetically identical to each other but distinct from the parent plant. Types of Polyembryony Polyembryony can be classified based on various criteria including the source of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Polygenic Inheritance (Quantitative inheritance)? Definition of Polygenic Inheritance Polygenic inheritance is a genetic mechanism where a single phenotypic trait is controlled by the additive effects of multiple genes, resulting in continuous variation rather than discrete categories. Characteristics of Polygenic Inheritance Examples of Polygenic Inheritance in Humans This section explores how polygenic inheritance influences ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Polymerase chain reaction or PCR is a laboratory technique that is used to make multiple copies (millions or billions!) of a specific region of DNA in vitro (in a test tube rather than an organism).

What is Polymorphism in cnidarians? The majority of polyps are sessile, whereas meduase types are motile. Nonetheless, there is a similarity between the two in their fundamental characteristics. Importance of Polymorphism Polymorphism is fundamentally a phenomena of labour division. Rather than assigning diverse functions to the components or organs of a single individual, distinct functions ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Polyploidy plays a pivotal role in plant breeding, especially in enhancing the genetic diversity and adaptability of crops. Polyploidy refers to the condition in which a plant has more than two complete sets of chromosomes, a state that naturally occurs due to irregularities in mitotic or meiotic divisions. These irregularities can lead to an increase ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Polysaccharide? Characteristics of Polysaccharides Polysaccharides possess several characteristic properties: Chemically, polysaccharides are characterized by their complex structure, consisting of multiple monosaccharide units linked together by glycosidic bonds. The general chemical formula of polysaccharides is (C6H10O5)n, where “n” represents the number of monosaccharide units in the polysaccharide chain. Polysaccharides exhibit great structural diversity, ranging ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Pond Water and Microorganisms Pond water is a fascinating ecosystem teeming with life, both visible and invisible to the naked eye. It encompasses a wide range of microorganisms, which are crucial to the balance and health of this aquatic environment. These tiny organisms contribute to various ecological processes, making the study of pond water a ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Population? Definition of Population Population can be defined as the total number of individuals, whether human, animal, plant, or microorganism, residing in a specific area or ecosystem. Features/Characteristics Of Population Population characteristics are fundamental in understanding ecological dynamics, encompassing various aspects such as size, density, dispersion patterns, and dispersal mechanisms. The properties of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Population, a term derived from the Latin word populus meaning “people,” refers to a group of organisms belonging to the same species that live in a specific geographical area and have the potential to interbreed. In ecological terms, a population is an assemblage of individuals of a species that occupy a particular space at a ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Population genetics is a subfield of genetics that focuses on understanding how genetic variation is distributed across populations, and how these variations evolve over time. A population, in this context, refers to a group of individuals from the same species that occupy a specific geographic area and have the potential to interbreed. Unlike isolated groups, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Positive displacement pipettes are characterised by piston-driven displacement. The piston in a positive displacement pipette makes direct contact with the sample, which allows the aspiration force to remain constant. Air displacement pipettes accurately dispense the majority of liquids. However, the precision may be affected negatively by the solution’s viscosity, volatility, surface tension, and temperature. For ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Since the late 1950s and early 1960s, the positive staining approach has been employed to increase the contrast of biological materials (tissues and cell structures, viruses, etc.). The samples are treated in heavy metal salt solutions that react with cellular structures using this technique and negative staining. Uranyl acetate and lead citrate are the most ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Post-glycolysis processes Glycolysis is a process that involves: Glucose + 2 NAD+ + 2 ADP + 2 Pi → 2 pyruvate + 2 NADH + 2 H+ + 2 ATP Glycolysis could not continue indefinitely if all NAD+ was used up and glycolysis would cease. Organisms must be capable of oxidizing NADH back into NAD+ ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What Are Post-Harvest Diseases? Classification of Post-Harvest Diseases Post-harvest diseases can be classified based on the timing of pathogen infection, specifically focusing on two primary categories: field pathogens and storage pathogens. This classification aids in understanding the nature and timing of infections that affect harvested plant products, allowing for more effective management strategies. Types of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Post-harvest technology? Principles of Post-Harvest Technology (PHT) Post-harvest technology (PHT) is a crucial component in the agricultural sector, serving as a scientific approach to ensure the efficient handling, preservation, and processing of food commodities after harvest. Its principles focus on maintaining product quality, minimizing losses, and enhancing the value and utility of agricultural ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Post-transcriptional modification is a set of biological processes common to most eukaryotic cells by which an primary RNA transcript is chemically altered following transcription from a gene to produce a mature, functional RNA molecule that can then leave the nucleus and perform any of a variety of different functions in the cell.

Potato Dextrose Agar (PDA) is commonly abbreviated as PDA. Potato Dextrose Agar has been suggested by APHA and F.D.A.for the count of moulds and yeasts during the testing of food items and dairy products.

The pour Plate Method technique was created in the laboratory by Robert Koch and is still widely used in the laboratory since his time. This technique is appropriate for Microaerophilic, facultative, or anaerobic microorganisms. It is straightforward to use, requires fewer resources, and is simple and cost-effective. However, it requires the specimen to be placed ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Poxviruses? Classification of Poxviruses Based on whether they infect insect or vertebrate hosts, the family Poxviridae has been divided into two subfamilies: Chordopoxvirinae and Entomopoxvirinae. The subfamily Chordopoxvirinae encompasses viruses that infect vertebrate hosts and consists of eight genera, at least four of which cause human illness. These are the categories: The genera ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is lesion nematode? Symptoms of lesion nematode Lesion nematode infestations can cause a range of symptoms in both herbaceous and woody plants, primarily affecting root systems and leading to noticeable aboveground effects. The severity of symptoms depends on nematode population levels, environmental conditions, and plant susceptibility. The following list outlines key symptoms and contributing ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Definition of Prebiotics Types of Prebiotics There are numerous varieties of prebiotics. The majority of them are a subset of carbohydrate groups and are largely oligosaccharide carbohydrates (OSCs) (OSCs). 1. Fructans 2. Galacto-Oligosaccharides 3. Starch and Glucose-Derived Oligosaccharides 4. Other Oligosaccharides 5. Non-Carbohydrate Oligosaccharides Criteria for Eligibility as Prebiotic To qualify as prebiotic, food items ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Precipitation Reaction? Precipitation Reaction Definition Precipitation reaction refers to a chemical reaction in which two soluble substances react to form an insoluble solid compound, known as a precipitate. This reaction occurs when two aqueous solutions containing ions combine, resulting in the formation of an insoluble product that settles out of the solution as ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Predation? – Predation Definition Characteristics of Predators 1. Physical adaptations 2. Diet and behaviour 3. Camouflage and mimicry 4. Venom 5. Electric fields 6. Physiology Types of Predators Predation comes in four main forms: 1. Carnivory Example of Carnivorous Predation 2. Herbivory Example of Herbivorous Predation 3. Parasitism Examples of Parasitic Predation 4. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

This is the recipe for the crystal violet stain used in the Gram stain and other staining procedures.

pH Buffer solution A pH buffer or hydrogen ion buffer is defined as an aqueous solution that is composed of a mixture of a weak acid and its conjugate base, or vice versa. In addition of a small amount of strong acid or base, it shows very little changes in pH. pH buffer is mainly ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The process of growing an organism in the surface of a medium is known as culture. The food source that supports the development of the organism is known as a culture medium. The media for culture are designed so that the organism will receive all the nutrition requirements. However, the media for culture are made in laboratories by weighing and dispensing particular ingredients or by purchasing ready-made media on the market. The majority of the media include organic as well as inorganic nutrients. However, to cultivate a variety of microorganisms, special media are created. If the media is to be solidified required, agar-agar can be mixed with other ingredients. The culture media can be classified into three categories that include semi-synthetic, natural and synthetic media each of which is employed for microbiological studies.

If the broth medium is supplemented with agar-agar it is referred to as agar medium like the nutrient Agar Medium (NAM) for the cultivation of bacteria potato dextrose (PDA) medium for the cultivation and storage of general fungi Czapek Dox agar (CDA) medium for fungi, starch-casein (SCA) media for the cultivation of actinomycetes, and so on.

Microorganisms are everywhere in their the distribution. In any given environment, many microorganisms are present at any given time. It is difficult to identify a specific kind of microbe until we understand their ecological needs. For instance, anaerobic microbes do not require oxygen those that are aerobic require oxygen micro-aerophiles to have oxygen however, in a small amount. So, we require cotton plugs to provide an conditions that are aerobic and keep the growing culture uninvolved with unwanted microbes. Cotton plugs are made of cotton along with air pours. Air can flow through air pours, but not the bacteria that cause microbial contamination. They are fixed to the surface of cotton fibres , and prevent them from being able from getting into flasks, tubes, etc. Air aids in for the development of microorganisms within glass equipment.

Causes of Canned Foods Spoilage  Appearance of The Unopened Container Types of Biological Spoilage of Canned Foods  Typically, types of microorganism-induced spoiling of canned foods are separated into those caused by thermophilic bacteria and those caused by mesophilic microorganisms. Other approaches for categorising types of food spoilage are based on the types of changes that ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Contamination Of Sugars And Sugar Products Sucrose  Maple Syrup  Honey  Candy  Preservation Spoilage Sucrose During the production of sugar, the original cane or beet juice becomes increasingly purified toward sucrose and the concentration of sugar in solution increases until crystalline sugar and high-sugar molasses are produced. The more pure a product is, the less suitable ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Preservation of meat and meat products from microbial spoilage is crucial for several reasons: By implementing appropriate preservation methods, following good manufacturing practices, and adhering to recommended storage and handling guidelines, the risks associated with microbial spoilage can be minimized, ensuring the safety, quality, and availability of meat and meat products for consumers. Methods for ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Preservation of milk and milk products refers to the methods and techniques used to prevent or slow down the spoilage and deterioration of these products, thereby extending their shelf life and maintaining their quality and safety. Preservation methods aim to inhibit or control the growth of microorganisms, enzymes, and other factors that can lead to ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Contamination of Meats and Meat Products – Contamination source and causes Meat spoilage can occur through natural processes as well as microbial contamination. Let’s explore the factors responsible for microbial contamination and the events that take place during the rigor mortis phase after animal slaughter: These events and factors emphasize the importance of proper hygiene ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Milk and milk products that provide nutrition have been of fundamental importance since ancient times. These are aids for improving the economic status of farmers and sellers, as well as the health of consumers. However, microbial contamination may cause these products to spoil, resulting in the potential loss of not only producers and sellers, but ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The discussion of poultry focuses primarily on chicken meat, but the principles also apply to the meat of turkey, geese, ducks, and squab. Contamination of Poultry Preservation of Poultry 1. Asepsis  2. Use of Heat  3. Use of Low Temperatures  a. Chilling  b. Freezing  4. Use of Preservatives  5. Carbon Dioxide Atmosphere  6. Use of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Contamination of Vegetables And Fruit Preservation of Vegetables  Microorganisms on the surfaces of freshly picked fruits and vegetables comprise not just the regular surface flora, but also microorganisms from the soil and water, and possibly plant diseases. Additionally, a variety of moulds and occasionally a few yeasts may be present. Some germs may thrive between ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Immune Response? What is Primary Immune Response? Mechanism Stages of Primary Immune Response When an individual is exposed to an antigen for the first time, an initial immune response that is very transient and feeble occurs. This can be separated into four phases: lag, exponential, steady state, and decline. Lag (latent) phase Exponential ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Primary consumers are fundamental components of ecological food chains, holding a critical position as the link between producers and higher trophic levels. In essence, they are organisms that feed directly on primary producers, typically plants or algae, which are capable of photosynthesis. Occupying the second trophic level, primary consumers are mostly herbivores, although some omnivorous ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Data has become the lifeblood of businesses and organizations of all stripes in today’s increasingly digital environment. The ability to gather, store, and analyze massive amounts of data has completely altered the ways in which we think about problems, formulate solutions, and acquire understanding. Primary databases, the bedrock of effective data management, are at the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Primer? Types of Primers There are two main types of primers: DNA primers and RNA primers. DNA primers are commonly used in vitro, specifically for PCR amplification and DNA sequencing. On the other hand, RNA primers are utilized in in vivo processes like DNA replication and cloning. 1. DNA Primers: 2. RNA Primers: ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is aerodynamics? Aerodynamics is the branch of science and engineering that deals with the study of how gases, particularly air, interact with moving objects. It focuses on understanding the forces of drag and lift that are induced by the flow of air over and around solid bodies. While aerodynamics encompasses a wide range of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Unwanted microorganisms can cause food to be contaminated. The contamination is usually natural, but it can also be artificial. Natural contamination is when microorganisms attach to food during its growing stages. For example, Fruits are often contaminated by yeasts, which ferment the fruits' carbohydrates. Artificial contamination is when food is improperly handled or processed.

What are Prions? Definition of Prion A prion is an infectious, misfolded protein that causes neurodegenerative diseases by inducing abnormal folding of normal cellular proteins, leading to the accumulation of these misfolded proteins in the brain. Unlike other infectious agents, prions lack nucleic acids and propagate their abnormal structure through direct protein-protein interactions. Characteristics of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Probiotics Definition Probiotics are living microorganisms that mitigate the negative effects of antibiotics by restoring the body’s natural homeostasis. Probiotics are identified by their genus, species, and a strain-specific identifying name (e.g. Lactobacillus rhamnosus GG) and are available in a range of formulations, including yoghurt drinks, pills, and nutritional supplements. Probiotic Bacteria The majority of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Evolution? Evolution refers to the process of change and development that occurs in living organisms over successive generations. It is the central concept in biology that explains the diversity of life on Earth and how species have come to exist in their present forms. Evolutionary theory explains how species evolve through the gradual ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is a Producer? Types of Producers Phototrophs and chemotrophs are the two most common forms of primary producers. Phototrophs  Word origin: photo– (light) + troph (nourishment) On occasion, the terms’secondary producers’ and ‘tertiary producers’ are employed. Animals that devour plants are secondary producers because they “generate” biomass for their predators. Likewise, carnivores that are ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Production Media? Production media, often associated with the fermentation industry, plays a crucial role in the cultivation of specific strains for the purpose of generating either microbial cells or biochemical products. This media, essentially a growth environment, is meticulously formulated to support the development and productivity of designated microbial strains under controlled conditions. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Sources of industrially significant microorganisms and methods for isolating, preserving, and maintaining them, as well as strain improvement, A production strain is the most crucial factor for the success of any fermentation enterprise. Utilizing a producing strain with the following four traits is extremely desirable: 1. Screening Techniques Screening refers to the detection and isolation ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

In the previous article we learned about cell structure and functions. Now in this article we will learn about Prokaryotic and eukaryotic cells. Introduction Hey, if I told you, that you are surrounded by 100 trillion bacterial cells, would you believe? Yes, If you look closer than you will find trillions of bacterial cells on ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

It is important to note that the distinction between prokaryotes as well as eukaryotes was clearly established by microbiologists Roger Stanier and C. B. van Niel in their 1962 paper on the concept of bacteria (though they used the words procaryote as well as eucaryot in the paper).

What is Prokaryotic DNA Replication? Structure of Ori C OriC (Origin of Chromosome) is the specific locus in Escherichia coli where DNA replication is initiated. This critical region is located at approximately the 84.5 mpu position on the E. coli genome, situated opposite to the replication termination site. The structure of OriC is characterized by ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Prokaryotic Ribosomes? Definition of Prokaryotic Ribosomes Prokaryotic ribosomes are molecular complexes consisting of ribonucleic acid (RNA) and proteins that facilitate protein synthesis within prokaryotic cells, such as bacteria and archaea. Ribosome Subunits Ribosomes, intricate molecular complexes responsible for protein synthesis, consist of two essential subunits in prokaryotic cells, collectively referred to as the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Prometaphase? Definition of Prometaphase Prometaphase is a stage in eukaryotic cell division characterized by the breakdown of the nuclear envelope and the attachment of microtubules to chromosomes, preparing them for alignment during metaphase. What Happend in Prometaphase? In prometaphase, several key events take place during eukaryotic cell division: Overall, prometaphase sets the stage ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Prophase? Definition of Prophase Prophase is the initial stage of cell division in eukaryotes, characterized by the condensation of chromosomes, the separation of centrioles, and the breakdown of the nuclear envelope. What Happens in Prophase? Pointers to prophase Prophase, a pivotal stage in cell division, is marked by several distinct events that prepare ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Prophase I? Definition of Prophase I Prophase I is the initial stage of meiosis I, characterized by the exchange of genetic material between paired homologous chromosomes through homologous recombination, leading to increased genetic variation. This phase encompasses five sub-stages: leptotene, zygotene, pachytene, diplotene, and diakinesis. Prophase I Glossary of Terms By understanding these ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Prophase II? Definition of Prophase II Prophase II is a stage in meiosis II where chromatin condenses into distinct chromosomes, the nuclear envelope disintegrates, centrosomes migrate to opposite poles, and the spindle apparatus forms, preparing the cell for subsequent division. Unlike Prophase I, no crossing over of chromosomes occurs in this phase. What ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The protection of plant varieties is crucial for preserving national resources and advancing agricultural development. Farmers play a vital role in maintaining and enhancing plant genetic resources, contributing to the creation of new plant varieties. Simultaneously, plant breeders are instrumental in developing these varieties through their research efforts. Therefore, it is essential to safeguard the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Traditional Knowledge (TK)? Significance of Traditional Knowledge (TK) The significance of Traditional Knowledge (TK) is deeply rooted in both cultural identity and practical utility for many indigenous and local communities. It forms a fundamental part of their daily lives and is essential for their continued development and sustainability. The following points outline the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Hey there! Ever wondered how scientists keep track of all the proteins in our bodies? It’s all thanks to protein databases! These handy tools are like giant digital libraries where researchers can find detailed info about proteins. In this article, we’ll break down what protein databases are, explore the different types out there, and check ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Protein Purification? Protein Purification Methods Creating a Crude Protein Extract – Extraction Precipitation and Differential Solubilisation – Concentration of crude extract Ammonium sulfate precipitation Fractional precipitation with acetone Ultracentrifugation Sucrose gradient centrifugation Chromatographic Methods Different chromatographic methods 1. Size Exclusion Chromatography 2. Ion Exchange Chromatography 3. Affinity Chromatography 4. Metal Binding 5. Immunoaffinity ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Protein Synthesis? Protein synthesis is a fundamental biological process that occurs within cells, responsible for the formation of proteins through the assembly of amino acid chains, termed polypeptides. This process is pivotal to the central dogma of genetics and is instrumental in maintaining cellular function and structure. The process of protein synthesis can ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Protein Synthesis Inhibitors? Types of Protein synthesis inhibitors On the basis of target organisms inhibitor of protein synthesis is categories as follows- 1. Acting only on prokaryotes 2. Acting on prokaryotes and Eukaryotes 3. Acting only on Eukaryotes Mechanism of Protein synthesis inhibitors Protein synthesis, a core biological process, occurs at the ribosomal ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Proteins? Definition of Proteins Proteins are large, complex molecules composed of amino acid chains that perform a vast array of functions in living organisms, including catalyzing metabolic reactions, providing structural support, and facilitating cell signaling and transport. Properties of Proteins Synthesis of peptides Peptides are short chains composed of amino acids. These chains, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Morphology of Proteus Proteus demonstrates the following characteristics: Culture of Proteus Proteeae organisms are aerobic bacteria that thrive on common media like nutrient agar. On the medium, colonies of Proteus exude a putrefactive (or “fishy” or “seminal”) stench. Swarming Biochemical properties of Proteus Cell Wall Components and Antigenic Properties Antigens O and H are present ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Protists? Protists are a group of eukaryotic organisms belonging to the Kingdom Protista. They are distinct from animals, plants, and fungi. While all protists are eukaryotes with a nucleus and cellular organelles, they can vary widely in their characteristics. The majority of protists are unicellular, although there are a few multicellular protists, with ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Protochordata? Characteristics of Protochordata Protochordata, often referred to as primitive chordates, exhibit several defining features that differentiate them from more advanced vertebrates. These organisms are primarily marine and show a blend of both invertebrate and vertebrate characteristics. Below is a detailed overview of the key characteristics of protochordates: Classification of Protochordata Protochordate is ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Isolated protoplasts can be cultured in a liquid medium , or semisolid agar medium , either in thin layers or tiny drops of nutrient medium in petridish. The medium used to cultivate protoplasts is the same as that needed for suspension or callus culture. The increase in calcium concentration aids in maintaining the membrane’s integrity. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Protoplast Definition Protoplasts are plant cells that are completely naked with no cell wall however they do have plasma membranes and other components of the cell. They are functional cells, but without the presence of a barrier, cell wall. Protoplasts from various species can be merged to create a hybrid, and this is known as ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The process of somatic fusion is also known as protoplast Fusion, is a kind of genetic modification of plants in which two plant species are merged into a hybrid plant that has the traits of both species the species, an somatic hybrid. Hybrids are created among different species that are of the exact same species ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The protoplast, sometimes referred to as a naked plant cell refers to all the constituents in a cell of plant that are not the wall of the cell. The term”protoplast” was first used in the work of Hanstein in 1880 to refer to the living matter contained within the membrane of the plant cell. The ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Protozoa? Protozoa Definition Protozoa are a diverse group of single-celled eukaryotic organisms that can be either free-living or parasitic. They primarily feed on organic matter, including microorganisms and organic debris. Protozoa are characterized by their lack of a rigid cell wall, motility, and heterotrophic feeding habits. Examples include Amoeba, Paramecium, Euglena, and Trypanosoma. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is PRP Centrifuge? Types of PRP Centrifuge Platelet-Rich Plasma (PRP) centrifuges extract and concentrate platelets from blood samples for therapeutic use. The centrifuge type used can affect PRP quality and effectiveness. Main PRP centrifuge types: In addition to centrifuges, PRP preparation techniques vary: Consider the application, platelet concentration, processing volume, and budget while choosing ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Pseudomonas aeruginosa? Scientific classification of Pseudomonas aeruginosa Domain: Bacteria Phylum: Pseudomonadota Class: Gammaproteobacteria Order: Pseudomonadales Family: Pseudomonadaceae Genus: Pseudomonas Species: P. aeruginosa Morphology of Pseudomonas aeruginosa Pseudomonas aeruginosa is a Gram-negative bacterium with several distinctive morphological features that contribute to its pathogenicity and ability to thrive in various environments. Below is a breakdown of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Pseudomonas Aeruginosa Principle The MacConkey Agar is a specialized culture medium widely used in microbiology for the isolation, identification, and differentiation of gram-negative bacteria, particularly those belonging to the Enterobacteriaceae family. The principle of MacConkey Agar lies in its combination of selective and differential properties, making it an effective tool in microbiological analyses. The medium’s ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Requirements for Gram stain Procedure Observation of Pseudomonas Aeruginosa Under Microscope When observing Pseudomonas aeruginosa under a microscope, several distinctive characteristics can be noted: In summary, under the microscope, Pseudomonas aeruginosa can be identified as Gram-negative rods with a reddish/pink coloration. They have a rod-like shape, are motile with a polar flagellum (sometimes more than ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Pseudomonas putida? Scientific classification of Pseudomonas putida Domain: Bacteria Phylum: Pseudomonadota Class: Gammaproteobacteria Order: Pseudomonadales Family: Pseudomonadaceae Genus: Pseudomonas Species: P. putida Habitat of Pseudomonas putida Pseudomonas putida is a versatile bacterium found in a wide range of environments, thriving in both natural and man-made habitats. Its adaptability to various ecological niches is a ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Pseudopod? Definition of Pseudopod A pseudopod is a temporary, arm-like extension of the cytoplasm in eukaryotic cells, primarily utilized for cellular motility and phagocytosis. Composed of actin filaments and other cytoskeletal elements, pseudopods enable cells to move and ingest particles. They are highly dynamic and can adopt various forms, such as lamellipodia, filopodia, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Definition of Pseudostratified columnar epithelium  A pseudostratified columnar epithelium an epithelium made up of only one layer of cells which creates the appearance of multiple layers due to the nuclei in the cells are located at various levels. It is histologically an epithelium that is simple, even though when viewed from a cross-section it could ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Division: Psilophyta Class: Psilotopsida Order: Psilotales Family: Psilotaceae Genus: Psilotum Distribution of psilotum The distribution of Psilotum, commonly referred to as whisk fern, primarily encompasses two species: P. nudum and P. flaccidum. Understanding their geographic spread and ecological niches offers valuable insights into their adaptability and survival strategies. The occurrence of Psilotum The occurrence of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Pteridophyta? General Characteristics of Pteridophytes Pteridophytes are an ancient group of vascular plants known for their distinctive features and diverse forms. They primarily thrive in moist, shaded environments, although some adapt to aquatic or xerophytic conditions. Here are the key characteristics of pteridophytes, focusing on their morphology, structure, and reproductive processes: Habitat of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Dive into the fascinating world of Pteridophyta, the diverse group of vascular plants commonly known as ferns and their allies. This comprehensive guide will explore: Discover the morphology, anatomy, and reproductive strategies of these ancient plants. Uncover their role in ecosystems and learn about their practical uses in today’s world. Whether you’re a botany student, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Pteris is a widely distributed genus of ferns that can be found in various geographical locations around the world. Although this genus is cosmopolitan in nature, it thrives primarily in tropical and subtropical climates. Pteris species are typically located in well-drained environments or in the crevices of rocks, where they exhibit a remarkable adaptability to ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Puberty? Definition of Puberty Puberty is the natural process of physical changes during which a child’s body develops into an adult body capable of sexual reproduction. Effects of early and late puberty onset The effects of early and late puberty onset can have significant implications for both girls and boys. Here’s a breakdown ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Publication of a Research Report? Publication of a scientific research report refers to the process of sharing the findings and outcomes of a research study with the wider scientific community and the general public. It involves preparing a manuscript that describes the research objectives, methodology, results, and conclusions, and submitting it to a ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Pulsed Field Gel Electrophoresis (PFGE) is a highly effective genotyping technique used for the separation and analysis of large DNA molecules, such as entire genomic DNA. It involves digesting the DNA with specific restriction enzymes and applying it to a gel matrix under an electric field that periodically changes direction. PFGE is a modified version ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Pulsed-field Gel Electrophoresis (PFGE)? Principle of Pulsed Field Gel Electrophoresis (PFGE) The principle of pulsed-field gel electrophoresis (PFGE) revolves around the separation of DNA fragments based on their size using an electric field. In conventional gel electrophoresis, small DNA fragments migrate more easily through the gel matrix than large fragments. However, when dealing ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Pureline Selection? Definition of Pureline Selection Pureline selection is a plant breeding method where individual plants are selected from a self-pollinated crop, and their progeny are evaluated. The best-performing progeny, derived from a single homozygous plant, is released as a pureline variety, ensuring genetic uniformity. History of Pureline Selection Characteristics of Pureline Selection ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Principle of PYR Test Purpose of PYR Test Procedure of PYR Test The PYR examination is accessible in many versions. The original PYR test took 16 to 20 hours, but a 4-hour broth assay is now available, as reported in this post. Other forms include quick (10-15 minute) assays in which organisms to be evaluated ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Biomass Pyramid? Definition of Biomass Pyramid A biomass pyramid is a graphical representation of the total biomass or organic matter at each trophic level in an ecosystem, illustrating the flow of energy from producers to consumers. What is Biomass? In the scientific realm of ecology, “biomass” is defined as the cumulative mass of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Pyrimidines and Pyrimidine Nucleotides Structure of Pyrimidines and Pyrimidine Nucleotides Occurrence of Pyrimidines and Pyrimidine Nucleotides Properties of Pyrimidines and Pyrimidine Nucleotides Biosynthesis of Pyrimidine  Pyrimidine Nucleotide Examples Cytosine Thymine Uracil Purines and Purine Nucleotides Structure of Purines and Purine Nucleotides Occurrence of Purines and Purine Nucleotides Properties of Purines and Purine Nucleotides Purine Nucleotides ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Pyronin Y(G) (PY) is a dye used for DNA staining. PY has orange spectral emission that is easily distinguishable from FITC and 7-AAD.

Pyruvate Broth Test Purpose Pyruvate Broth Test Principle Requirement Pyruvate Broth Composition Pancreatic digest of casein (10 gm/L) sodium pyruvate (10 gm/L) yeast extract (5 gm/L) NaCl (5 gm/L) dipotassium Phosphate K2HPO4 (5 gm/L) bromothymol blue (0.04 gm/L) pH 7.3 +/- 0.2 at 25ºC. Pyruvate Broth Test Procedure Expected Results of Pyruvate Broth Test Quality ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Python Programming? Programming in Python refers to the process of creating computer programmes using the Python programming language. Python is a high-level, interpreted programming language renowned for its readability and simplicity. It was developed by Guido van Rossum and published for the first time in 1991. Python is extensively employed in numerous fields, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Two different methods of blood tests, thin and thick microscopy, are considered to be the "gold standard" for the diagnosis of malaria. A Quantitative Buffy Coat(QBC) is an additional quick and direct test to make the identification of malaria.

What is Quantitative Inheritance? Characteristics of Quantitative Inheritance Quantitative inheritance is a complex genetic phenomenon characterized by the inheritance of traits influenced by multiple genes. This type of inheritance plays a critical role in the expression of various traits in organisms, especially those that demonstrate continuous variation rather than discrete categories. Examples of Quantitative Inheritance ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Without data collection, research is incomplete. This begins with the identification of research problems and the design of research. The collection of primary data can be done using a variety of methods, including interviews, observation, questionnaires, schedules and schedules. Schedule and questionnaire are two popular methods for collecting data in research surveys. These two methods ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is R Programming Language? R is predominantly used for statistical computing and graphics. It was devised in the early 1990s at the University of Auckland in New Zealand by Ross Ihaka and Robert Gentleman. R offers a vast array of statistical and graphical techniques and is extensively utilised in a variety of fields, including ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Rabies is a viral disease that causes inflammation of the brain in humans and other mammals. It is transmitted through the saliva of infected animals, usually through a bite. The virus attacks the central nervous system, leading to symptoms such as fever, muscle spasms, and hallucinations. If left untreated, rabies is almost always fatal. It ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Single Radial Immunodiffusion also referred to as Mancini technique is a quantitative immunodiffusion technique that is used to measure the antigen's concentration by measuring the size of the precipitin-based ring created by the interaction between the antigen with the antibody at the optimal concentration. The antibody is embedded in the agarose gel, while the antigen is diffused into it in the form of a radiatal pattern.

Radiation is used to sterilize and decontaminate medical supplies (surgeon supplies, vaccines and drugs) as well as the food and beverage industries. There are two types of radiations available: ionizing or non-ionizing. Radiation sterilization isn’t widely used in the food industry because of concerns about radioactive contamination, toxic or carcinogenic products production, taste alteration, and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Radioimmunoassay (RIA)? Dfinition of Radioimmunoassay (RIA) Radioimmunoassay (RIA) is a highly sensitive laboratory technique that uses radioisotopes to detect and measure the concentration of antigens or antibodies in a sample. Radioimmunoassay (RIA) Principle The principle of radioimmunoassay (RIA) is based on competitive binding, specificity, and sensitivity. In RIA, a radioactive antigen, also known as ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The rapid furfural test is a type of chemical test which is used to determine the difference between fructose and glucose. The test for rapid furfural is like Molisch’s test however it utilizes concentrated hydrochloric acid instead of concentrated sulfuric acid, and the solution is then boiled. A dilute solution of sugar is added in ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Rapid Plasma Reagin (RPR) Test? Principle of Rapid Plasma Reagin (RPR) Test The principle of the Rapid Plasma Reagin (RPR) test is based on the detection of antibodies produced in response to antigens released by damaged host cells during a syphilis infection. The RPR test is a macroscopic, non-treponemal flocculation card test that ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Industrial fermentation processes leverage a wide array of raw materials, with a significant emphasis on utilizing cost-effective and readily available sources. Among these, agricultural by-products stand out due to their abundance and potential for repurposing. The interest in these materials stems from several key factors: The concept of transforming ‘wastes into resources’ is not just ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

When working with centrifuges you’ll encounter two different measurement units that are called the Relative Centrifugal Force (RCF) and the number of revolutions per Minute (RPM). It is essential to be aware of the fact that they are both different. If they are not used correctly (which isn’t as rare as you believe) and the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Reactive Oxygen Species (ROS)? Types of reactive oxygen species (ROS) Reactive oxygen species (ROS) encompass a diverse range of oxygen-containing molecules that exhibit significant chemical reactivity. These species are primarily generated as byproducts of cellular metabolism, particularly through mitochondrial oxidative phosphorylation, as well as through various enzymatic processes. Understanding the types of ROS ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

A real-time polymerase chain reaction (real-time PCR) is a conventional polymerase chain reaction (PCR) based laboratory technique used in molecular biology for real-time monitoring of the amplification of a targeted DNA molecule during the PCR, not at its end, as the conventional PCR do.

What is Receptor? Definition of Receptor A receptor is a specialized protein molecule that selectively recognizes and binds to specific ligands, leading to cellular responses or signal transduction within the cell. Types of Receptors Receptors are specialized protein structures integral to cellular communication and response mechanisms. They are primarily categorized based on their cellular location ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Recombinant DNA? Definition of Recombinant DNA Recombinant DNA (rDNA) is a form of DNA constructed in the laboratory by joining genetic material from multiple sources, creating sequences not naturally found in any organism. Characterisitcs Features of Recombinant DNA Recombinant DNA (rDNA) refers to the formation of new combinations of DNA sequences that are ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Recombinant DNA Technology? Definitions of Recombinant DNA Technology Recombinant DNA technology is a method used to manipulate and combine DNA from different sources to create new genetic combinations. It involves inserting genes from one organism into the DNA of another, allowing for the production of specific proteins or traits not naturally found in ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Red blood cells constitute the primary cellular component in blood. Red blood cells that are mature are biconcave discs which have no nucleus and are devoid of most cell organelles , including the lysomes, endoplasmic-reticulum and mitochondria.

What is Reflex Action? Definition of Reflex Action Reflex action is an automatic and rapid response to a stimulus that occurs without conscious control or thought. It involves the activation of sensory neurons, interneurons, and motor neurons to produce a quick and stereotyped response, often for the purpose of self-preservation or protection. Types of reflex ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Regeneration? Definition of Regeneration Regeneration is the natural process by which organisms restore, repair, or replace lost or damaged body parts through the growth and differentiation of specialized cells, often known as stem cells. Types of Regeneration Regeneration, a pivotal biological process, can be classified into distinct types based on the underlying mechanisms ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Glycolysis is the primary stage in the process of breaking down glucose in order to obtain energy to power the cell’s metabolism. The majority of living organisms perform glycolysis as a part in their metabolic process. This process does not require oxygen, which is why it is considered anaerobic. Glycolysis happens in the cytoplasms of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The regulation of heart rate is a critical component of cardiovascular physiology, influencing overall heart function and health. Heart rate (HR) is defined as the number of times the heart beats within a minute. Together with stroke volume (SV), which is the volume of blood ejected from each ventricle during a single contraction, heart rate ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Repeater Pipette? How Repeater Pipettes Work Repeater pipettes enable the precise and repetitive dispensing of liquid in equal volumes. They improve efficiency by eliminating the need for repeated aspiration. Here’s a breakdown of their operation: Mechanism of Action Parts of Repeater Pipettes Repeater pipettes are designed for precise and efficient liquid dispensing. They ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Reproduction in Protista Methods of Reproduction in Protists The following paragraphs emphasise the two essential reproductive strategies of protists. The procedures are: A. Asexual Reproduction in Protists Mode of Asexual Reproduction In Protista 1. Binary Fission Mitosis is the division of the parent cell into two identical daughter cells. Examples: Amoeba, Euglena and Paramecium. 2. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Protozoa carried out their reproduction by asexual and sexual mode of reproduction. The higher group of protozoa follow mainly sexual reproduction. Some protozoa carried out both asexual and sexual reproduction based on the types of the host cells.

There are different modes of reproduction in fungi such as sexual, asexual, and vegetative modes of reproduction. There are involve different methods in asexual mode, sexual mode, and vegetative mode of reproduction, each of these methods are discussed below; Different modes of reproduction in fungi Mainly there are three types of reproduction in fungi such ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Reproductive System? The reproductive system, also known as the genital system or the reproductive tract, is a collection of organs and structures in the human body that are involved in the process of sexual reproduction. Its primary function is to produce, nurture, and deliver gametes (sex cells) and facilitate the union of sperm ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The reproductive system in insects is highly specialized and varies significantly across species, reflecting their diverse life histories and ecological roles. In general, both male and female insects possess distinct reproductive organs tailored for the production, fertilization, and development of offspring. The male reproductive system typically consists of paired testes that produce sperm, which is ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Reproductive System of Earthworm Male Reproductive Organs of Earthworm The male reproductive system of the earthworm is a meticulously organized structure, designed for the efficient production and transportation of sperm. This system is characterized by a series of specialized organs, each playing a pivotal role in the reproductive process. 1. Testes: 2. Testis Sacs: 3. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Types and modes of reproduction in Fish Reproduction in fish is characterized by diverse methods and strategies that reflect adaptations to their environments. Fish reproduction is broadly categorized into two main types: sexual and asexual reproduction. Each of these methods has distinct processes and implications for the species involved. Organs of reproduction TESTES The testes ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Reptilia? Reptilia Scientific Classification Characteristics of Reptilia The characteristics of animals belonging to Class Reptilia are as follows: Some examples of reptiles include snakes, turtles, lizards, and crocodiles. These animals exhibit a wide range of adaptations and behaviors that have allowed them to thrive in diverse habitats across the globe. Origin of the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Research? Definition of Research Research is a systematic and methodical investigation aimed at generating new knowledge, solving problems, or validating existing information through the collection, analysis, and interpretation of data. Objectives of research The objectives of research are diverse and depend on the specific goals of the study. Research is fundamentally aimed at ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Types of Respiration in Mollusca Mollusca exhibit various types of respiration, depending on their habitat and morphology. Their respiratory systems are adapted to meet the specific demands of their environments. The three primary types of respiration in mollusks are cutaneous, branchial, and pulmonary respiration. Aquatic Respiration in Mollusca Aquatic respiration in mollusks involves the extraction ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What Are Respiratory Pigments? Examples of Respiratory pigments Below are the primary examples of respiratory pigments, highlighting their structure, function, and variations. Comparative analysis of respiratory pigments reveals distinct differences and similarities among them: Evolutionary significance of respiratory pigments The evolutionary significance of respiratory pigments is profound, as these molecules have enabled organisms to adapt ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Respiratory syncytial virus RSV is a member of the family Paramyxoviridae and possesses a continuous, single-stranded, negative-sense RNA genome. Paramyxoviruses are globally significant to both human and animal populations. This family contains several highly contagious viruses, including the human pathogens measles, mumps, and RSV, and the zoonotic viruses Hendra and Nipah. Human RSV (hRSV) is ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The respiratory system of fishes is a highly specialized and efficient mechanism that allows them to extract oxygen from water. As aquatic organisms, fish must adapt to the lower oxygen content in water compared to air, and their respiratory systems have evolved to maximize the efficiency of gas exchange. Below is an overview of the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The respiratory system of a frog is quite interesting because frogs have multiple ways to exchange gases with their environment. Here’s a brief overview: It’s important to note that while frogs have lungs, they rely heavily on their skin for gas exchange, especially when they are in water. This dual mode of respiration allows them ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Respiratory System? The respiratory system is a complex network of organs and tissues in living organisms that is responsible for the exchange of gases, primarily oxygen and carbon dioxide, between the organism and its environment. It plays a crucial role in facilitating the intake of oxygen required for cellular respiration and eliminating carbon ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The restriction enzymes cleave the DNA molecule at a specific site or specific nucleotide sequence, is known as recognition sequences or Restriction sites.

What is Restriction Enzyme (Restriction Endonuclease)? Definition of Restriction Enzyme (Restriction Endonuclease) A restriction enzyme, also known as a restriction endonuclease, is an enzyme that cuts DNA at specific recognition sites, called restriction sites. It is primarily found in bacteria and archaea and serves as a defense mechanism against invading viruses. Restriction enzymes are commonly ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Restriction Fragment Length Polymorphism (RFLP)? Principle of Restriction Fragment Length Polymorphism (RFLP) Restriction Fragment Length Polymorphism (RFLP) is a powerful technique used in molecular biology to analyze genetic variations and identify differences in DNA sequences. This technique relies on the principle that the DNA fragments generated by the digestion of DNA with specific ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Reticulocytes? Reticulocytes are immature red blood cells (erythrocytes) that have not yet completed the final stages of maturation. They are usually produced in the bone marrow and have a characteristic reticulated (network-like) appearance when stained with special dyes. Reticulocytes are important in the evaluation of anemia, as they provide information about the bone ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Retrogressive Metamorphosis Retrogressive metamorphosis refers to a specific type of metamorphosis observed in ascidians or tunicates, which are a type of urochordate. Metamorphosis is a process in which an organism undergoes a profound change in form during post-embryonic development, typically transitioning from a larval stage to an adult stage. In retrogressive metamorphosis, the larva possesses ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is a Retrovirus? Definition of Retrovirus A retrovirus is a type of RNA virus that replicates by converting its RNA genome into DNA through the enzyme reverse transcriptase. This DNA is then integrated into the host cell’s genome, where it directs the production of new viral particles. Retroviruses are associated with various diseases, including ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Reverse grouping is defined as using the reagent cells with known ABO antigens and testing the patient’s serum for ABO group antibodies.

In this method, the Group B Streptococcus (CAMP test positive) is streaked in the center of sheep blood agar, and Clostridium perfringens is streaked perpendicular to it.

Reverse transfection is a technique used in molecular biology to introduce a sample of RNA, DNA or protein into cells in culture. Instead of adding the reagents to the cells and allowing them to take them up (forward transfection), reverse transfection involves incubating the cells on a surface that is coated with the reagents. The ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Reversed-Phase Chromatography? Principle of Reversed-Phase Chromatography The principle of reversed-phase chromatography (RPC) is rooted in the interaction between molecules possessing hydrophobic groups. In RPC, the stationary phase comprises a solid support material that is modified with both hydrophobic and hydrophilic groups. When a sample is introduced into the chromatographic system, the solvent molecules ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is The Rh blood group? Nomenclature of Rh blood group Antigens of the Rh blood group The Rh blood group system consists of 49 antigens, with the most significant ones being D, C, E, c, and e. The specificity of most Rh antigens is determined by the sequence of amino acids in the proteins. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Rhizopus species, such as Rhizopus microsporus, are frequently associated with mucormycosis, a fatal fungal infection that affects immunocompromised patients. Mucormycosis necessitates the development of new therapeutic modalities due to its escalating prevalence, unacceptably high mortality rate, and the extreme morbidity of its highly disfiguring surgical treatment. Creative Biolabs has the knowledge and experience in the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Rhizopus nigricans is a species of fungus belonging to the genus Rhizopus in the order Mucorales. It is commonly known as black bread mold or black mold. Rhizopus nigricans is a saprophytic fungus, meaning it obtains its nutrients from dead organic matter. It is known for its rapid growth and ability to spoil a variety ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Rhizopus oligosporus classification Rhizopus oligosporus is a filamentous fungus belonging to the kingdom Fungi and the phylum Zygomycota (also known as the phylum Glomeromycota). It is further classified into the following taxonomic ranks: So, the complete taxonomy classification of Rhizopus oligosporus is as follows: Morphology of Rhizopus oligosporus The morphology of Rhizopus oligosporus can be ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Habitat of Rhizopus sporangia Rhizopus sporangia are typically found in a variety of habitats where the fungi of the genus Rhizopus thrive. These habitats include: Rhizopus sporangia Characteristics Rhizopus sporangia have several characteristic features that distinguish them from other fungal structures. Here are some key characteristics of Rhizopus sporangia: Rhizopus sporangia Taxonomy Classification Rhizopus sporangia ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Habitat of Rhizopus spp Rhizopus spp. is a genus of fungi found in numerous habitats, including soil, decomposing plant matter, and food. Additionally, they are prevalent in indoor environments, such as homes and businesses. Rhizopus spp. can thrive in a variety of environments, including warm and humid conditions as well as cooler and drier conditions. Additionally, they ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Rhizopus stolonifer is responsible for ripe fruits, such as strawberries, melon, and peach, mainly those contain wounds and higher sugar content. During germination, it produces esterases, including cutinase which enable the penetration of fungus into the plant cell wall.

What is Rhizopus? Mold or Rhizopus Under the Microscope Preparing specimen Studying the intricate world of mold and fungi under the microscope offers a fascinating glimpse into the hidden realms of life. While one can readily discover mold on decaying organic matter in nature, cultivating and preparing specimens for microscopic observation provides a controlled and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The rhizosphere is the narrow zone of soil that surrounds plant roots, acting as a bustling hub of biological and chemical activity. Imagine it as a dynamic marketplace where roots, microbes, and soil particles constantly interact. Plants release a mix of sugars, acids, and other organic compounds through their roots—a process often called “root exudation.” ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Rhodophyceae (Red Algae)? General Characteristics of Rhodophyceae (Red Algae) Rhodophyceae, or red algae, comprise an ancient group of eukaryotic algae characterized by their distinctive pigments, structural diversity, and reproductive strategies. They play a vital role in marine ecosystems and have unique adaptations that enable them to thrive in various aquatic environments. The following ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Ribosomes, sometimes referred to as Palade granules (after the discovery of George Palade and due to their granular shape) are macromolecular devices which are present in every cell, and that carry out biochemical protein synthesizing (mRNA translation).

What are Ribozymes (RNA enzymes)? Structure and mechanism of Ribozymes Splicing pathways of group I and II introns and the spliceosome Group I Group II Types of Ribozymes There are the different types of ribozymes such as; 1. RNase P ribozyme 2. Hepatitis delta virus (HDV) ribozyme 3. Hammerhead Ribozyme 4. Hairpin Ribozyme  5. Group ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Rickettsia? Small-sized intracellular bacteria with a 0.3 to 2 µm range make up the genus Rickettsia. Rickettsia’s tiny scale made it first confused as a virus. Having DNA and RNA as their genetic material, these bacteria reproduce via binary fission within the cytoplasm of eukaryotic cells. Gram-negative rickettsia bacteria abound in the digestive ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

To determine the presence or absence of antigens or antibodies in a patient, many tests have been developed that use the interaction of antibodies and antigens. These tests require specificity and sensitivity. Specificity refers to the property of only binding to one antigen. Sensitivity means that the antibody can recognize and bind the antigen.

What is RNA? Definition of RNA RNA, or Ribonucleic acid, is a nucleic acid molecule that plays a crucial role in gene expression and protein synthesis. It is a single-stranded molecule composed of nucleotides, including adenine (A), cytosine (C), guanine (G), and uracil (U). RNA carries genetic information from DNA and acts as a template ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

RNA Interference Definition RNA interference is the process by which RNA molecules suppress gene expression by neutralising the targeted messenger RNA molecules. RNA Interference Mechanism  The RNA interference mechanism can be explained in the following steps: Why RNAi as a genetic tool? RNA Interference Applications References

Ribonucleic acid (RNA) Polymerase (RNAP) enzyme is a multi-subunit enzyme which uses its function to catalyze the transcription process RNA produced from DNA template.

What is RNA splicing? In order for mRNA to be translated into a protein, RNA splicing removes the intervening, non-coding sections of genes (introns) from pre-mRNA and links the protein-coding sequences (exons) together. Facts of RNA splicing What is Intron? What is Exon? What is Spliceosome? Types of Spliceosome There are two types of spliceosomes: ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Cooked Meat Medium was originally developed by Robertson to cultivate specific anaerobes isolated from wounds. The current formulation is a modified version, sometimes referred to by the name of Chopped Meat Medium, which allows for the growth of a variety of spores and non-spore-forming strict anaerobes.

Rocket Immunoelectrophoresis (RIEP) also known as electro-immuno diffusion is a simple, quick and reproducible method for determining the concentration of antigen (Ag) in an unknown sample. 

What is Osmoregulation? Role of ADH, Renin-Angiotensin and Aldosterone in Osmoregulation 1. Role of ADH (Anti-diuretic Hormone) in Osmoregulation The role of the antidiuretic hormone (ADH), also known as vasopressin, in osmoregulation is pivotal for maintaining the body’s water balance and ensuring the stability of its internal environment. Here’s a detailed and sequential explanation of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

In this article you will. learn about Medico-ethnobotanical sources in India;Significance of the following plants in ethnobotanical practices (along with their habitat and morphology) a) Azadiractha indica b) Ocimum sanctum c) Vitex negundo. d) Gloriosa superba e) Tribulus terrestris f) Pongamia pinnata g) Cassia auriculata h) Indigofera tinctoria. Role of ethnobotany in modern medicine with ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Rolling circle replication? What Is Circular DNA? Mechanism of Rolling circle replication The Rolling circle replication is completed in the following steps; 1. Initiation of Rolling circle replication 2. Elongation of Rolling circle replication 3. Termination of Rolling circle replication As a summary, a typical DNA rolling circle replication has five steps Replication ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Romanowsky staining, also known as Romanowsky–Giemsa staining, is a classic staining technique that paved the way for several different but similar stains widely used in haematology (the study of blood) and cytopathology (the study of cells) (the study of diseased cells). Romanowsky stains are used to distinguish cells for microscopic study in pathological materials, particularly ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Root Cap? Definition of Root Cap The root cap is a protective, cap-like structure at the tip of a plant root, composed of parenchyma cells. It safeguards the sensitive root tip during growth through soil, facilitates downward root growth through gravity perception, and secretes mucilage to ease movement through soil. Structure of Root ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Root Culture? Principle of Root Culture Protocol of Root Culture Below is a detailed protocol outlining the processes involved in initiating root cultures and clones. Importance of Root Culture Root culture is a critical area of plant biotechnology that contributes significantly to our understanding of root physiology and various applications in plant science. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is endodermis? Structure of endodermis The endodermis is a specialized layer of cells that plays a crucial role in the roots of vascular plants. Its structure is uniquely designed to fulfill specific functions essential for the regulation of water and nutrient uptake while providing protection against environmental stressors. Below are the key structural features ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are root hair cells? Structure of Root Hair Root hairs are slender, tubular extensions of epidermal cells located at the root tips, specializing in water and nutrient absorption. Their unique structure is optimized for efficient interaction with the soil environment, allowing plants to maximize the uptake of essential resources. Key Components of Root Hair ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Rotavirus is a family of double-stranded RNA viruses belonging to the genus Reoviridae. Rotaviruses are the leading cause of diarrhea in neonates and young children. By the age of five, nearly every child in the world has been infected with rotavirus at least once.Immunity develops with each infection, reducing the severity of subsequent infections. Rarely ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Acetoacetic acid and acetone react with an alkaline solution of sodium nitroprusside to form a purple-colored complex. This method can detect above 1-5 mg/dl of acetoacetic acid and 10-20 mg/dl of acetone. Beta-hydroxybutyrate is not detected.

What is Rotor Stator Homogenizers? Principle of Rotor-Stator Homogenization (How does a rotor stator homogenizer work?) Parts of Rotor-Stator Homogenization Rotor-stator homogenization normally consists of the following parts: Operating Procedure of rotor stator homogenizers Uses of Rotor-Stator Homogenization Advantages of Rotor-Stator Homogenization Limitation of Rotor-Stator Homogenization Precautions Differences Between Rotor-Stator Homogenizers and High-pressure Homogenizers Aspect ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The rough and smooth ERs are the two kinds of endoplasmic-reticulum that form an interconnected system made up of membrane-bound channels that are located in the cell's cytoplasm. ER is an organelle that is enclosed by membranes found only in the eukaryotic cell.

What is Ribosomal RNA (rRNA)? Discovery of Ribosomal RNA Structure of rRNA Detail Structure of rRNA 5S ribosomal RNA 5S ribosomal RNA Structure Location within the ribosome Functions of 5s rRNA 23S ribosomal RNA Structure 23S rRNA Functions 16S ribosomal RNA Structure Functions of 16S ribosomal RNA 28S ribosomal RNA Structure Functions 18S ribosomal RNA ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Natural Rubber? Para Rubber The Para rubber tree (Hevea brasiliensis) is the main source of natural rubber, contributing 90-95% of the world’s rubber production. This species is indigenous to the Amazon and Orinoco river valleys in South America, where the hot, humid climate provides optimal growing conditions. The region, spanning over one million ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Raymond Sabouraud created Sabouraud Dextrose Aga or SDA in 1892. Sabouraud Dextrose Aggar is useful in the cultivation of fungi (yeasts and moulds), especially for skin infections.

Yeast or Saccharomyces cerevisiae is a eukaryotic, unicellular microorganism and a member of the fungus kingdom. These are the unicellular microorganism which is evolved from multicellular ancestors.

Hemoglobin, often abbreviated as Hb, is a vital protein found in red blood cells (RBCs). Its primary role in the human body includes the transport of oxygen from the lungs to various tissues and the transfer of carbon dioxide from tissues back to the lungs. Additionally, hemoglobin plays a significant role in maintaining the pH ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Genus Salmonella? Scientific classification Domain: Bacteria Phylum: Pseudomonadota Class: Gammaproteobacteria Order: Enterobacterales Family: Enterobacteriaceae Genus: Salmonella History of Salmonella The discovery and study of Salmonella have significantly advanced our understanding of bacterial pathogens. Below is a breakdown of key historical milestones in the study of this genus. Geographical Distribution and Habitat of S. Typhi ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Salmonella Shigella (SS) Agar can be moderately specific and a differing medium used for the cultivation, isolation as well as differentiation Salmonella spp. and a few varieties that belong to Shigella spp.

What is Salmonella? Salmonella is a group of gram-negative bacillus bacteria that is responsible for causing food poisoning and subsequent infections in the intestinal tract. While some infections can be effectively treated, there are certain strains that have developed resistance to antibiotics, making them potentially deadly. Consequently, Salmonella infections should not be underestimated and require ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Salmonellae are common infections in both humans and animals. They practically populate any animal, including livestock, poultry, birds, reptiles, rodents, domesticated animals, and people. One of three clinical syndromes, such as gastroenteritis, enteric fever, or localised disease, are frequently brought on by salmonella infections in humans. Salmonella infections in animals also result in significant losses ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Salt Meat Broth is used as an enrichment medium for staphylococci isolation from severely contaminated specimens.

The ability to develop in the presence of varying concentrations of sodium chloride (NaCl) has been used to distinguish between various bacteria.

ACK Lysis Buffer Preparation ACK Lysis Buffer is used to lyse red blood cells. To prepare 1L of ACK Lysis Buffer the following components are required; Component Amount Concentration NH4Cl (mw: 53.49 g/mol) 8.02 g 0.15 M KHCO3 (mw: 100.12 g/mol) 1 g 0.01 M Na2EDTA (mw: 372.24 g/mol) 37 mg 0.0001 M ACK Lysis ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The process of collecting bacteria from the air for analysis involves several techniques, one of the simplest being the utilization of open Petri dishes filled with a growth medium. These dishes are exposed to the air, allowing airborne bacteria to settle and subsequently grow on the medium, which can then be examined to identify the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The process of collecting bacteria from the air for analysis involves several techniques, one of the simplest being the utilization of open Petri dishes filled with a growth medium. These dishes are exposed to the air, allowing airborne bacteria to settle and subsequently grow on the medium, which can then be examined to identify the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

When examining water samples for bacterial content, direct microscopic observation often yields minimal visible bacteria due to their small size and low concentrations. To overcome this challenge and accurately assess the bacterial population in water, scientists employ the filtration technique. This method is pivotal for both quantifying bacteria per unit volume of water and analyzing ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Exploring the microscopic world within soil requires precise techniques for the effective sampling of microorganisms, such as bacteria. These organisms play crucial roles in various ecological processes, including nutrient cycling, and understanding their presence and diversity is vital for both scientific research and environmental monitoring. Two widely recognized methods facilitate the direct observation of these ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The Davson Danielli model (or the paucimolecular model) was an illustration that depicts the membrane in cells. It was developed in the year 1935 by Hugh Davson and James Danielli The model is a bilayer of phospholipids which is located within two layers of protein globular. the model is trilaminar as well as lipoproteinous.

What is Sandwich ELISA? Sandwich ELISA Principle The principle of sandwich ELISA involves the detection of antigens using a combination of specific antibodies. The test begins by coating and immobilizing a known antibody onto the wells of a microtiter plate. This immobilized antibody serves as the capture antibody, which will bind to the antigen of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Sanger Sequencing? Principle of Sanger Sequencing The principle of Sanger sequencing is rooted in the termination of DNA strand elongation by dideoxynucleotide triphosphates (ddNTPs). These ddNTPs are modified versions of normal DNA nucleotides that lack a 3’ hydroxyl group, which is essential for forming a phosphodiester bond. Without this bond, the DNA strand ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Sanger Sequencing? Sanger Sequencing Workflow/Steps Sanger sequencing is a DNA sequencing method known for its reliability and accuracy. The process involves the formation of a reaction system, amplification of the target segment, gel electrophoresis, and sequence reading. Here’s a step-by-step breakdown of the Sanger sequencing workflow: 1. DNA Sequence for Chain Termination PCR ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Sometimes referred to as saprotrophs saprophytes are organisms that receive nutrition from decaying and dead organic matter, particularly plant matter.

What are Sapwood and Heartwood? Sapwood and heartwood represent two distinct yet essential components of a tree’s structure, playing crucial roles in the overall functionality and durability of wood. Understanding these components is fundamental for students and educators studying plant biology, botany, or forestry. Structure and Development of Sapwood and Heartwood The structure and development ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

SARS-CoV-2 is the virus that causes COVID-19. COVID-19 is a highly infectious respiratory illness that can spread from person to person through respiratory droplets or close contact. The virus was first identified in Wuhan, China in December 2019 and has since spread to become a global pandemic. Symptoms of COVID-19 can range from mild to ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Satellitism Test? Definition of Satellitism Test The Satellitism Test is a biochemical assay used to differentiate Haemophilus influenzae from other Haemophilus species based on their growth factor requirements. In this test, H. influenzae grows proximally to Staphylococcus aureus colonies on blood agar due to the latter’s production of necessary growth factors, a phenomenon ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

A scanning electron microscope (SEM) produces high-resolution images from an electron beam that scans a focused beam over the surface of a specimen. The benefit of using electrons as opposed to an optical light microscope is that, due to electronegativity, the resultant interactions with the orbitals surrounding the atom create signals that indicate surface morphology ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Schistosoma haematobium? Kingdom: Animalia Phylum: Platyhelminthes Class: Trematoda Order: Diplostomida Family: Schistosomatidae Genus: Schistosoma Species: S. haematobium History and Distribution of Schistosoma haematobium Habitat Below are the key aspects of the habitat of S. haematobium: Hosts of Schistosoma haematobium Below are the key aspects regarding its hosts: Characteristics of Schistosoma haematobium Morphology of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Schistosomiasis also termed snail fever or bilharzia is a disease caused by parasitic flatworms called schistosomes. Infection with Schistosoma mansoni, S. haematobium, and S. japonicum causes illness in humans; less commonly, S. mekongi and S. intercalatum can cause disease.

The S. octosporous contain a haploid somatic cell. During the favorable condition, cells undergo through asexual cycle known as fission and haplobiontic sexual cycle.

What is Scientific Method? Definition of Scientific Method The scientific method is a systematic procedure used in scientific research to formulate hypotheses, gather data through observation and experimentation, and draw conclusions based on empirical evidence. It emphasizes objectivity, repeatability, and falsifiability in the pursuit of knowledge. Scientific Method Steps The scientific method is a systematic ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Definition of Epidemiology Overview of Epidemiology Scope of Epidemiology/Objective of Epidemiology The objectives of epidemiology are to:  Major Areas of Discussion in Epidemiology The Major Areas of Discussion in Epidemiology are; Population Disease frequency Disease Distribution  Disease Determinants  Disease Control  Fields of Epidemiology

Microbiology is among the most popular subjects after BiPC and is an important field of Biology that studies the study of fungi, bacteria virus, as well as other microorganisms that can’t be observed with eyesight. Microbiologists identify and study the behaviors of microbes under certain circumstances and the effect they may have on the environment. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

As their name suggests, microorganisms are minute organisms with the potential to adapt to their environment; for instance, commensals can become pathogenic in certain altered environments. The adaptability of microbes to certain treatments or medications remains a challenge for nurses and other medical professionals. Microbiology influences the lives of a nurse working in a medical ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Have you ever wondered how the human body operates? How did we discover that the human body contains 206 bones? How do we know that DNA is our body’s genetic material? Zoology, the study of animals, has enabled us to comprehend our bodies and those of all other species. It is also beneficial to comprehend ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is SDS-PAGE? Definition of SDS-PAGE SDS-PAGE is a technique used to separate proteins based on their molecular weight by using a gel matrix and the denaturing agent sodium dodecyl sulfate (SDS). Overview of SDS PAGE SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis) is a popular method for studying protein mixtures. By sorting proteins depending on ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Seafood toxins and fish and shellfish poisoning pose a significant risk to public health globally. These toxins are present in marine fish, bivalve shellfish, and even freshwater fish, and can cause foodborne illnesses when consumed by humans. While seafood is generally considered nutritious and beneficial to health, it can also harbor various toxins that can ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Secondary Consumers? Definition of Secondary Consumers Secondary consumers are organisms that primarily feed on primary consumers, which are herbivores, in a food chain. They occupy the third trophic level and can be either carnivores, who eat only other animals, or omnivores, who consume both animal and plant matter. Their role is vital in ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Secondary Databases Definition Secondary databases are repositories or resources that are specialized in storing and providing access to specific types of biological data within the field of bioinformatics. The creation of these databases is commonly achieved through the curation, organization, and integration of data from diverse primary sources, including experimental studies, literature, and other primary ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Secretion? Definition of Secretion Secretion is the process by which cells actively transport molecules, often synthesized within the cell, to their exterior environment. Purpose of Secretion How Does Secretion Occur? Cellular secretion is a multifaceted process that involves the transport of substances from the interior of a cell to its exterior. This process ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The classification of secretory tissues in plants The classification of secretory tissues in plants is essential for understanding how they function and interact with their environment. These tissues are broadly divided into two main categories based on their position within the plant body: external secretory tissues and internal secretory tissues. Each category serves specific purposes ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

may contain materials that must be eliminated from the cell. These materials could be harmful to cells, such as end products of chemical reactions or waste products.

What is Seed? Size and shape of Seed The size and shape of seeds exhibit considerable diversity, reflecting their adaptation to various ecological niches and functional requirements. This variability plays a crucial role in dispersal, survival, and germination strategies. Type of seed Seeds can be classified based on various criteria, including the number of cotyledons ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Seed Dispersal? Types of Seed Dispersal Seed dispersal is a critical process for plant reproduction, ensuring that seeds are spread to new locations where they can germinate and grow. Various methods have evolved, each adapted to different environmental conditions and ecological interactions. The primary types of seed dispersal include: Agents of Seed Dispersal ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Class Lycopodiopsida Order Selaginellales Family Selaginellaceae Genus Selaginella Habitat of Selaginella Selaginella species exhibit remarkable diversity in their habitats, being widely distributed across both tropical and temperate regions. The genus, comprising around 700 species, thrives in a variety of environmental conditions, adapting to both humid and arid ecosystems. Below is a detailed exploration of their ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are self pollinated Plants? Self-pollinated plants are those that can fertilize themselves without the need for pollen from another plant. This process occurs when pollen from the flower’s own anthers (the part of the flower that produces pollen) transfers to its own stigma (the part of the flower that receives pollen). Self-pollination ensures that ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Selenite Broth was invented by Leifson who proved that selenite is inhibitory to bacteria, coliforms, and other species, like streptococci from feces, which are found in fecal samples and, consequently, beneficial in the recuperation from Salmonella species. Selenite-F Broth is utilized to enrich the environment that is buffered by Lactose Peptone Broth to which Sodium Biselenite is added to act as the agent that is selective for elimination of Salmonella from urine, feces and water, as well as food items and other substances that are of sanitary significance.

What is Seliwanoff’s Test? Seliwanoff’s Test is a fundamental biochemical assay designed to distinguish between aldose and ketose sugars based on their structural differences. Named after chemist Theodor Seliwanoff, this test leverages the principle that ketoses (sugars with a ketone group, like fructose) dehydrate more rapidly than aldoses (sugars with an aldehyde group, like glucose) when heated with a ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Mode of DNA replication Imagine yourself in 1953, right after the discovery of the double helix structure of DNA. What are some burning questions you and other scientists might have? One big question concerned DNA replication. The double helix shape of DNA gave a tantalising hint about how copying might happen. It seemed likely that ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Sense Organs? Types of Sensory Receptors Sensory receptors in vertebrates are specialized structures that detect various types of stimuli from both the external and internal environments. These receptors convert sensory input into electrical signals, which are then transmitted to the brain for processing. Sensory receptors are classified based on their distribution, location, and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Sensory Receptor? Definition of Sensory Receptor A sensory receptor is a structure or specialized cell that detects and responds to physical stimuli in the environment, both internally and externally. It converts these stimuli into electrical signals that are transmitted to the central nervous system for processing and perception. How Sensory Systems Work? Classification ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Insects possess a diverse array of sensory receptors that enable them to effectively interact with their environments and respond to various stimuli. The primary visual receptors are compound eyes, which consist of numerous individual units called ommatidia, allowing insects to detect light, motion, and color across a broad field of vision. Additionally, dorsal ocelli and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Sequence Alignment? Sequence alignment is a computational technique used to compare and analyze the similarities and differences between two or more sequences of biological data, such as DNA, RNA, or protein sequences. By aligning sequences, researchers can identify conserved regions, detect mutations, infer evolutionary relationships, and predict functional elements. It involves arranging the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is a serial dilution? Serial dilution definition Serial dilution is a methodical process in which a solution is diluted sequentially to produce a series of progressively reduced concentrations. What is the purpose of serial dilution? – Serial Dilution Objectives Serial dilution serves as a foundational procedure in numerous scientific disciplines, especially microbiology. The primary ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is serological pipette? Parts of a Serological Pipette A serological pipette consists of several components that work together to provide accurate liquid handling for precise measurements in laboratory experiments. Each part is essential to the pipette’s functionality, ensuring that liquids can be transferred without contamination and with minimal error. Here are the key parts ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Classification of Serratia marcescens Habitat of Serratia marcescens Serratia Marcescens Taxonomy Serratia Marcescens as a Tracer Organism Serratia Marcescens Symptoms Serratia Marcescens as a Cancer Therapy? Morphology of Serratia marcescens  Virulence Factors of Serratia marcescens Hemolysin production Lipopolysaccharide Extracellular products   Serratia marcescens Pathogenesis  S. marcescens, an emerging multidrug-resistant organism, has the potential to manifest in ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

SARS-CoV is a type of coronavirus that caused a global outbreak of severe respiratory illness in 2002-2003. The virus was first identified in China and quickly spread to other countries, including Canada, where there was a significant outbreak. The symptoms of SARS-CoV include fever, cough, and difficulty breathing. In severe cases, the illness can progress ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Wastewater treatment or Sewage Treatment  Characteristics of Wastewater  Chemical Characteristics  Biochemical Oxygen Demand (BOD) Microbiological Character Wastewater Treatment Process Diverse wastewater treatment technologies exist. We shall explain the treatment methods as they pertain to two distinct circumstances: (1) a single home or unit structure, and (2) a community or municipality. 1. Single Dwelling Unit Anaerobic ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Sex Determination? Definition of Sex Determination Sex determination is the biological process that establishes whether an individual will develop as male or female, typically governed by genetic, environmental, or a combination of factors. It involves mechanisms that direct the differentiation of gonads and the subsequent development of sexual characteristics. Methods for Sex Determination ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Sex-linked Inheritance? Methods for Sex-linked inheritance Sex-linked inheritance refers to the transmission of genetic traits that are carried on the sex chromosomes, specifically the X or Y chromosome. These traits are inherited differently than those located on the autosomal chromosomes due to the unique nature of sex chromosome behavior. The two main categories ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Sexual Behaviour? Factors Affecting Sexual Behaviors Sexual behavior in organisms, including humans, is influenced by a variety of factors. These factors can be broadly categorized into biological, environmental, psychological, and social influences. Here are some key factors that can affect sexual behaviors: It is important to note that these factors interact and vary ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Sexual Reproduction? Definition of Sexual Reproduction Sexual reproduction is a biological process in which offspring are produced through the fusion of male and female gametes, resulting in a diploid zygote that develops into a genetically distinct individual. This mode of reproduction promotes genetic diversity and variation within a species. Features of Sexual Reproduction ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Sheep blood agar The principle of sheep blood agar Haemolysins are exotoxins created by bacteria that kill Red blood cell clots. The haemolytic process can be observed on blood Agar Plates. In blood agar plates, colonies of haemolytic bacterium may be covered by a the clear, uncoloured zone, in which the Red blood cells are ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Shelfords Law of Tolerance? Shelfords Law of Tolerance Shelford’s Law of Tolerance, formulated by Victor Ernest Shelford in 1911, outlines the relationship between organisms and their environmental conditions. The law is a key principle in ecology, describing how the success and distribution of organisms are influenced by their tolerance to various environmental factors. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Shiga toxin-producing Escherichia coli (STEC)? Virulence factors Virulence factors are key components that contribute to the pathogenicity of Shiga toxin-producing Escherichia coli (STEC). Here are some important virulence factors associated with STEC: These virulence factors play crucial roles in the pathogenesis of STEC infections, contributing to the colonization and damage of the intestinal ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Shigella? Shigella is a genus of Gram-negative, facultatively anaerobic, rod-shaped bacteria that is non-motile and non-spore-forming. It belongs to the Escherichia genus and was discovered by Kiyoshi Shiga in 1897. Shigella is a major cause of dysentery and primarily infects humans and certain primates, such as gorillas. This pathogen is not known to ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is shRNA (Short-hairpin RNA)? The shRNA is our short hairpin RNA, which is shorter, artificially manufactured, double-stranded ribonucleic acid that can be used in gene silencing investigations. What is RNA Interference? This mechanism inhibits genes through the targeting of messenger RNA molecules. mRNA is degraded, blocking protein synthesis and transcription. This is accomplished by ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Signal Transduction? Historical Context of Signal Transduction in Plants The study of signal transduction in plants has undergone significant evolution, informed by technological advancements, developments in molecular biology, and an increased understanding of plant physiology. This narrative highlights key milestones in the historical context of this field, illustrating how insights into plant signaling ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is a Signal Transduction Pathway? Definition of Signal Transduction Pathway A signal transduction pathway is a series of molecular events inside a cell that converts an external signal into a specific cellular response. Components of signal transduction Signal transduction involves several key components that are common in both plants and animals. These components include: ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Silent mutations? Definition of Silent mutations Silent mutations are genetic changes in the DNA sequence that do not alter the amino acid sequence of a protein, resulting in no effect on the protein’s function or the organism’s phenotype. Cause of Silent Mutation Silent mutations are genetic changes that do not alter the final ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is silver staining? Silver staining is a powerful and versatile technique used for the detection and identification of proteins in gels. This technique is accomplished by binding silver to the chemical terminal or side chains of amino groups, such as carboxyl and sulfhydryl groups. For decades, silver staining has been used to separate proteins ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Simmons Citrate Agar? Composition of Simmons Citrate Agar Ingredients Gms/liter Magnesium sulfate 0.200 Ammonium dihydrogen phosphate 1.000 Dipotassium phosphate 1.000 Sodium citrate 2.000 Sodium chloride 5.000 Bromothymol blue 0.080 Agar 15.000 Final pH ( at 25°C) 6.8±0.2 Principle of Simmons Citrate Agar The principle of Simmons Citrate Agar revolves around the ability of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

About Simmons citrate agar test Simmons citrate agar test helps in detection of citrate utilizing bacteria. In this test, a specific medium is used called Simmons’ citrate agar which helps to differentiate among various Gram-negative enteric bacilli. Simmons’ citrate agar is a type of selective and differential medium. Which is used for the study of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Definition of Simple columnar epithelium  The simple columnar epithelium, which is one type of epithelium, is made up of a single layer consisting of long, elongated cells. These cells are located in areas where absorption or secretion are the primary functions. The cells of the columnar epithelium can also be modified, just like cuboidal epithelium. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Definition of Simple diffusion  Simple diffusion is one of the types of passive transport that is, as the name implies is the simple movement of solute that happens when the electrochemical potentials of one side of the permeable barrier differ. Principle of Simple diffusion/How does simple diffusion work? In free diffusion across a membrane, solute ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Simple Microscope? Definition of Simple Microscope A simple microscope is an optical device consisting of a single convex lens that magnifies objects by enlarging their image through light refraction. Principle of Simple Microscope Working Mechanism of Simple Microscope This ray diagram in below, explains how simple microscopes is working; Magnification of a simple ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The main purpose of simple staining is to determine the cell shape, size, and arrangement of bacterial cells.

What is Single Cell Protein(SCP)? Definition of Single Cell Protein(SCP) Single Cell Protein (SCP) refers to edible proteins derived from unicellular microorganisms such as algae, yeasts, fungi, or bacteria. It can be used as a protein supplement in human or animal diets and is produced through the cultivation and processing of these microorganisms, which convert ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Single Pan or Unequal Arm Mechanical Balance? Parts of Single Pan/Unequal Arm Mechanical Balance A single pan or unequal arm mechanical balance consists of several key parts that contribute to its functioning and accuracy. Here is a description of the various parts: These parts work together to create a functional and reliable single ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Single Use Bioreactor? Working Principle of Single Use Bioreactor Parts of Single Use Bioreactor Comprising numerous essential components meant to enable effective and sterile biological operations, a single-use bioreactor (SUB) Types of Single Use Bioreactor Offering disposable, pre-sterilized systems that cut turn-around times and eliminate the need for cleaning, single-use bioreactors (SUBs) have ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Small Interfering RNA (siRNA)? Properties of siRNA Structure of siRNA Naturally occurring siRNAs have a well-defined structure consisting of phosphorylated 5′ ends, hydroxylated 3′ ends, and two overhanging nucleotides. Mechanism of siRNA action The following describes the process by which natural siRNA induces gene silencing via suppression of translation. siRNA is also similar ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Skeletal system? Definition of Skeletal system The skeletal system is the framework of bones, joints, and cartilages that provides support, protection, and facilitates movement in the human body. Types of Skeletal Systems There are three main types of skeletal systems found in different organisms: hydrostatic skeleton, exoskeleton, and endoskeleton. Each type of skeletal ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Cartilage and Bone: Key Components of the Vertebrate Skeletal System The vertebrate skeletal system is primarily composed of two types of connective tissue: cartilage and bone. Both play crucial roles in providing structural support, protection, and aiding in locomotion. Although both tissues are essential for the overall functioning of the skeleton, they differ significantly in ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Classification of Fish Based on the Habitat and Skeletal System The classification of fish is primarily based on two factors: the type of skeletal system and their habitat. This categorization facilitates a deeper understanding of their biological and ecological adaptations. Structure of the Fish Skeleton System The composition of the fish skeleton system is intricate ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Skin? Definition of Skin Skin is the body’s largest organ, serving as a protective outer layer that covers and shields internal organs, muscles, and bones. It regulates body temperature, enables sensory perception, synthesizes vitamins, and acts as a barrier against pathogens and environmental damage. Gross Structure of Skin The skin’s composition varies across ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Sludge? Objectives of Treating Sludge 1. Reducing its Volume 2. Stabilizing its Organic Materials 3. Kill off the odor 4. To Ensure it Can be Safely Used 5. Pathogen Inactivation 6. Dewatering 7. The alternative (incineration and landfill disposal) are Not Environmentally Friendly Sources of Sludge Wastes  The following unit operations are the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Small nuclear RNA (snRNA)? Types of  Small nuclear RNA (snRNA) The snRNAs can be divided into two classes on the basis of common sequence  features and protein cofactors. 1. Sm-class RNAS 2. Lsm-class RNAs Structure of snRNA Steps of snRNA gene transcription  phosphorylation of the CTD of Pol II during snRNA gene transcription. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Smell? The Organs of Smell The organs of smell primarily involve the olfactory system, which is responsible for detecting and processing odors. Unlike common misconceptions, the nose itself does not perform the act of smelling; rather, it serves as a conduit for air to reach specialized cells within the nasal cavity. The key ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Smooth Muscle? Definition of Smooth Muscle Smooth muscle is an involuntary, non-striated muscle tissue found primarily in the walls of hollow organs and blood vessels, responsible for functions such as regulating blood flow and propelling substances through organs. Characteristics of smooth muscle Smooth muscle tissue, distinct from its skeletal and cardiac counterparts, exhibits ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is a Social Insect? Characteristics of Social Insects Social insects, including species such as ants, termites, bees, and wasps, exhibit distinct characteristics that allow them to thrive in highly organized colonies. These characteristics ensure cooperation, survival, and efficiency within the colony. Social insects are not only known for their complex societies but also for ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Social behavior refers to interactions between individuals of the same species, often providing mutual or individual benefits. In the case of insects, social behavior has evolved due to its advantages in survival and reproduction. By working together, individuals in insect societies enhance their ability to defend their colony, forage efficiently, and reproduce more successfully, thus ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Soil Biology? What is Soil? Components of Soil The components of soil exhibit variations in their ratios across different locations due to various soil-forming factors, climate, topology, the presence of organisms, human influences, and the duration of their interaction. These components can be broadly categorized into four main groups: The relative proportions and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Definition of Soil Formation The process through which soil grows over time from weathered rock, organic matter, and other components in the environment is known as soil formation. This process involves the interaction of physical, chemical, and biological processes that transform basic materials into a complex, living environment that supports the growth of plants and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Soil Microorganisms or Soil Microflora? The term “soil microflora” is used to describe the community of microorganisms that make up most of the soil’s organic matter and a smaller, colloidal amount of humus. What is Soil Microfauna? What is Soil Microflora? What is Soil Microbiology? Factors Affecting Microbial Community in Soil Like higher ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Soil? Soil Properties Distribution of soil layers Importance of Soil Soil Forming Factors Climate, organisms, relief, parent material, and time are the five major factors that influence the formation of soil. One may say that the local soil environment is determined by the relief, climate, and organisms, which work together to induce weathering ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Solid State Fermentation (SSF)? Definition of solid state fermentation Solid State Fermentation (SSF) is a fermentation method that involves the growth of microorganisms on solid support, such as grain brans or oil seed cakes, without a free-flowing aqueous phase. It is used in various industries to produce valuable metabolites, including antibiotics, enzymes, and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Solid Waste Management? Management of solid waste is the collection, treatment, and disposal of solid material that has served its purpose or is no longer useful. Improper disposal of municipal solid waste can result in unsanitary circumstances, which in turn can lead to environmental contamination and outbreaks of vector-borne diseases, which are transmitted ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Solubility Tests is a type of biochemical test which is performed to check the ability of compounds to dissolve within a liquid solvent.

Chelation Medium Preparation To prepare 1L of Chelation Medium the following components are required. Component Amount Concentration NaCl (mw: 58.44 g/mol) 40.9 g 0.7 M MgCl2·6H2O (mw: 203.3 g/mol) 6.1 g 0.03 M MgSO4·7H2O (mw: 246.47 g/mol) 7.39 g 0.03 M KCl (mw: 74.55 g/mol) 1.49 g 0.02 M EGTA (mw: 380.35 g/mol) 7.6 g ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Somatic Mutation? Definition of Somatic Mutation A somatic mutation is a genetic change that occurs in non-reproductive cells after fertilization, which typically does not get passed on to offspring. Causes of Somatic Mutation Several factors and stressors can contribute to somatic mutations. These can be categorized into endogenous factors, chemical mutagens, physical mutagens, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

MacConkey Sorbitol Agar is an adaptation of the formulation that was described by Rappaport and Henigh. It is selective and differential media for the detection of sorbitol-nonfermenting Escherichia coli serotype O157:H7 associated with hemorrhagic colitis. E. coli serotype O157:H7 is a human pathogen that is associated with hemorrhagic colitis which is caused by the actions of a Shiga-like toxins (SLT).

What is SOS Response or SOS Repair? Definition of SOS Response or SOS Repair The SOS response or SOS repair is a cellular mechanism activated in response to DNA damage, where the cell cycle is temporarily halted to facilitate DNA repair and mutagenesis. Central to this system is the RecA protein, which, when stimulated by ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Southern Blotting is a molecular biology technique used for the identification of a specific DNA sequence in a collected DNA sample.

What is Southern Blot? What is Western Blot? Southern Blot vs Western Blot Here is a detailed comparison between Southern blotting and Western blotting: Feature Southern Blotting Western Blotting Target Molecule DNA Protein Purpose Detection of specific DNA sequences within a complex DNA sample Detection and analysis of specific proteins in a sample Developed By ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Speciation? Definition of Speciation Speciation is the evolutionary process through which new, genetically distinct species arise from an existing species, often due to reproductive isolation and genetic differentiation between populations. This can occur via mechanisms such as allopatric or sympatric speciation. Factors Influencing Speciation Speciation, or the process by which new species arise, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is a Spectrometer? Types of Spectrometers Spectrometers, pivotal instruments in the realm of scientific research, are designed to detect and analyze various properties of substances. These devices are categorized based on their specific functionalities and the type of measurements they are engineered to perform. Herein, we delve into the primary types of spectrometers and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is a Spectrophotometer? Definition of Spectrophotometer A spectrophotometer is a laboratory instrument that measures the amount of light absorbed by a sample and is used to determine properties such as concentration or absorption patterns of substances. Principle of Spectrophotometer Types of Spectrophotometer Spectrophotometers are analytical devices for measuring, at designated wavelengths, the intensity of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Spectrophotometer Cuvette? A spectrophotometer cuvette is a small, usually rectangular container used to hold liquid samples in a spectrophotometer. Spectrophotometers are instruments that measure the amount of light absorbed by a sample as a function of wavelength. The cuvette is an essential component of these instruments because it holds the sample in place ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Sperm Cell? Definition of Sperm Cell A sperm cell, or spermatozoon, is the male reproductive cell in sexual reproduction, produced in the testes through the process of spermatogenesis. It is a haploid cell containing half the number of chromosomes and is designed to fertilize a female egg cell, leading to the formation of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Sphaeroplast? A Spheroplast (or sphaeroplast according to British use) can be described as a microbe organism with a cell wall that is almost entirely gone through the penicillin or Lysozyme. According to certain definitions the term is employed to refer to Gram-negative bacteria. In other definitions, the word also includes yeasts. Spheroplast’s name ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Introduction to Sphagnum Sphagnum is commonly referred to as peat moss, bog turf moss or moss moss due of its ecological significance in the creation of peat and bog. These plants are perennial and thrive in swamps and damp habitats such as rocky slopes, where water accumulates , or in areas where it drips. They ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Sphenodon? Habits and Habitat of Sphenodon Sphenodon, commonly known as the tuatara, exhibits a range of distinct behaviors and occupies specific habitats that have enabled it to survive as a relic of ancient reptilian lineages. These habits and habitat preferences are vital to understanding the unique biology and conservation needs of this species. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Sphingolipid? Definition of Sphingolipid Sphingolipids are a class of lipids that contain sphingoid bases, such as sphingosine, and play important roles in cell signaling and recognition. Structure of Sphingolipid Types of Sphingolipid Sphingolipids are a diverse class of lipids that play important roles in cellular structure and signaling. They can be classified into ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Spinal cord? Definition of Spinal cord The spinal cord is a long, tubular structure made of nervous tissue that extends from the brainstem to the lower back. It is a vital part of the central nervous system, responsible for transmitting nerve signals between the brain and the rest of the body. It plays ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Spindle Fibres? Definition of Spindle Fibres Spindle fibres are microtubule structures that facilitate the separation and movement of chromosomes during eukaryotic cell division. Importance of Spindle Fiber Spindle Fibers are essential structures in the process of cell division, ensuring the accurate and proper segregation of chromosomes. Their significance can be highlighted through the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Spirochete? Definition of Spirochete Spirochete is a type of bacteria characterized by its elongated, helically coiled (corkscrew-shaped) morphology, belonging to the phylum Spirochaetota. These bacteria are known for their unique movement mechanism using endoflagella and can be found in diverse environments, with some species causing diseases like Lyme disease and syphilis. Taxonomic organization ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Spirogyra is a genus of filamentous green algae that belongs to the Chlorophyta phylum. It is commonly found in freshwater habitats and is known for its spiral chloroplasts that give it its distinctive appearance. In this article, you will learn about the definition and structure of Spirogyra, as well as its reproduction process. A detailed ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Spleen? Definition of Spleen The spleen is a large organ located on the left side of the body, below the diaphragm. It acts as a blood filter and plays important roles in immune function, removing old red blood cells, recycling iron, and storing a reserve of blood cells. It is part of the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Spliceosome? Properties of Spliceosome Structure and composition of Spliceosome Components of Spliceosome In addition to the pre-mRNA, spliceosomes include many other RNAs and proteins. Small nuclear ribonucleoproteins (snRNPs, pronounced “snurps”) are a type of RNA-protein complex that includes a small nuclear RNA (snRNA) bound to a protein. Gel electrophoresis enables the snRNAs to ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

For its production, fermented milk and cheese require a specific fermentation or series of fermentations. Therefore, any abnormalities in these fermentations will harm the product’s quality and may even cause it to spoil. Even the final product may be susceptible to deterioration by microbes. Fermented Milks  Cheese Cheese defects may be caused by mechanical or ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is a Chocolate? Contamination source of chocolate The delightful world of chocolate, while enchanting, is not immune to potential sources of contamination. Several factors can contribute to the presence of contaminants in chocolate, compromising its quality and safety. Let’s delve into some of the key sources of contamination associated with this beloved treat. In ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Confectionaries? Contamination source of confectionaries When it comes to the production of confectionaries, it is crucial to be aware of potential sources of contamination that may compromise the quality and safety of these delightful treats. Several factors can contribute to the contamination of confectionaries, ranging from the raw ingredients used to the equipment ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Contamination of Eggs Eggs, in their natural state, are typically sterile. However, contamination can occur after they are laid due to a variety of reasons. It is essential to understand these potential sources of contamination in order to minimize the risk of egg spoilage. The following factors contribute to the contamination and subsequent spoilage of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Spontaneous Generation Theory? Definition of Spontaneous Generation Spontaneous generation is the historical theory that living organisms can arise directly from nonliving matter. Spontaneous Generation Theory The spontaneous generation theory, as delineated by Aristotle in his seminal work “On the Generation of Animals” circa 350 B.C., offers a scientific proposition to elucidate the seemingly ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Sporangium? Definition of Sporangium A sporangium is a specialized cellular structure in plants and fungi responsible for the formation, encapsulation, and dissemination of spores. Characteristics of Sporangium Structure of Sporangium The sporangium is a specialized structure designed for the production and protection of spores. Its structure can vary depending on the organism, but ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Sporothrix schenckii is a globally distributed fungus that was first isolated from a human specimen in 1896 by medical student Benjamin Schenck. The species is found in soil as well as on living and decaying plant matter, such as peat moss, and in soil. It is capable of infecting both humans and animals and is ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Sporozoa? Short Definition of Sporozoa Sporozoa are unicellular, parasitic organisms that undergo complex life cycles involving two hosts and alternating between sexual and asexual stages. Classification of Sporozoa  Characteristics of Sporozoa Motility of Sporozoa Feeding of Sporozoa Types of Spores Sporozoans, a group of parasitic protozoa, can be classified into four categories based ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Spot Indole Test? Definition of Spot Indole Test The Spot Indole Test is a rapid biochemical method used to detect the production of indole by bacteria, indicating their ability to metabolize the amino acid tryptophan. This test aids in differentiating specific bacterial species based on their tryptophan degradation capabilities. Objectives of Spot Indole Test ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Spread Plate Method in microbiology The spread plate method is used to isolate individual colonies from a diluted sample of mix population. Different methods have been developed for the isolation of microorganisms from a mixture sample but among them Spread plate culture method is the most widely used technique in laboratory. An ideal spread plate ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

SSPE (Blot, 20x, pH 7.4) Preparation and Recipe Required components Component Amount Concentration Sodium chloride (mw: 58.44 g/mol) 175.3 g 3 M Sodium Phosphate Monobasic Monohydrate (mw: 137.99 g/mol) 27.6 g 0.2 M EDTA (mw: 292.24 g/mol) 7.4 g 0.02 M SSPE (Blot, 20x, pH 7.4) Preparation Prepare 800 mL of distilled water in a suitable container. Add 175.3 g of Sodium chloride to the solution. Add 27.6 g of Sodium Phosphate Monobasic Monohydrate to the solution. Add 7.4 g of EDTA to the solution. Add distilled water until the volume is 1 L. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Stage Micrometer? Definition of Stage Micrometer A stage micrometer is a calibrated slide with a ruled scale used to calibrate microscopes and measure the size of objects under a microscope. Principle of Stage micrometer The principle of a stage micrometer is based on using a calibrated slide with a known scale to measure ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The development of a chick embryo from a freshly laid hen’s egg involves various stages and intricate processes. Let’s explore the initial stages of chick embryo development based on the provided information: The hen’s egg, when laid, is relatively large, measuring about 3cm in diameter and 5cm in length. It is considered a macrolecithal egg ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Staphylococcal Food Poisoning? Contamination Sources for Staphylococcal food poisoning Production of Toxin during Staphylococcal food poisoning Staphylococcus aureus Enterotoxins Structure of Staphylococcus aureus Enterotoxins Mode of Action of Staphylococcus aureus Enterotoxins The mode of action of Staphylococcus aureus enterotoxins (SEs) involves their ability to induce emesis (vomiting) and activate immune responses. The specific amino acids and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Domain: Bacteria Phylum: Bacillota Class: Bacilli Order: Bacillales Family: Staphylococcaceae Genus: Staphylococcus Species: S. aureus Overview of Staphylococcus aureus Staphylococcus aureus can be described as a gram-positive round-shaped bacterium that is one of the Firmicutes and is a typical member of the microbiota in the body. It is often located in the respiratory tract as ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Starch casein agar can be described as an nutrient-rich medium that is used for the cultivation and growth of the saccharolytic marine bacteria.

Starch Hydrolysis Test Objective Starch Hydrolysis test principle Starch is a polysaccharide that is composed by glucose subunits. The glucose rings may be joined by a 1,4-glucosidic glucosidic link, which results in long, straight chain of glucose. (“1, 4” is a reference to the bond formed between number 1 carbon in one glucose molecule, and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Starter Culture Definition A starter culture is a microbial preparation containing a very high number of cells (such as 1012 g-1) of one or more microbe species that is given to raw material to produce fermented food by accelerating and directing fermentation. Functions of Starter Cultures The fundamental function of lactic starters is to convert ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Principles to maintain active tarter culture The preparation of cultures depends on a number of variables: 1. The choice of milk 2. Heat treatment of milk 3. Containers/Utensils 4. Amount of inoculum  5. Aseptic culture transfer 6. Time of inoculation 7. Cooling Preparation of mother culture The preparation of the mother culture is a crucial ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Stem cell? Stem Cells Definition Stem cells are unique cells in the body that have the potential to develop into different types of specialized cells or divide to produce more stem cells. Properties of Stem Cells Stem cells possess several intrinsic properties that make them unique and give them remarkable capabilities: These properties ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Stem cell? Classification of Stem Cells Stem cells can be classified into different categories based on their origin, potency, and differentiation potential. Here are the main classifications of stem cells: It’s important to note that the classification of stem cells is not always rigid, as there can be overlap and ongoing research to ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Stereoisomerism? Types of Stereoisomerism Stereoisomerism, a form of isomerism based on the three-dimensional arrangement of atoms within molecules, can be classified into two main subtypes: conformational isomerism and configurational isomerism. Configurational isomerism, in turn, can be further divided into two subtypes: geometric isomerism (also known as cis-trans isomerism) and optical isomerism (enantiomerism). These ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Sterilization? Important Definitions Methods of Sterilization A. Physical Methods of Sterilization Method Description Key Agents/Processes Applications Sunlight Utilizes ultraviolet rays for germicidal effects. Reduces microorganisms in natural bodies of water. Ultraviolet Rays Water sterilization Heat Involves dry heat and moist heat to kill microorganisms through protein denaturation and coagulation. Dry Heat, Moist Heat ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Stokes disc diffusion method isn't as well-standardized as Kirby-Bauer's method and is utilized in labs especially where the exact amount of antimicrobial present in discs isn't known because of the difficulty in getting discs and correctly storing them or when other requirements needed for the Kirby-Bauer method cannot be fulfilled.

Wha is Stomata? Definition of Stomata Stomata are tiny pores located on the epidermis of plant leaves and stems that regulate gas exchange, allowing carbon dioxide, oxygen, and water vapor to enter and exit the plant. Each stoma is flanked by guard cells that control its opening and closing, facilitating processes such as photosynthesis and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Stomata? Aim To prepare a temporary mount of a leaf peel in order to show the stomata of a leaf Principle/Theory The principle or theory of the stomata under a microscope experiment is based on the understanding that plants, as primary producers, perform essential physiological processes like photosynthesis and respiration. To facilitate these ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Storage Granules Definition Structure of Storage Granules Storage Granules in Bacteria Storage Granules Function Storage granules have several important functions in cells, including: Overall, storage granules play a critical role in maintaining cellular homeostasis and allowing cells to adapt to changing environmental conditions. FAQ References

What is Stratified cuboidal epithelium? Definition of Stratified cuboidal epithelium  Stratified cuboidal epithelium is a type of epithelial tissue characterized by multiple layers of cells, with the surface layer consisting of cube-shaped cells. It is primarily found in glandular structures and plays roles in protection, selective absorption, and secretion. Stratified cuboidal epithelium labeled Stratified cuboidal ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Stratified squamous epithelium Definition Stratified squamous epithelium diagram and Structure Classification of stratified squamous epithelium The stratified squamous epithelium is divided into two classes based on the accumulation of keratin by the cells towards the surface; Keratinized stratified squamous epithelium Non-keratinized stratified squamous epithelium Function of stratified squamous epithelium Stratified squamous epithelium play an important ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Streak Plate Method Overview There are two types of microbial culture such as mixed culture and pure culture. The mixed culture contains two or more species while the pure culture contains only a single species.  During the identification of a microorganism, the first and important step is to isolate the individual species from a mixed ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Streptococcus pneumoniae Overview Streptococcus pneumoniae, commonly known as pneumococcus, is a Gram-positive, spherical bacterium. It is alpha-hemolytic and belongs to the genus Streptococcus. Discovered by Louis Pasteur and George Sternberg in the late 19th century, it is a significant human pathogen, especially noted for causing pneumonia. S. pneumoniae typically appears as lancet-shaped diplococci, meaning it ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Streptococcus pyogenes? Classification of Streptococcus Streptococcus species are diverse bacteria that are classified based on their oxygen requirements, hemolytic activity, and antigenic structure. These classifications provide a framework for identifying different types of streptococci and understanding their roles in human health and disease. Classification by Oxygen Requirement Classification Based on Hemolysis on Blood ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Roantree et al introduced a medium for the isolation of streptococci from group A beta-hemolytic. The medium was enriched with yeast nucleic acids and maltose boosted the size of colonies and improved the clarity, sharpness and precision of the hemolytic zones created by these organisms.

Stroma, as a term in botany, refers to the transparent fluid that surrounds the grana inside the chloroplast. In the stroma, there are the grana (stacks of the thylakoid) and sub-organelles, or daughter cells in which photosynthesis begins prior to the chemical reactions being completed within the stroma.

Strongyloides stercoralis Distribution of Strongyloides stercoralis Habitat of Strongyloides stercoralis Morphology of Strongyloides stercoralis There are two different species of Strongyloides stercolaris: parasitic and free-living. The females are easily found during the parasite phase, but not the males. Parasitic female Parasitic males Eggs Larva The larva of S. Stercoratis is of two types: 1. Rhabditiform larva (first stage larva) 2. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Structural isomer? Types of Structural isomer Structural isomerism, also known as constitutional isomerism, is a form of isomerism in which the atoms within a molecule are arranged in different orders, resulting in compounds with the same molecular formula but different structural formulae. Structural isomers often exhibit distinct physical and chemical properties. Let’s explore ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is an Ecosystem? Ecosystem Definition An ecosystem is a complex interplay of living organisms and their physical environment, interacting as a functional unit. Characteristics of Ecosystem An ecosystem, as delineated by Smith (1966), possesses several distinct characteristics that underscore its significance in the realm of ecology: In essence, these characteristics elucidate the dynamic nature ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Coronaviruses are a type of virus that can cause illness, ranging from the common cold to more severe diseases such as Middle East Respiratory Syndrome (MERS) and Severe Acute Respiratory Syndrome (SARS). Coronaviruses are so named because they have a crown-like appearance when viewed under a microscope. They are primarily transmitted from person to person ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Flower? Symmetry of Flower The symmetry of a flower is an important characteristic that affects its overall structure and function. Flowers can be classified based on how their parts are arranged around a central axis and how they can be divided into symmetrical halves. Bracts: Position of Floral Organs Relative to the Ovary: ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Bacterial Cell Wall Characteristics of Peptidoglycan Peptidoglycan is a fundamental component of bacterial cell walls, forming a complex, mesh-like structure known as the sacculus. This structure is crucial for maintaining cell shape and integrity. Here are the key characteristics of peptidoglycan: Cell membrane of Gram-Positive Cell Wall The cell membrane of Gram-positive bacteria is a ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Water Molecules Structure of Water The structure of water is fundamental to its unique properties and functions in various biological systems. The molecular composition, bonding characteristics, and phase transitions of water are essential concepts in understanding its role in life processes. Properties of Water Properties Values Chemical formula H₂O Molar mass 18.01528(33) g/mol Odour None ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Materials required The study of legumes, particularly in understanding their biochemical composition and properties, requires specific materials to conduct experiments effectively. The following items are essential for analyzing legumes such as Glycine max (soybean) and Cicer arietinum (gram). Each material plays a critical role in the experimental process, ensuring accurate results and insights into the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The Lactophenol Cotton Blue solution stains the chitinous cell wall of the fungal cell, which makes them different from the surrounding environments and can easily distinguishable. LCB is made of three main components such as Phenol, Lactic acid, and Cotton blue.

Biting and Chewing Chewing and Lapping Piercing and Sucking The piercing and sucking mouth parts found in various insects, such as mosquitoes and bugs, are highly adapted for piercing the tissues of animals and plants to extract blood or plant juices. These mouth parts are specialized for their specific feeding habits and can be categorized ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Materials Required The study of cereals, particularly wheat and rice, necessitates a range of materials to facilitate effective specimen analysis and testing. Below is a comprehensive list of materials essential for this investigation, each serving a specific function in the experimental process. Procedure The following procedure outlines the steps required to study the herbarium specimens ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Chlamydomonas are single-celled green flagellates while Volvox is a part of colonial phytoflagellate that develops a hollow spheroid with several thousand cells enclosed in its mucilaginous wall.

Larval Forms in Protochordates The larval forms of Protochordates, along with the subphylum Cephalochordata (lancelets) and Urochordata (tunicates), are central to the clarification of the phylogeny of Chordata. The larval stages of Protochordates exhibit very typical characteristics provided within all chordates, such as the presence of a notochord. The larval forms of Protochordates are essential ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Penicillium can be found in a freezer that has not been cleaned for a duration of 2 months or longer.

Rhizopus is a multicellular, saprophytic fungi and found on plants. They are parasitic on animals.

Aim Transfer of microbial cells from a parent culture medium to a fresh broth culture. Principle The broth is a liquid medium, which is used to grown microorganisms within the laboratory on a small scale. It also used in an industrial fermentor on a large scale. The media called broths, milks, or nutrient solutions are ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Overview of Subculturing Technique In microbiology, subculture is defined as a new cell or microbiological culture, which is prepared by transferring a few or all cells to a fresh growth medium from an old culture or a previous culture. In a single word, the transfer of cells from a previous culture to a fresh or ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Submandibular Gland? Definition of Submandibular Gland The submandibular gland is one of the major salivary glands located beneath the floor of the mouth, responsible for producing a significant portion of saliva that aids in lubrication and digestion. Anatomical Position of Submandibular Gland Situated within the anterior region of the submandibular triangle, the submandibular ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Sucrose gradient centrifugation Definition Technique for the characterization and preparation of subcellular particles. A sucrose gradient is used to fill a centrifuge tube of the type swinging-bucket design. The bottom is the most dense, and the top the least dense. The solution is then layered with a suspension of the particles. Centrifugation separates particles in ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Sudan Black is a slightly basic dye and will combine with acidic groups in compound lipids, thus staining phospholipids also. An alternative stain to the Sudan Black B stain.

What is Sulfur Reduction Test? Definition of Sulfur Reduction Test The Sulfur Reduction Test is a biochemical assay used to determine the ability of microorganisms to metabolize sulfur-containing compounds, resulting in the production of hydrogen sulfide (H2S) gas. This test aids in differentiating and identifying bacterial species based on their sulfur-reducing capabilities. Objective of Sulfur ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The majority of plasma proteins are too big to pass through the kidney’s glomeruli. The limited quantity of protein that does filter through is often reabsorbed by the renal tubules back into the blood. Normal urine contains only trace levels of protein (less than 150 mg per 24 hours). Tamm-horsfall protein (up to 40%), albumin ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Sulphur cycle Definition Sulfur Cycle Overview Types of Sulphur Cycle There are two major kinds of the Sulphur Cycle, namely; 1 . Gaseous Sulphur Cycle 2. Sedimentary Sulphur Cycle Sulphur Cycle Steps The key phases of the sulphur cycle are as follows: 1. Decomposition of Organic Compounds 2. Oxidation of Hydrogen Sulphide to Elemental Sulphur ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Superantigens (SAgs)? Superantigens (SAgs) are a type of antigens that stimulate the immune system excessively. It specifically results in non-specific T-cell activation, polyclonal T-cell activation, and large cytokine release. Features of Superantigens (SAgs) Classification of Superantigens (SAgs) The superantigens can be grouped generally into the subsequent families: Structure of Superantigens (SAgs) Examples of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The Concept of Sustainability Resource Use and Sustainability Resource use and sustainability are fundamentally interconnected concepts that shape the dynamics of environmental stewardship and economic development. Understanding how resources are classified, utilized, and the implications of their use is essential for fostering sustainable practices. Below are the key components of resource use and its relationship ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Swim bladder? Development of Swim-Bladder The development of the swim bladder in fish is a complex process that varies among different groups, particularly in teleosts and certain primitive forms. This internal organ plays a crucial role in buoyancy regulation and has evolutionary significance, linking it to the lungs of tetrapods. The development process ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The SXT (sulfamethoxazole-trimethoprim) susceptibility test tells the difference between group A and B streptococci and other hemolytic streptococci. 

What is Sycon? Definition of Sycon Sycon is a genus of small, tube-shaped calcareous sponges from the family Sycettidae, commonly found attached to rocks, corals, and mollusc shells in shallow, temperate marine waters. Sycon Classification Sycon is a genus of calcareous sponges within the broader classification system of the animal kingdom. Understanding its classification helps ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Symbiosis? Symbiosis, derived from the Greek words “σύν” (sýn) meaning “together” and “βίωσις” (bíōsis) signifying “living,” refers to a prolonged biological interaction between two distinct species, known as symbionts. This interaction can manifest in various forms, ranging from mutualistic, where both entities benefit, to commensalistic, where one benefits without harming the other, and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Synapse? Definition of Synapse A synapse is a junction between two neurons or between a neuron and an effector cell, such as a muscle cell, that allows for the transmission of electrical or chemical signals. It consists of a presynaptic terminal, a synaptic cleft, and a postsynaptic terminal, facilitating communication within the nervous ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Synchronous culture Definition A synchronous or synchronized culture is a microbiological culture or a cell culture which contains the cells that are all in the same growth stage. Obtaining Synchronous culture  There are present different method for obtaining a Synchronous culture such as; Application of Synchronous culture References

What is Fatty Acid? Location of Fatty Acid Synthesis Fatty Acid Synthesis Pathway Fatty acid synthesis proceeds through a series of steps, each involving specific enzymatic reactions and the utilization of various substrates. The pathway can be summarized as follows: It is important to note that palmitate can undergo further modifications, such as desaturation or ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Types Of Classification In the study of botany, the classification of plants is a fundamental task aimed at organizing the immense diversity of plant species into manageable categories. Due to the vast number of plant species and their complex relationships, it is essential to classify them into hierarchical groups based on similarities and differences. This ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is T cell (T Lymphocyte)? Definition of T cell (T Lymphocyte) T cells, also known as T lymphocytes, are a type of white blood cell that plays a crucial role in the immune system. They are responsible for recognizing and attacking foreign pathogens, infected cells, and cancer cells. T cells have specialized receptors on ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Thymus-Independent Antigens (T Independent Antigen) Properties of Thymus-Independent Antigens (T Independent Antigen) Thymus-Dependent Antigens (T Dependent Antigen) Properties of Thymus-Dependent Antigens (T Dependent Antigen) Main steps during B-cell activation by a thymus-dependent antigen This CD40/CD40L interaction is crucial for B-cell survival, development of germinal centres, production of memory-cell populations, and somatic hypermutation (for affinity maturation). ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Taenia Solium? Classification of Taenia solium Phylum Platyhelminthes Class Cestoda Subclass Eucestoda Order Taenioidea Genus Taenia Species solium Habitat of Taenia Solium This parasitic organism occupies specific ecological niches, which facilitate its survival and proliferation. Structure of Taenia Solium The structure of Taenia solium, commonly known as the pork tapeworm, is intricate and specifically ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Taproot is among the two important root systems in which the primary root produces branches of the secondary as well as tertiary roots which are growing downwards as primary root tapers toward the final.

What is TaqMan Probe? Definition of TaqMan TaqMan probes are hydrolysis probes used in quantitative PCR (qPCR) to increase specificity by utilizing the 5´–3´ exonuclease activity of Taq polymerase to cleave a dual-labeled probe during hybridization, resulting in a fluorescence signal that allows for precise quantification of the target DNA. Principle of TaqMan TaqMan technology ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Taste? The Organs of Taste The organs of taste are essential in helping humans detect and differentiate between various flavors. While the tongue is the primary organ associated with taste, other areas such as the palate, pharynx, and epiglottis also play a role in the tasting process. Additionally, odors from food contribute to ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Tautomer? Tautomer definition A tautomer is a type of isomer that exists in multiple interconvertible structures, differing in the relative position of a specific atomic nucleus, typically hydrogen. What Is Tautomerism? Structural Requirement of Tautomerism Tautomerism, the phenomenon of interconversion between different isomeric forms of a compound, has specific structural requirements. Here are ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

In Taxonomy, evidence is the information used in context for a purpose such as identification or classification. The foundation of plant taxonomy was laid on a number of characters (attributes) of plants and plant groups studied from time to time. Such taxonomic information can be realised in many ways to prove a hypothesis, solve a ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Taxonomic Hierarchy? Taxonomic hierarchy is a fundamental concept in biological classification that organizes the vast diversity of life into a structured framework. This system is essential for the accurate identification, naming, and classification of organisms, allowing biologists to communicate effectively about the characteristics and relationships of various species. At the core of plant ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Taxonomy? History of Taxonomy Taxonomy, the science of classifying living organisms, has evolved significantly since its inception. The journey of taxonomy traces back to ancient civilizations, undergoing various transformations through the ages, influenced by the works of numerous scholars and the advent of scientific methodologies. Ancient Beginnings: The earliest inklings of taxonomy can ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Thiosulfate-citrate-bile salts-sucrose (TCBS) Agar, is a type of selective agar that is used in microbiology laboratories to isolate Vibrio species. TCBS Agar can be used to cultivate Vibrio cholerae from clinical specimens or other materials. Kobayashi et. al. developed TCBS Agar, which modified the Nakanishi selective medium. This medium was originally intended to isolate V. cholerae from V. parahaemolyticus. However, Vibrios can grow healthy colonies with many different colonial morphologies.

What is Tea? Types of Tea Tea is classified into several distinct types, primarily based on the processing techniques used after harvesting the Camellia sinensis leaves. Each type of tea varies in terms of oxidation, fermentation, and the preservation of specific chemical compounds such as polyphenols and catechins. Below is a detailed explanation of the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Telomerase? Telomerase (terminal transferase) is a ribonucleoprotein enzyme that extends telomeres, the repetitive nucleotide sequences at the ends of eukaryotic chromosomes. Telomeres function as protective caps, stopping chromosome ends from being erroneously perceived as DNA damage or from bonding with neighboring chromosomes. Most eukaryotes use telomerase to maintain their telomeres, but some organisms, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What Are Telomeres (telomere)? At the ends of linear eukaryotic chromosomes are specialized structures called telomeres. DNA degradation is prevented by repetitive nucleotide sequences of the telomere, which caps and so stabilizes chromosomal DNA during cell division. The termini of chromosomes not only have no translation product but instead have a highly important role in ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Telophase? Telophase, derived from the Ancient Greek terms τέλος (télos) meaning ‘end’ and φάσις (phásis) signifying ‘appearance’, represents the concluding phase in the intricate process of cell division, both in mitosis and meiosis of eukaryotic cells. This phase is characterized by a series of events that essentially reverse the changes observed during prophase ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Dry Mount Slide? A dry mount slide is a type of microscope slide preparation where the specimen is directly placed on the slide without the use of any liquid medium. In this method, the specimen is typically dry, and no mounting medium or cover slip is added on top. The dry mount technique ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

In Mounting technique, the specimen to be observed is held on a microscopic slide by using a coverslip.

What is Teratogenesis? Teratogenic Agents 1. Infectious agents 2. Physical agents 3. Chemical agents Chemical agents, including certain medications and substances, can have teratogenic effects on the developing fetus. These agents can disrupt normal development and contribute to the occurrence of birth defects. Here are some key points about different chemical agents and their teratogenic ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Definition of Terrestrial Ecosystem Features of Terrestrial Ecosystem The terrestrial ecosystem has the following characteristics: Types Of Terrestrial Ecosystems Different types of terrestrial ecosystems are widely dispersed throughout the geological zones. They consist of: 1. Desert Ecosystem 2. Forest Ecosystem Types of forest Ecosystem According to climate and tree type, they are divided into the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Testing of Disinfectants/ Evaluation of disinfectants definition. Different methods for Testing of Disinfectants There are present different tests which can be used to test the efficiency of disinfectants such as; 1. Phenol coefficient test Methods of Phenol coefficient test There are two distinct methods of Phenol coefficient test, such as; A. Rideal Walker method for ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Testicle (Testis)? Definition of Testicle (Testis) A testicle, or testis, is a male reproductive gland responsible for producing sperm and the hormone testosterone. Located in the scrotum, the testicles are essential for male fertility and the regulation of male secondary sexual characteristics. Structure of Testes The structure of the testes is integral to ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Algae? What is the thallus organization of algae? Types of thallus organization in Algae The organization of the algal thallus varies considerably across different species. The thallus, or plant body, can be categorized into several distinct types based on its structural complexity and organization. The algal thallus organization can be classified in these ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Cell Structure and Function Crossword: Dive into the microscopic world with this biology crossword that explores the essential building blocks of life. Test your knowledge of cell organelles, their functions, and key cellular processes like mitosis and osmosis. From the powerhouse mitochondria to the command center nucleus, challenge yourself to unlock the mysteries of what ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Marine Biology Crossword: Dive into the depths of the ocean with this marine biology-themed crossword! Explore the fascinating world of marine ecosystems, coral reefs, and the diverse species that inhabit our seas. From tiny plankton to mighty whales, challenge yourself with clues about oceanography, marine life, and the delicate balance of aquatic environments. Discover the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Zoology Crossword: Embark on an exciting journey through the animal kingdom with this zoology-themed crossword! Test your knowledge of various animal species, their classifications, habitats, and behaviors. Solve clues about key concepts such as evolution, adaptation, and conservation, while learning about the rich diversity of life on Earth. From the tiniest insects to the largest ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Genetics and Heredity Crossword: Unravel the secrets of inheritance with this genetics-themed crossword! Explore the building blocks of life by solving clues about DNA, genes, chromosomes, and Mendelian laws. Discover how traits are passed from generation to generation, and test your understanding of genetic variation, mutations, and inheritance patterns. It’s a puzzle where every answer ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Human Anatomy Crossword: Take a deep dive into the inner workings of the human body with this anatomy-themed crossword! From major organs like the heart, lungs, and brain to the intricate systems that keep us alive, challenge yourself to identify body parts and their functions. Explore the skeletal, muscular, circulatory, and nervous systems, and see ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Genetics and Heredity Crossword: Step into the world of genes and discover how traits are passed down through generations. This puzzle challenges your understanding of DNA, chromosomes, alleles, and Mendel’s laws of inheritance. Test your knowledge of genetic variations, hereditary patterns, and the molecular mechanisms that make each of us unique. Decode the puzzle of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Ecology and Ecosystems Crossword: Explore the delicate balance of nature with this ecology-themed crossword! Solve clues about food chains, energy flow, biomes, and the interdependence of living organisms. Delve into key ecological concepts such as producers, consumers, decomposers, and how ecosystems respond to environmental changes. This puzzle will test your understanding of the complex relationships ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Evolution and Natural Selection Crossword: Journey through time with this evolution-themed crossword, exploring the mechanisms that have shaped life on Earth. From Darwin’s theory of natural selection to the fossil record, solve clues about species adaptation, mutations, and survival of the fittest. Challenge your knowledge of evolutionary biology and uncover how life has evolved and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Microbiology Crossword: Enter the microscopic realm with this microbiology-themed crossword! Test your knowledge of bacteria, viruses, fungi, and other microorganisms that play crucial roles in health, disease, and ecosystems. From antibiotics and vaccines to the immune system and microbial metabolism, explore the unseen world that shapes life at the smallest scale. Challenge yourself to identify ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Botany and Plant Biology Crossword: Immerse yourself in the vibrant world of plants with this botany-themed crossword! Explore the intricacies of plant structure, including leaves, stems, roots, and flowers. Solve clues about photosynthesis, plant reproduction, and the diverse classifications of plants, from flowering species to ferns. Challenge your knowledge of the vital roles plants play ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Biochemistry Crossword: Unlock the molecular mysteries of life with this biochemistry-themed crossword! Challenge yourself with clues about macromolecules such as proteins, carbohydrates, lipids, and nucleic acids. Explore key metabolic pathways, enzyme functions, and the chemical reactions that fuel biological processes. This puzzle will test your understanding of how complex molecules interact to sustain life, revealing ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Hey, in this article I will discuss the complement pathway which is one of the easiest pathways. Basically, This complement pathway helps to kill microorganisms  by antibodies or phagocytosis. The complement pathway has been accomplished in three main ways, which I have discussed step by step below. Believe me, if you understand the first step ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

In a world dominated by technological advancements and an increasing knowledge of the intricacies of our planet’s natural environment scientists and researchers have launched an innovative project known as the Earth BioGenome Project (EBP). This ambitious global project aims to sequence and catalogue the genomes of every known species of Earth which will lead to a ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Glyoxylate cycle Definition Glyoxylate cycle Steps Glyoxylate cycle functions The conversation of dicarboxylic and tricarboxylic acids in germinating seeds occurs in three compartments such as mitochondria, glyoxysomes, and cytosol. During the conversation, the oxaloacetate from the TCA cycle (mitochondria) enters into the glyoxysomes in the form of aspartate. After that, the aspartate converted into oxaloacetate ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The Human Genome Project (HGP) was an international scientific research endeavor with the objective of identifying, mapping, and sequencing all the genes of the human genome from a physical and functional standpoint. It began in 1990 and was finished in 2003.It remains the largest collaborative biological project in the globe.After its adoption by the US ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Michaelis–Menten model? The Michaelis–Menten model is a fundamental concept in biochemistry, specifically in the realm of enzyme kinetics. Enzymes, which are proteins, play a pivotal role as catalysts in biochemical reactions. Their primary function is to reduce the Gibbs free energy of activation, ΔG, thereby facilitating the reaction to reach its transition state ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Humans have been fighting off viruses way before the time our species evolved into its current version. In the case of some viral diseases vaccinations and antiviral medications have helped us stop the spread of infections to a minimum and helped people suffering from illness recover. In the case of one disease called smallpox, we've managed to eliminate it, clearing the globe of cases.

SARS-CoV-2 is the virus that causes the disease COVID-19 (coronavirus disease 2019). It is a highly infectious disease that can spread from person to person through respiratory droplets or close contact. The virus was first identified in Wuhan, China in December 2019 and has since spread to become a global pandemic. Symptoms of COVID-19 can ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The nervous system represents one of the most intricate and essential systems in multicellular organisms, functioning as the primary coordinator of actions, sensory information, and responses to environmental stimuli. This complex network is responsible for detecting changes in the environment, processing that information, and enabling organisms to react accordingly, working closely with the endocrine system ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is The Wobble Hypothesis? The Wobble Hypothesis, proposed by Francis Crick in 1966, provides an explanation for the degeneracy of the genetic code. Degeneracy refers to the fact that multiple codons can code for the same amino acid. According to the Wobble Hypothesis, the precise pairing between the bases of the codon and the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The chemical energy stored in molecules can be released as heat in chemical reactions that occur when the fuel methane, coal or cooking gas burns in the air. Chemical energy could also be utilized to carry out mechanical work when fuel is burned in an engine or to generate electric energy via an electrolytic cell ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Theta model of DNA Replication? The theta model of DNA replication is a mechanism for DNA replication which occurs in circular DNA molecules, in particular, those of bacteria, and also the mitochondria and chloroplasts. True to its name, this replication process creates an intermediate structure during replication that resembles the Greek letter theta ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

A blood film or Peripheral blood smear (PBS) must be prepared from capillary blood or a drop of blood from an EDTA (anticoagulant) blood sample. Blood examination under the microscope requires blood smears. The Differential Leukocyte Count (DLC) is typically determined by blood smears. The DLC entails counting 100 white blood cells (WBCs) and noting ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Chromatography? Chromatography is a large family of analytical procedures used to separate, identify, and quantify components in a mixture. It is an effective technique in many scientific fields, including chemistry, biochemistry, pharmacology, environmental analysis, and forensic research. The chromatographic concept is based on the differential distribution of components between two phases: stationary and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Thioglycolate broth, an enrichment broth that is multipurpose and can be used to determine the oxygen needs of microorganisms, is called a differential medium. It is used most often in diagnostic bacteriology as an enrichment broth. This broth is supportive of the growth and development of microorganisms fastidious, anaerophilic, microaerophilic and aerobes.

All living organisms are grouped into three major categories under the three-domain system, a modern way to classify life based on genetic and evolutionary relationships. Proposed by microbiologist Carl Woese in the 1990s, this system splits life into Bacteria, Archaea, and Eukarya. Bacteria are the familiar single-celled microbes found everywhere, from soil to our bodies, lacking a cell ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Thymus Gland? Definition of Thymus Gland The thymus gland is an important organ of the lymphatic system located in the chest behind the breastbone. It plays a crucial role in the development and maturation of immune cells known as T cells, which are essential for the body’s immune response. The thymus gland is ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Thyroid Gland? Definition of Thyroid Gland The thyroid gland is a butterfly-shaped endocrine organ located in the anterior neck that produces hormones such as thyroxine (T4), triiodothyronine (T3), and calcitonin, which regulate metabolism, growth, and calcium homeostasis. It plays a crucial role in maintaining the body’s metabolic rate and overall hormonal balance. Anatomical ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Ticks? Definition of Ticks Ticks are small, parasitic arachnids belonging to the order Ixodida, feeding on the blood of mammals, birds, reptiles, and amphibians. They are classified into two main families: Ixodidae (hard ticks) and Argasidae (soft ticks). Ticks have a complex life cycle that includes four stages: egg, larva, nymph, and adult, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Tissue Homogenizer? Parts of a Tissue Homogenizer The specific parts of a tissue homogenizer can vary depending on the type of homogenizer being used, but here are some common parts that are found in most homogenizers: Operating Procedure of Tissue Homogenizer Types of Tissue Homogenizer Essential laboratory tools for disrupting biological samples and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Tissues? Definition of Tissues Tissues are groups of similar cells that work together to perform specific functions in an organism. They serve as the structural and functional units that form organs, playing critical roles in various biological processes. Characteristics of Tissues Location of Tissues Formation of Tissues The formation of tissues, known as ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Tobacco mosaic virus (TMV)? Characteristics of Tobacco Mosaic Virus (TMV) TMV has a range of distinctive features that set it apart as a widespread and resilient plant virus, impacting several economically important crops, especially within the Solanaceae family. TMV’s combination of durability, wide host range, and ease of spread underscores the importance of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Disclaimer: The information presented in this blog post about the tobacco plant is intended solely for educational purposes, particularly for botany students and enthusiasts. The content aims to provide a comprehensive understanding of the plant’s characteristics, uses, and cultivation methods. We do not endorse or promote the use of tobacco in any form, nor do ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

It is a type of biochemical test which is used to distinguish reducing sugars from non-reducing sugars. This biochemical test is also known as the silver mirror test based on the end product of this test. This test was also used to differentiate between aldehydes and ketones through routine qualitative organic analysis.

Toluidine blue is a basic thiazine metachromatic dye that stains nuclei blue, and can be used to differentiate different types of granules (e.g. within mast cells).

Tomato Spotted Wilt Virus (TSWV), caused by the pathogen Tomato spotted wilt orthotospovirus, is a devastating threat to global agriculture, particularly affecting crops like tomatoes, peppers, and potatoes. Recognized by its scientific name in research, this virus spreads rapidly through thrips, its primary insect vector, making tomato spotted wilt virus transmission a major concern for farmers. Early identification of tomato spotted wilt virus ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

To function properly, cells must be kept turgid. To function properly, a well-watered plant will grow and produce fruits and flowers. A plant that is not watered for several days will wilt and eventually die. This happens because water leaves the cell and causes the cell to lose its turgidity. Based on the concentration of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Toolmakers Microscope? Principle of Toolmakers Microscope The working principle of the toolmakers microscope relies on the principles of optics, similar to a conventional light microscope. The microscope is equipped with a light source that directs light upward, focusing it onto the object being observed. When the light falls on the object, it casts ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Research plays a crucial role in advancing knowledge and understanding across various fields, from science and medicine to social sciences and humanities. To carry out effective research, researchers employ a wide array of tools and techniques that enable them to collect, analyze, and interpret data in order to address research questions and achieve their objectives. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Difference Between Monera, Protista, Fungi, Animalia, Plantae. The five-kingdom classification was proposed by R.H. Whittaker in 1969 and was built on the work of two-kingdom classification. In Five Kingdom Classification, the organisms are classified based on several characteristics such as mode of nutrition, thallus organization, cell structure, phylogenetic relationships, and reproduction. It is the most ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

In this article, I will share a list of Top and Best Books for Cell Biology. In this paper on microbiology, you will study about Structure and organization of Cell, Nucleus, Protein Sorting and Transport, Cell Signalling, Cell Cycle, Cell Death and Cell Renewal. Our goal: Find the Best Books for Cell Biology, based on ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The average Researcher will spend about 4-5 years of time in the lab. The whole period is focused on setting goals and defining experiments, carrying out experiments, taking notes and analyzing results from experiments in the process of interpreting and concluding results of the experiment for publication of the outcomes. The most crucial steps is performing experiments that can be practical unlike other experiments that are theoretical and can be carried out. To get the most effective results from the tests it is vital to be proficient with the instruments as well as to be proficient with wet-lab methods.

List of Top 14 books for Industrial Microbiology

Difference Between Monera and Protista. The five-kingdom classification system divides the different life forms of earth into five distinct categories such as Kingdom Monera, Protists, Fungi, Plantae, and Animalia. Among them, Monera is the most primitive organism. The key difference between Monera and Protista is that Monera has a prokaryotic cellular organization, whereas Protista has ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Food and diary Microbiology is a branch of microbiology. In this portion of microbiology, we discuss about preparation procedures of dairy products and different foods in industries. Now, in this article, I will discuss about Top books for Food and diary Microbiology which you can buy from online stores. List of Top 15 Books for ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

In this article, I will share a list of Top and Best Molecular Biology Books. In this paper on microbiology, you will study about Structures of DNA and RNA / Genetic Material,  Replication of DNA (Prokaryotes and Eukaryotes), Transcription in Prokaryotes and Eukaryotes, Post-Transcriptional Processing, Translation (Prokaryotes and Eukaryotes), Regulation of gene Expression in Prokaryotes ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The worldwide issue of deadly and infectious illnesses caused by bacteria are becoming one of the biggest medical and scientific issues of the moment.

Here i am with Top books for Environmental Microbiology. All these books are recommended for the study of environmental microbiology. List of Top 18 books for Environmental Microbiology

Difference Between Bacteria and Virus Bacteria Bacteria are referred to as microscopic, single-celled organisms which exist in their millions, in every environment, both inside and outside other organisms. In 1676, a Dutch microscopist Antonie van Leeuwenhoek first observed a bacterial cell by using a single-lens microscope of his own design. In 1828, Christian Gottfried Ehrenberg ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Top 30 Differences Between Bacteria, Archae, and Eukarya. References

In this article, I will share a list of top and best books on Microbial Physiology and Metabolism. In this paper, you will study about Microbial Growth and Effect of Environment on Microbial Growth, Nutrient uptake and Transport, Chemoheterotrophic Metabolism – Aerobic Respiration, Chemoheterotrophic Metabolism- Anaerobic respiration and fermentation, Chemolithotrophic and Phototrophic Metabolism, Nitrogen Metabolism. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The world of biofertilizers and biopesticides is a fascinating one that’s full of new developments and discoveries. If you’re interested in learning more about these sustainable alternatives to traditional chemical fertilizers and pesticides, then you’ll be pleased to know that there are a wealth of books out there to help you do just that. In ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Are you fascinated by the intricate details of the microscopic world? Have you ever wondered what it would be like to see beyond the limitations of traditional microscopy? Look no further because the world of Artificial Intelligence (AI) has made it possible to generate highly detailed and visually stunning images of the microscopic world. In ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Discover the top 8 books that provide comprehensive insights into biodiversity, covering microbes, algae, fungi, and archegoniate plants. These recommended reads are essential for anyone interested in the intricate world of microscopic life forms and their crucial roles in ecosystems. From foundational texts to advanced guides, this list offers valuable resources for students, researchers, and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

In this article we will discuss about the Top and Best Books for Microbiology. Best Microbiology Textbook for B.Sc and M.Sc Students. There are 14 core subject of Microbiology. Introduction to Microbiology and Microbial Diversity Bacteriology Biochemistry Virology Microbial Physiology and Metabolism Cell Biology Molecular Biology Microbial Genetics Environmental Microbiology Food and Dairy Microbiology Industrial ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Biotechnology companies have evolved as backbones to support the country's economy. To develop products or resolve problems, the techniques from living cells are employed by biotechnology companies. The source of DNA and identification has allowed the biotechnology industry to achieve great levels.

For students pursuing a career in Life Sciences, Biotechnology, and related fields, entrance exams are critical milestones that determine your path to higher education and research opportunities. This guide provides an in-depth look at 42 essential entrance exams that can help you secure admission to top institutions and prestigious fellowships in India. Importance of Life ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

In this article, we will discuss about Top MSc Microbiology colleges in West Bengal. All these Colleges conduct an MSc program in Microbiology and they are located in West Bengal. Top M.Sc in Microbiology Private and Government colleges in West Bengal Adamas University Address Adamas Knowledge City, Barasat – Barrackpore Road, P.O. – Jagannathpur, District ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Microbiology is a vital field of study that has a significant impact on our health, food, and environment. The study of microorganisms is crucial in understanding and addressing a wide range of issues such as the spread of infectious diseases, the production of food and beverages, and the development of medical treatments. In West Bengal, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

James Wang discovered the first DNA topoisomerase in bacteria in 1971, initially naming it ω (omega) protein; it is now known as Escherichia coli (E. coli) topoisomerase I (topo I) and is a member of the type IA family of enzymes. Subsequently, James Champoux and Renato Dulbecco discovered an analogous activity in eukaryotic cells (rat liver); the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Torovirus is a genus of enveloped, positive-strand RNA viruses belonging to the Nidovirales order and Tobaniviridae family.They infect predominantly vertebrates, particularly cattle, pigs, and horses. Among the diseases associated with this genus is gastroenteritis, a condition typically observed in mammals.Torovirus is the only genus in the monotypic Torovirinae subfamily.Torovirus is a monotypic taxon with a ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Torsion? Conditions before Torsion The following points outline the key features and conditions that are present in the veliger larva prior to the onset of torsion: How Torsion Occurs Torsion in gastropods is a complex, stepwise process that leads to the twisting of visceral organs in a counterclockwise direction, resulting in a significant ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Haemocytometry is a quantitative method that quantifies the RBC count in blood samples. The manual method of counting RBCs is the Haemocytometer (or Neubauer’s chamber slides). Modern devices, such as photometric and electrometric counters, can be more precise or automated. They can count the cells in the blood sample. It is impossible to count the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The White Blood Cells (WBCs) also known as Leucocytes are round nucleated cells in blood, that provide protection against foreign invaders. There are many types of White Blood cells found in blood, and identified as Granulocytes (Neutrophils, Eosinophils & Basophils) and Agranulocytes (Monocytes and Lymphocytes). The size of White Blood Cells can vary between 10 ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Growth of prevalent filamentous fungi in foods may result in the production of mycotoxins, which can cause a variety of adverse effects in humans, including allergic reactions, immunosuppression, and cancer. Mycotoxins aflatoxins, ochratoxin A, fumonisins, tnchothecenes, and zearalenone are the most significant. Aflatoxins are potent carcinogens and, in conjunction with the hepatitis B virus, are ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

In this article we will learn about Trademarks Objectives, Types, Rights, Protection of goodwill, Infringement, Passing off, Defences, Domain name. What is Trademark? Definition of Trademark A trademark is a unique word, symbol, phrase, or design used to identify and distinguish the goods or services of one business from those of others. It serves as ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Dahi  Idli  Dosa Dhokla  Fermented Leafy Vegetables Ziang sang/Ziang dui  Sinki  Gundruk  Goyang  Fermented Fish Products  Ngari  Hentak  Tungtap  Fermented Beans  Kinema  Hawaiijar  Tungrumbai  Ankhone/Bekang/Peruyyan  Fermented Bamboo Shoots  Soibum/Soidon  Mesu  Lung-Seij  Bas-tenga  Miya Mikhri  Ekung/Hirring  Fermented Alcoholic Beverages  Ennog/Sai Mod  Apong  Kodo ko Jaanr  Xaj-pani  Zutho  Judima  Antingba  Kiad  Sujen 

The process of DNA transcription also referred to as RNA synthesis , is the process where genetic information in DNA is transformed into messenger (mRNA) (mRNA) through an enzyme known as RNA polymerase.

Transcription refers to the process in which the information contained in the DNA strand is transformed into a new messenger RNA molecule (mRNA). In prokaryotic cells, transcription occurs in three stages called the initiation, the elongation, and the termination.

Transfection refers to the introduction of foreign DNA (non-host genome genetic material) into a cell. The primary goal of transfection is to modify the host genome in order to express or inhibit the production of the linked protein. The primary purpose of this page is to provide readers with a thorough explanation of the fundamental ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Standard protein expression systems, including E. coli, frequently fail to generate folded, monodisperse, or functional eukaryotic proteins (see Small-scale Expression of Proteins in E. coli). Utilizing a eukaryotic system, such as mammalian cells, that includes the required folding and posttranslational machinery is highly advantageous for the expression of these proteins. Using polyethylenimine, we present strategies ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Principle of Transfection According to the definition of transfection, the external genetic material must enter the cell via the cell membrane. It is essential to highlight that the genetic material, whether DNA or RNA, is negatively charged as a result of the proteins that surround it. Therefore, in an unmanipulated environment, exogenous DNA cannot cross ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Transfer-messenger RNA (tmRNA)? History Properties of tmRNA tmRNA Structure tmRNA contain the following domains; tRNA-Mimic Domain Pseudoknots mRNA-Mimic Domain Protein Partners tmRNA Function ― Trans-Translation Trans-translation of tmRNA activity Steps Regulation of tmRNA activity Facts References

What is Transgenic Animal? Definition of Transgenic Animal A transgenic animal is an organism that has had a foreign gene (transgene) deliberately inserted into its genome, allowing the gene to be expressed and passed on to future generations. Steps for Production of Transgenic Animals The production of transgenic animals involves a detailed and systematic approach ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Transgenic Plants? Definition of Transgenic Plants Transgenic plants are genetically modified organisms in which DNA from another species is inserted into their genome through genetic engineering techniques to confer new traits, such as pest resistance or improved nutritional content. Different Methods to Create Transgenic Plant Creating transgenic plants involves various techniques to introduce ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Resistance of transgenic crops to biotic stresses Resistance to biotic stresses has been discussed under the following headings. Insect resistance of transgenics crops The development of transgenic crops with insect resistance represents a significant advancement in agricultural biotechnology. By incorporating specific insect control genes, particularly those derived from Bacillus thuringiensis (Bt), researchers have successfully engineered ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The epithelium of transition is a form of stratified epithelium that comprises several layers of cells, where their shape cells changes in accordance with the function that the organ performs. The epithelium can have a varied appearance, as it appears to be circular or cubic in a relaxed state with the exception of the apical layer that appears flat when stretched. The epithelium is essentially restricted to the urinary system that's why it's sometimes referred to"urothelium" "urothelium".

Before going through Eukaryotic Translation steps, please take a look at our previous article Prokaryotic Translation Steps, Requirements, to check the components required for the translation procedure. Protein synthesis in eukaryotes, which includes organisms such as animals, plants, fungi, and protists, involves a complex process that occurs in two main stages: transcription and translation. Here’s ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Translational regulation? In conclusion, translational regulation is a vital process that controls protein synthesis levels by modulating the initiation, elongation, and termination stages of translation. It enables rapid cellular adjustments in response to various stimuli and is critical for maintaining cellular homeostasis. Understanding the mechanisms and factors involved in translational regulation contributes to ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Translocation in phloem refers to the process by which photoassimilates, primarily sugars, are transported over long distances within plants. This vital function occurs within the phloem, a type of vascular tissue responsible for distributing the products of photosynthesis from the sites of production to various sinks throughout the plant. The primary photosynthate transported by phloem ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

In molecular biology and genetics, translation is the process in which ribosomes in the cytoplasm or endoplasmic reticulum synthesize proteins after the process of transcription of DNA to RNA in the cell's nucleus. The entire process is called gene expression.

Now, let’s cover the TEM. The best way to get to know the TEM is to understand where and why you’d use one. When would you ever need to see something so small that light can never penetrate it? It’s like staring at an ant—but in space. This is not a microparticle microscope you’d find ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Maintain an infectious disease in a human population the pathogens must need to be transmitted from one host or source to another. In Biology the term transmission is refers to the passing of a pathogen from one individual to another individual which can cause a serious disease or infection. The transmission of disease is occurred ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Transpiration? Types of Transpiration Transpiration in plants occurs through several distinct pathways, each playing a specific role in water movement and evaporation. These pathways are classified into four primary types: stomatal, cuticular, lenticular, and bark transpiration. Factors affecting Transpiration Transpiration is influenced by a variety of factors that can be classified into two ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Modern medicine continues to provide numerous marvels that extend the lives of humans and vastly improve their quality of life. The replacement of faulty organs by transplantation has been one of medicine’s unachievable goals for millennia. The dream of health experts has been to replace or restore severely damaged tissues or organs. Successful transplantation needs ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Transport media are basically buffer solutions that contain carbohydrate, peptones, along with other nutritional elements (excluding growing factors) that are designed to protect the health of bacteria during transport, without allowing for their multiplicity. The main goal of utilization of the medium is to keep the sample as close to its original condition as is possible.

The transport of ions across the cell membrane is a fundamental process necessary for maintaining cellular homeostasis. The plasma membrane, acting as a selectively permeable barrier, allows certain substances to enter or leave the cell, ensuring proper balance between the intracellular and extracellular environments. This selectivity is crucial for the regulation of essential molecules such ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Barbara McClintock discovered the first transgenic elements in maize (Zea mays) at New York’s Cold Spring Harbor Laboratory. McClintock was conducting experiments on maize seedlings with broken chromosomes. McClintock planted self-pollinating corn kernels during the winter of 1944–1945, indicating that the silk (style) of the flower received pollen from its own anther.These kernels originated from ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Transposition? Transposition is the process of shifting genetic sequences from one site in a genome to another. Types and Mechanisms of Transposition 1. Replicative Transposition Replicative transposition of DNA transposons The DNA transposon strand transfer process is described in the following section. Step 1 Step 2 Step 3 Step 4 Step 5 Replicative ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Treponema Pallidum? Definition of Treponema Pallidum Treponema pallidum is a helical, microaerophilic bacterium responsible for causing syphilis, a sexually transmitted disease, and other related diseases such as bejel and yaws. It is characterized by its slow metabolic rate and is best visualized using dark-field microscopy. What is Syphilis? Classification of Treponema Pallidum Treponema ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Trichinella spiralis? History and Distribution of Trichinella spiralis Trichinella spiralis is a tissue nematode known as the causative agent of trichinosis, a significant zoonotic disease impacting human health. Its historical context and distribution reveal critical insights into its epidemiology and the public health challenges it poses. Habitat of Trichinella spiralis The habitat of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Trichomes? Trichomes Under Pocket Microscope (Handheld Microscope) Trichomes Under Stereo Microscope To observe trichomes under a stereo microscope effectively, a few key requirements must be met. A stereo microscope, also known as a dissecting microscope, is an essential tool for obtaining a three-dimensional view of trichomes, allowing for detailed examination and analysis. Here ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Trichonympha? Morphology/Structure of Trichonympha Species Requirements Procedure By following this well-structured procedure, researchers can unlock the microscopic wonders of Trichonympha and gain valuable insights into their symbiotic relationships with termites and wood-feeding cockroaches. As scientists continue to refine their observations, this captivating journey into the microcosm contributes to our understanding of the complexities ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Trichophyton is a genus of fungi that comprises the parasitic species responsible for tinea, athlete’s foot, ringworm, jock itch, and similar infections of the nail, beard, skin, and scalp. Trichophyton fungi are characterized by the development of both macro- and microconidia with smooth walls. Macroconidia are thin- or thick-walled, clavate to fusiform, and range in ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Trinocular Microscope? Principle of Trinocular Microscope A trinocular microscope is similar to a binocular microscope but has an additional third eyepiece for a camera. It shines an LED light on the specimen and projects it onto a computer screen through a digital camera. The trinocular microscope is essentially a binocular microscope that focuses ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Triosephosphate isomerase? Mechanism of Triosephosphate isomerase Structure of Triosephosphate isomerase Triosephosphate isomerase in glycolysis Triosephosphate isomerase (TPI) plays a crucial role in the glycolysis pathway, which is the central metabolic pathway responsible for the breakdown of glucose to produce energy. TPI catalyzes the reversible isomerization of two triose phosphate molecules: dihydroxyacetone phosphate (DHAP) ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Triple Beam Balance? Definition of Triple Beam Balance A triple beam balance is a precise measuring instrument used to determine the mass of an object. It consists of three beams, each with different sizes and scale readings, allowing for precise measurements ranging from 0.1 grams to 600 grams. Parts of Triple Beam Balance ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Triple Sugar Iron Test (TSIA Test)? Purpose of Triple Sugar Iron Agar test (TSIA Test) The Triple Sugar Iron (TSI) Agar test, meticulously designed as a differential medium in tubed format, plays an instrumental role in microbiological diagnostics. Its primary objectives are multifaceted, as delineated below: Principle of TSIA Test The Triple Sugar ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The majority of bacteria are able to ferment carbohydrates, especially sugars. Within them, every bacteria is able to ferment just a few of the sugars, whereas it is unable to ferment all the other sugars. So, the sugars that a bacterium is able to ferment, as well as the sugars that it can't, is the signature of the bacterium and is an important factor in its determination. It is the Triple Sugar Iron (TSI) Agar is a type of culture medium known for its capacity to determine a microorganism's capacity to produce sugars and generate hydrogen sulfur.

Tris-SDS Buffer (pH 6.8) is used to prepare buffer for stacking gel during SDS-PAGE (SDSPolyacrylamide gel electrophoresis). It is a discontinuous gel with a huge pores size to concentrate proteins prior to entering the separating zone. The buffer is sold in a 5X stock.

What is tRNA? History of tRNA Properties of tRNA tRNA biogenesis Structure of tRNA  The transfer RNA (soluble RNA) molecule has a molecular weight of about 25,000 and has between 71 and 80 nucleotides, most of which are 75. There are at least 20 different kinds of tRNAs, which is the same number of amino ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What Is Trochophore Larva? Historical Retrospect of Trochophore Larva The trochophore larva, a critical developmental stage in marine invertebrates, has a rich history of scientific discovery and nomenclature. Its identification and study have undergone several phases, with various researchers contributing to the understanding of this organism’s significance and evolutionary relationships. Below is a chronological overview ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Tropism? Tropism refers to the inherent capability of an organism, predominantly plants, to orient or move in reaction to an external stimulus. This response is not learned but is an innate, genetically encoded behavior. The nature of the response is contingent upon the direction of the stimulus, distinguishing it from nastic movements, which ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Trypanosoma gambiense? Classification Domain Eukaryota Phylum Euglenozoa Class Kinetoplastea Order Trypanosomatida Family Trypanosomatidae Genus Trypanosoma History and Distribution of Trypanosoma gambiense Trypanosoma gambiense, the parasite responsible for causing Human African Trypanosomiasis (HAT) or African sleeping sickness, has been a health concern in tropical Africa for centuries. Its history and distribution provide valuable insight ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Tryptic Soy Agar can be used to grow microorganisms. These media are non-selective and general-purpose. They provide enough nutrients to support a variety of microorganisms. This medium can also be used to grow, store, maintain, and transport pure microorganism cultures.

Supplemented with sodium pyruvate and sodium chloride, tryptone soya soup can be used for selective enrichment of Staphylococcus Aureus. 

Tryptophan (Trp) Operon Definition A collection of genes that are transcribed together encode the components for tryptophan synthesis. Note: The trp operon is a set of genes that, when transcribed together, encode the enzymes that cause bacteria to generate the amino acid tryptophan. The trp operon was initially defined in Escherichia coli, and it has ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is a tumor? Risk factors for tumors Types of Tumors There is three types of Tumors such as; 1. Cancerous or Malignant Tumor Types of malignant tumors Examples of Cancerous or Malignant Tumor 2. Noncancerous or Benign Types of benign tumors Examples of Noncancerous or Benign Adenomas Fibroids Fibroids, also known as fibromas, are ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Tumors Tumor Antigens  Some Antigens Are Tumor-Specific  Antigens unique to cancers caused by chemical or physical carcinogens, as well as some virally induced malignancies, have been found. It is particularly difficult to demonstrate the presence of tumor-specific antigens on spontaneously developing tumours since the immune response to such tumours destroys all of the tumour cells ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Features of Malignant Cells  Malignant cells exhibit the following characteristics: It has been hypothesised that the immune system is partially responsible for protecting the body from the development of cancers. In addition, the presence of multiple tumours in immunocompetent individuals suggests that the immune system has a limited function in defending against cancer and is ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Turgor Pressure? Definition of Turgor Pressure Turgor pressure is the internal force exerted by water against a cell’s plasma membrane and its supporting cell wall, primarily observed in plants, fungi, and bacteria, resulting from the osmotic flow of water into the cell. Mechanism of Turgor Pressure Turgor pressure, a fundamental concept in cellular ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Two pan or equal arm analytical balance? Principle of Two pan or equal arm analytical balance – How does a two-pan or equal-arm analytical balance work? Parts of a Two pan or equal arm analytical balance Additional parts that may be found on some two-pan analytical balances include: While the core components mentioned ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Two-Dimensional (Crossed) lmmunoelectrophoresis? Principle of Two-Dimensional (Crossed) lmmunoelectrophoresis The principle of Two-Dimensional (Crossed) Immunoelectrophoresis involves the combination of two distinct electrophoretic steps to separate and identify proteins based on their charge, size, and antigen-antibody interactions. The technique consists of the following steps: The principle of Two-Dimensional Immunoelectrophoresis exploits the migration characteristics of proteins ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Two-Point Cross? A two-point cross is a genetic mapping technique used to determine the recombination frequency between two specific genes located on the same chromosome. In this method, a test cross is performed between a heterozygous individual (carrying two different alleles for the genes of interest) and a homozygous recessive individual (which has ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Type I Hypersensitivity Reaction? Definition of Type I Hypersensitivity Reaction? Type I hypersensitivity reaction, also known as immediate hypersensitivity, is an exaggerated immune response triggered by the re-exposure to a specific allergen. It involves the rapid release of inflammatory mediators from mast cells and basophils sensitized with IgE antibodies. This type of reaction ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Type 1 Diabetes vs Type 2 Diabetes Type 1 Diabetes: Type 2 Diabetes: Comparison chart of Type 1 Diabetes vs. Type 2 Diabetes ologies for the confusion. Here’s the information presented in a table format: Aspects Type 1 Diabetes Type 2 Diabetes Definition Beta cells in pancreas are attacked, resulting in no insulin production Insulin ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Type II Hypersensitivity? Definition of Type II Hypersensitivity Type II hypersensitivity is an immune response characterized by the destruction of healthy cells mediated by antibodies, specifically IgG or IgM, targeting antigens on the surface of host cells. This antibody-mediated reaction can lead to cell lysis, tissue damage, or loss of function. Mechanism of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Type III Hypersensitivity? Definition of Type III Hypersensitivity Type III hypersensitivity is an allergic reaction characterized by the accumulation of immune complexes (antigen-antibody complexes) in tissues, leading to inflammation and tissue damage. Types of Type III hypersensitivity reaction Type III hypersensitivity reactions can be categorized into localized and generalized reactions. The manifestation of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Type IV or Delayed-Type Hypersensitivity (DTH)? Definition of Type IV or Delayed-Type Hypersensitivity (DTH) Type IV or Delayed-Type Hypersensitivity (DTH) is an immune response mediated by T cells rather than antibodies, characterized by a delayed onset (usually 24-72 hours) after exposure to an antigen. It involves the interaction of CD4+ T cells, monocytes, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Evacuated Tubes that are used for blood collection for different laboratory tests are made up of tubes in variable sizes, and color-coded tops to indicate tube contents. The majority of blood collection tubes contain an ingredient that either speeds up the blood's clotting (clot activator) or stops blood from becoming clot-free (anticoagulant). The following list lists the most frequently utilized blood collection tubes, along with their additives, and their uses in lab:

What is Cell? Definition of Cell A cell is the fundamental, structural, and functional unit of living organisms, responsible for carrying out all the processes necessary for life. Types of Cells Cells, the fundamental units of life, operate akin to intricate factories, with specialized components working in harmony to achieve a unified goal. These cellular ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

A centrifuge uses centrifugal force in order to separate different components from a fluid. This is done by spinning fluid at high speeds within a container. It can then separate fluids with different densities (e.g. Cream from milk, or liquids and solids. It causes particles and substances that are denser to move in the radial ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Centrifuge? Types of Centrifuges There are many different types of centrifuges available, and the appropriate type depends on the specific application and the characteristics of the sample being processed. Some common types of centrifuges include: 1. Benchtop centrifuges Applications of Benchtop centrifuges 2. Floor-standing centrifuges 3. High-speed centrifuges 4. Refrigerated centrifuges 5. Microcentrifuges ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Chromatography? Definition of Chromatography Chromatography is a laboratory technique for the separation of a mixture by passing it in a solution or suspension or as a vapor (as in gas chromatography) through a medium in which the components move at different rates. How does Chromatography work? Applications Of Chromatography Because chromatography can separate, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Chromatography? Chromatography Definition Chromatography is a technique used to separate and analyze the components of a mixture based on their properties and interactions with a stationary and mobile phase. What is a stationary phase? What is the mobile phase? Types of Chromatography Here is the Types of Chromatography; Type of Chromatography Description Gas ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Crystals in Urine Urine is a complex fluid that contains various chemicals, and under certain conditions, these chemicals can solidify and form salt crystals. This phenomenon is known as crystalluria. When examining urine samples, the presence of crystals is often assessed as part of a urinalysis, which measures different substances in the urine. While normal ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Eggs are fascinating structures found in various organisms across the animal kingdom. They serve as the starting point for new life, harboring the potential for development and growth. However, not all eggs are created equal. Different species exhibit diverse types of eggs, varying in size, shape, and the presence of yolk. Moreover, eggs are surrounded ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Immunoelectrophoresis? Types of Immunoelectrophoresis There are 4 types of Immunoelectrophoresis; 1. Classical immunoelectrophoresis Advantages In summary, classical immunoelectrophoresis offers the advantages of separating complex mixtures, identifying individual components, specificity in immunoprecipitation reactions, simplicity in procedure, and providing visual and informative results. 2. Counter Current Immunoelectrophoresis Counter current immunoelectrophoresis, also known as crossover immunoelectrophoresis, utilizes ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Types of Microorganisms In Pond Water 1. Arthropods 2. Bacteria 3. Protozoa 4. Hydra 5. Algae Algae are autotrophic protists commonly found in pond water. They exhibit a wide range of colors, with most microorganisms being green, while some may appear yellowish-brown. The diversity of algae extends to their structure, where they can exist as ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Mutations are changes in the genetic material of an organism. These alterations can occur in various ways, and they play a fundamental role in biological diversity and evolution. Broadly, mutations can be classified into two major categories: gene mutations and chromosomal mutations. Gene mutations, also known as point mutations, occur when a change takes place ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

They are multicellular, eukaryotic cells which comprise the Plant (a collection of eukaryotes that belong to the Plantae kingdom ) capable of producing their own food from sunlight, water and carbon dioxide). Since they are eukaryotic they possess a distinct nucleus, with specially designed organelles that allow them to function in a controlled way.

What is Research? Research refers to the systematic investigation, study, or inquiry conducted to discover new knowledge, expand understanding, solve problems, or validate existing theories. It is a process of gathering information, analyzing data, and drawing conclusions to contribute to the body of knowledge in a particular field. Research typically involves the following key elements: ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is RNA? Different Types of RNA and Their Functions RNA, or Ribonucleic acid, is a crucial molecule synthesized by RNA polymerase from DNA. It serves various functions in the cell, including protein-coding and non-coding roles. Understanding the different types of RNA is essential for comprehending their specific functions. Let’s delve into the main types ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is spectroscopy? Types of Spectroscopy Spectroscopy encompasses a broad range of techniques based on the interaction between light and matter, each with its own unique applications and principles. Here’s an overview of some key types: Each spectroscopic method brings unique insights into the physical, chemical, and structural properties of materials, finding applications across science, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Staining is a method used to boost the contrast of samples, usually at the microscopic scale.

Different stains react or concentrate on different areas of a tissue or cell These properties can be utilized to highlight certain areas or regions. A few of the most well-known biological staining methods can be found below. If not otherwise indicated All of these dyes can be used on tissues and cells that are fixed as well as essential dyes (suitable for use in live organisms) are indicated.

Scientists use a variety of methods for making vaccines. They are based on research on the diseases (caused by bacteria or viruses) the vaccine is designed to be able to prevent, like the way that germs infect cells, and the way the immune system responds to it.

What is skeletal muscle? Definition of skeletal muscle Skeletal muscle is a type of voluntary muscle tissue that is attached to the bones and responsible for movement and various bodily functions. Properties Of Skeletal Muscle Skeletal muscles possess several important properties that contribute to their function and enable them to perform various tasks: These properties ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

An ultracentrifuge is one of those lab tools that might not grab headlines, but behind the scenes, it’s a game-changer for scientists. Picture a high-tech spin machine—way more intense than your average centrifuge. It whirs at mind-blowing speeds, sometimes hitting hundreds of thousands of rotations per minute. The force it creates? Imagine gravity cranked up ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Ultrasonic Homogenizers? Principle of Ultrasonic Homogenizers Parts of Ultrasonic Homogenizers The specific parts of an ultrasonic homogenizer can vary depending on the type of ultrasonic homogenizer being used, but here are some common parts that are found in most ultrasonic homogenizers: It’s important to refer to the manufacturer’s instructions for the specific ultrasonic ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Unicellular organism? Evolutionary History of Unicellular Organisms The evolutionary trajectory of unicellular organisms is a testament to the intricate processes that have shaped life on Earth. These microscopic entities, which form the foundation of the biological hierarchy, have a rich and complex history that spans billions of years. All cellular life forms exhibit ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Urea Cycle? Definition of Urea Cycle The urea cycle is a series of biochemical reactions in the liver that convert ammonia, a toxic byproduct of protein metabolism, into urea, a less harmful compound that is excreted in the urine. Urea Cycle Reactions/Urea Cycle Steps The urea cycle is a critical metabolic pathway that operates primarily ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Urease Test? Purpose of Urease Test Principle of Urease Test (NH2)2CO + H2O → CO2 + 2NH3 Media Used for Urease Test Two types of media are typically employed to detect urease activity. Christensen’s urea agar is employed to identify urease activity in numerous bacteria. Stuart’s urea broth is largely used to distinguish ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Urethra? Definition of Urethra The urethra is a tube that carries urine from the bladder to the outside of the body. In males, it also transports semen during ejaculation. Structure of Urethra The urethra is a fibrous and muscular tube that serves as the conduit for urine from the urinary bladder to the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Urinary System? Definition of Urinary System The urinary system is a collection of organs, including the kidneys, ureters, bladder, and urethra, that work together to eliminate waste from the body, regulate fluid balance, and maintain the chemical stability of the body. Anatomy of the Urinary System Two kidneys, two ureters, a urinary bladder, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Urinary Tract Infection (UTI)? An illness affecting a portion of the urinary tract—that which comprises the kidneys, ureters, bladder, and urethral—is known as a urinary tract infection (UTI). Following are some salient features of urinary tract infections: Types of Urinary Tract Infection (UTI) UTIs can attack various urinary system segments, causing varied symptoms. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Urochordata? Characteristics of Urochordata The following characteristics distinguish Urochordata from the other subphylums of Chordata: Larval Characteristics During the larval stage of Urochordata, known as the ascidian tadpole larva, several characteristic features can be observed. These features contribute to their chordate nature and play important roles in their development and behavior. These larval ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Urogenital System? Male and Female Excretory System The male and female excretory systems share significant similarities in structure, particularly concerning the kidneys, ureters, bladder, and urethra. Despite these commonalities, there are notable differences, particularly in the anatomy and function of the urethra. Development of Urogenital System The development of the urogenital system is ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Uronic Acid Pathway or Glucuronic pathway? Overview The uronic acid pathway stands as a distinctive cytoplasmic thoroughfare within cellular metabolism, orchestrating intricate transformations that hold pivotal significance for various physiological processes. As we embark on an exploration of this biochemical route, we uncover its multifaceted roles and far-reaching implications for cellular health and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

This is a form of digital Microscope which is connected to a computer using an USB port. It operates on low power. The camera is fitted with a powerful macro lens. Additionally, they have an integrated LED light that is built into the lens.

UV Spectroscopy is a scientific method that’s like a detective tool for scientists. It helps them understand what’s happening in a molecule when it interacts with light, specifically ultraviolet light. This type of light is invisible to our eyes but plays a crucial role in the world of molecules. Imagine a molecule as a tiny, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

UV-Vis Spectroscopy, short for Ultraviolet-Visible Spectroscopy, is an analytical technique widely used in the fields of chemistry, physics, biochemistry, and molecular biology. It’s based on the absorption or transmission of UV and visible light by substances. At its core, UV-Vis Spectroscopy involves shining ultraviolet or visible light through a sample and measuring how much of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Vaccine? Definition of Vaccines Vaccines are medical preparations that stimulate the immune system to provide protection against specific diseases by promoting the production of antibodies and immune memory. How do vaccines work in Immune System? Types of Vaccines Vaccines can be classified into three main groups based on their composition and mode of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

A light microscope may be used to see and examine the vacuole's structure. While the vacuole doesn't stain as the other organelles of the cell (because it does not contain many constituents that stain) tests have demonstrated that staining is possible for this organelle because the vacuole's sap absorbs and stores dyes that are colored.

Bacteria cells. The most visible part of the majority of plants is a massive, fluid-filled vacuole.

Varicella zoster virus Varicella, also known as chickenpox, is an infectious disease caused by the varicella-zoster virus (VZV). The virus causes chickenpox (typically primary infection in non-immune hosts) and herpes zoster or shingles (after reactivation of latent infection). Chickenpox causes a rash consisting of small, itchy lesions that scab over. It begins on the chest, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Plasmids are small circular molecules of DNA that exist independently of chromosomal DNA within a cell. Because they replicate independently, these molecules are called replicons. The plasmids have an origin of replication known as the ori site from which replication begins. Plasmids encode a few of their own proteins, but when it comes to replication ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Vascular Bundles? Components of vascular bundles Vascular bundles are fundamental structures in vascular plants, comprising two primary components: xylem and phloem. These components play essential roles in the transportation of water, minerals, and nutrients throughout the plant. Both xylem and phloem are classified as complex tissues, meaning they are made up of various ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is the Vascular Cambium? Location of Vascular Cambium in Plants The vascular cambium is a key component of secondary growth in plants, responsible for producing secondary vascular tissues. Its location varies among different plant types, as detailed below: Structure of Vascular Cambium The vascular cambium, a crucial meristematic tissue in plants, is composed of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Centers of origin? The concept of “centers of origin” refers to the geographical regions where specific groups of organisms, whether wild or domesticated, initially emerged on Earth. This term is often associated with the origins of crop plants and wild species, reflecting the places where these organisms first evolved. It is important to ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is a vector in biology? Vector Definition A vector is a DNA molecule or genetic material used to transfer specific genetic information between cells in molecular biology and genetic engineering. Characteristics Features of vectors The following outlines the key features and functions of vectors, providing insights into their design and effectiveness. Types of vectors ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Many plants can reproduce genetically identical offshoots or clones of themselves through asexual reproduction. These offshoots then become independent plants. This is known as vegetative reproduction or vegetative propagation. Fragmentation is one way that vegetative propagation can occur. This means that a part of a plant can be regrown into a new plant. There are ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Venereal Disease Research Laboratory (VDRL) Test? Principle of Venereal Disease Research Laboratory (VDRL) Test The VDRL test operates on the principle of detecting antibodies that are produced in response to antigens released by damaged host cells in individuals with syphilis. This test utilizes a specific antigen known as VDRL antigen, which consists of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Vernalization? Definition of Vernalization Vernalization is the process by which exposure to prolonged cold temperatures induces flowering in plants, ensuring they bloom in favorable conditions, typically after winter. Types of Vernalization Vernalization can be categorized into two primary types, each influencing flowering in distinct ways: Mechanism of Vernalization  Vernalization involves a series of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Vertebra? Definition of Vertebra A vertebra is an individual bone that forms part of the vertebral column (spine) in vertebrate animals. It is an irregularly shaped bone composed of a central body, a vertebral arch, and various processes, providing structural support, flexibility, and protection for the spinal cord. Parts of Vertebrae 1. Vertebral ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Evolution of Vertebrata Vertebrata  Vertebrates, also known as Craniata or Osseo Batch, are animal species characterized by the presence of a backbone or vertebrae. They belong to the Subphylum Vertebrata within the Kingdom Animalia, which encompasses the broader group of chordates with a backbone. Vertebrates are part of the clade Olfactories, which is a monophyletic ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Vertical Zonation? Vertical zonation refers to the distribution of different species or communities in distinct vertical layers or zones in an environment. This phenomenon is most commonly observed in marine ecosystems, especially along rocky intertidal shores, but it can also be found in forests and other terrestrial habitats. In each of these environments, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

A vesicle can be described as a tiny part of a cell comprised of fluid that is enclosed by a bilayer of lipids. The membrane that surrounds the vesicle also has a lamellar phase like the plasma membrane.

Aim To distinguish between living and dead cells. Principle The viability Staining Method mainly used to detect living and dead cells in culture. This method is based on the fact that, certain changes take place in dead cells which result in these cells giving a different reaction to stains from that of living cells. Requirement ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Vibrio cholerae? Geographical Distribution and Habitat of Cholera Cholera is a global health issue, primarily affecting parts of Africa and Asia, though it has also spread to other regions. The condition is rare in developed countries, but still a persistent threat in many developing areas. Geographical Distribution Habitat of Vibrio cholerae The bacterium’s ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Vibrio parahaemolyticus Food Poisoning? Vibrio parahaemolyticus food poisoning is a type of acute gastroenteritis caused by the consumption of raw or undercooked seafood products contaminated with the bacterium. Here is information about Vibrio parahaemolyticus food poisoning: Characteristics of Vibrio parahaemolyticus Vibrio parahaemolyticus is a bacterium with distinct characteristics that contribute to its physiology and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Viral entry is the first phase of infection in the viral life cycle when the virus is in contact with the cell of its host and injects virus-related material into the cell.

Introduction In our daily life, we are thinking about Viral Infection and their symptoms, when we get infected by any infectious virus such as the flu or the chickenpox. But ever you ask, what’s actually happening in your body when you have been infected by a virus? In biology, viral infection means viruses are started ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Pathogenesis refers to the process by which infection by viruses causes illness. Thus, it is a description of the mechanism by which initial infection triggers the development of disease.

Viral replication is the process of forming of biological viruses in the course of the infection process within the host cells. A virus has to go through the process of reproduction to generate new, infectious virions which are able to infect cells within the body and subsequent hosts.

The local spread of the infection within the epithelium happens when the virus is released and infects adjacent cells. The infections are typically controlled by the physical limitations of the tissue, and are managed by the inherent immune and innate defenses.

A viral transport medium (VTM) is an essential nutrient that is used to transport and sustain the viability of samples (viruses) to an laboratory for analysis and identification of the specimen.

Viroids Definition Viroids Structure: Replication of Viroids or Infection of Viroids Viroid RNA replicates autonomously and spreads within the host by recruiting host proteins. There are three enzymes that help in RNA replication such as RNA pol. II, RNAase and RNA ligase. Viroid RNA don’t code for any plant protein and they lack AUG initiation ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Viruses? Origins of Viruses Viruses have likely existed since the earliest life forms and have evolved alongside cellular organisms. Due to their lack of fossil records, the origins of viruses remain unclear, and scientists use molecular biology techniques to explore their evolutionary history. Three primary hypotheses attempt to explain how viruses may have ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

A virus is a form of microscopic infectious agent that can only replicate within the cells of a living organism. Viruses are capable of infecting all forms of life, including animals, vegetation, and even bacteria. They are comprised of a minute piece of genetic material, either DNA or RNA, encased in a protein shell known ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are animal and plant cells? Animal and plant cells serve as the building blocks of life for animals and plants, respectively. Both are eukaryotic cells, meaning they contain a true nucleus and specialized organelles, but they also display significant structural and functional differences. Animal Cells Animal cells are generally smaller and have a flexible, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The retinoids, a group of molecules related to the dietary retinol  (vitamin A) , are essential for vision and reproduction, growth and the maintenance of epithelial tissue. They also play an essential part in the immune system. Retinoic acid, which is derived by oxidation of retinol plays a major role in the action of the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Vitamin B1 (Thiamine)? Definition of Vitamin B1 (Thiamine) Vitamin B1, also known as thiamine, is a water-soluble vitamin essential for the metabolism of glucose and amino acids in the body. It plays a critical role in energy production and is vital for the proper function of the nervous system. Thiamine is naturally found ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Vitamin B12? Microorganisms used for B12 Productions Streptomyces griseus, S. olivaceus, Bacillus megaterium, B. coagulans, Pseudomonas denitrificans, Propionibacterium freudenreichi, P. shermani, and a mixed fermentation of a Proteus spp. and a Pseudomonas spp. may be used in the industrial manufacture of vitamin B12. Typically, Vitamin By is produced via the submerged-culture method. The ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Vitamin C (Ascorbic Acid)? Definition of Vitamin C (Ascorbic Acid) Vitamin C, also known as ascorbic acid, is a water-soluble essential nutrient found in various foods, primarily in citrus fruits. It plays a crucial role in tissue repair, collagen synthesis, and acts as an antioxidant, protecting cells from damage. Humans must obtain it ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Vitamin D? Definition of Vitamin D Vitamin D is a fat-soluble secosteroid that plays a crucial role in calcium absorption in the gut, promoting bone health and regulating various other biological functions. It can be naturally obtained from sunlight exposure, certain foods, and supplements. Once ingested or synthesized in the skin, it undergoes ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Vitamin E? Definition of Vitamin E Vitamin E is a fat-soluble antioxidant essential for human health that protects cell membranes from damage by reactive oxygen species and plays a role in immune function, skin health, and vision. It encompasses a group of eight compounds, including four tocopherols and four tocotrienols. Chemical structures of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Vitamin K? Definition of Vitamin K Vitamin K is a fat-soluble vitamin essential for the synthesis of proteins involved in blood coagulation and bone health. It is naturally found in green leafy vegetables, certain animal foods, and is also produced by gut bacteria. Properties of vitamin K Different forms of vitamin K Vitamin ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Vitamins? Definition of Vitamins Vitamins are organic molecules essential in small amounts for an organism’s proper metabolic function, which are typically obtained through the diet as they cannot be synthesized by the organism in sufficient quantities. History and nomenclature of Vitamins The history and nomenclature of vitamins have their roots in the early ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

In 1898, Voges as well as Proskauer (16)characterized the process of fermentation of sugars by a variety of bacteria. They demonstrated that the gas that was produced during the process was a mixture of H2 and CO2 that when they added KOH to the cultures been grown in glucose peptone medium to allow for a prolonged period of incubation in presence of oxygen certain organisms developed a red fluorescent color. While the exact nature of the color was not known in the early days, this technique was suggested to differentiate between the bacterial strains that produced it and ones that didn't. in 1906 Arthur Harden analyzed the fermentation products of Enterobacter aerogenes. He discovered that when it was surrounded by glucose, the organism made two compounds, acetoin as well as 2,3-butanedio.

What is Volumetric Pipette? Principle of Volumetric Pipette The principle of a volumetric pipette is based on its precise design and calibration, which enable the accurate measurement and transfer of a fixed volume of liquid. This functionality is crucial for tasks requiring exact quantities of liquid, such as in analytical chemistry, titrations, and solution preparation. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What Is Volvox? Definition of Volvox Volvox is a polyphyletic genus of chlorophyte green algae that forms spherical colonies composed of thousands of cells and inhabits various freshwater environments. Discovery of Volvox: Unveiling a Microscopic Marvel The origins of Volvox, a captivating microorganism, are steeped in mystery, intertwining with the annals of scientific exploration. Over ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Volvox? The taxonomic genus Volvox, a member of the family Vovlocacae, constitutes a distinctive assemblage of green algae that manifests itself as a singular spherical colony composed of a remarkable aggregation of over 50,000 cells. The ubiquity of Volvox within freshwater ecosystems, encompassing diverse habitats such as ponds, puddles, and ditches, accentuates its ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is a Vortex Mixer? Definition of Vortex Mixer A vortex mixer is a laboratory device that uses rapid circular oscillations to create a swirling motion, or vortex, in small volumes of liquid samples for efficient mixing and blending. Principle of Vortex Mixer The principle of a vortex mixer is based on the oscillation of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Coliforms are all facultative and aerobic rod-shaped, gram-negative, non-spore-forming bacteria that produce lactose by fermentation with gas and acid production within 48 hours, at temperatures of 35 degrees Celsius. Methods to identify, enumerate and presumedly identify coliforms are utilized in the testing of dairy and food products. One method of performing the presumptive test to identify coliforms employs the Violet Red Bile Agar (VRBA). The Violet Red Bile Aggar (VRBA) is an selec-tive medium that can be used to detect and quantify lactose-fermenting coliform microorganisms.

What is waste?  Types of Waste Based on its physical properties On the basis of their physical features, trash can be classified as solid waste (such as garbage), liquid waste (such as wastewater), and gaseous waste. Based on pattern of use Based on the pattern of use, it can be classified into  Based on source ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is a water distiller? Definition Water distiller A water distiller is a device that purifies water by heating it to produce steam, then cooling and condensing the steam to remove impurities. This process helps remove contaminants such as bacteria, viruses, heavy metals, and minerals, resulting in purified and distilled water. Principle of Water Distiller ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Water is indispensable for all forms of life, and its role in the plant kingdom is particularly crucial. The relationship between water and plants is prominently illustrated in lush environments where vegetation flourishes, contrasting sharply with arid regions that suffer from water scarcity. Among the various environmental factors influencing plant growth—light, temperature, soil, and water—it ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

In 1953, James Watson and Francis Crick made a groundbreaking contribution to the understanding of DNA structure. By combining physical and chemical data, they proposed a model for DNA as a double helix, a twisted molecule consisting of two complementary strands held together by hydrogen bonds. This model revolutionized our knowledge of genetics and unlocked ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Wave Bioreactor? Working Principle of Wave Bioreactor Types of Wave Bioreactor Wave bioreactors mix and oxygenate cell cultures using mechanical waves. Various wave bioreactors create waves using different mechanisms: Parts of Wave Bioreactor Wave bioreactors mix and oxygenate culture media by rocking. Its main components are: Operating Procedure of Wave Bioreactor The operating ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

West Nile virus (WNV) is the most prevalent disease transmitted by mosquitoes in the continental United States. It is often transmitted to humans through the bite of an infected mosquito. Cases of West Nile virus arise during the summer and fall mosquito season. There are no vaccinations or drugs to prevent or treat WNV in ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

In molecular biology Western blotting is a rapid and sensitive assay for detection and characterization of proteins. This technique exploits the inherent specificity of antigen-antibody interaction to identify specific antigens by polyclonal or monoclonal antibodies.

What are bacteria? Definition of Bacteria Bacteria are microscopic, single-celled prokaryotic organisms lacking a nucleus and membrane-bound organelles, found in diverse environments, and essential for ecological processes, industrial applications, and human health. Origin and Early Evolution of Bacteria Bacteria represent some of the earliest life forms on Earth, with origins dating back approximately 4 billion ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

In the wake of the COVID-19 outbreak this pandemic has raised questions regarding the effectiveness of the body's capability to fight off illnesses. Naturally the body fights diseases by activating its immune response that trigger a series of mechanisms within the body to remove the pathogen from the body.

What is a Lichen? Habit and Habitat of Lichens General Characteristics of Lichens Types of Lichens Lichens, fascinating organisms formed by the symbiotic relationship between fungi and algae, display a variety of forms and structures. These types are primarily categorized based on their morphology and growth forms. Classification of Lichens based on different factors Lichens, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

A ribonucleoprotein known as telomerase, terminal transferase adds a repeat sequence of telomeres to the 3′ end of chromosomes, the length of which varies depending on species. In most eukaryotic organisms, the chromosomal ends are capped by a repeating sequence known as a telomere. Telomeres prevent DNA damage and chromosomal fusion at the chromosome’s end. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Zoology is the biological discipline devoted to the study of animals and the animal kingdom. Also referred to as animal biology. Zoology is the study of the connection between the animal kingdom and their environments, including taxonomy, habits, structure, embryology, distribution, evolution, and extinct species. Zoology is the branch of biology concerned with animal life. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Escherichia coli, commonly referred to as E. coli, is a type of Gram-negative bacterium. It is facultative anaerobic, meaning it can survive in environments with or without oxygen, and has a rod-shaped morphology. E. coli is predominantly found in the lower intestine of warm-blooded organisms, including humans (endotherms). Human strains of E. coli can be ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Alage? In 1753 Linnaeus first, introduce the term Algae, it is a Latin word (seaweeds) which means the Hepaticae. Algae are the most prominent group of Thallophyta which is the primitive and most simplistic division of the plant kingdom. Where Thallos means a sprout and phyton means a plant. What is Algae? Characteristics ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is bacteria? Bacteria is an essential part of the environment. They are considered as the first life forms to appear on Earth. Biologists estimated that the first forms of life appeared on Earth about 4 billion years ago, which was a unicellular microorganism, the modern name is bacteria. It is estimated that one gram ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Continuing Evolution? Evolution as an Ongoing Process Evolution is a continuous phenomenon, where populations of organisms undergo various changes over time due to numerous biological processes. Understanding these processes is crucial for both students and educators, as they illustrate the dynamic nature of life on Earth. Below are key components that highlight the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Developmental Biology? Developmental biology is a branch of biology that studies the processes and mechanisms by which multicellular organisms grow, develop, and reach their final form from a single fertilized egg or embryo. It examines how cells differentiate and specialize to form different tissues and organs, as well as how these structures are ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

A dihybrid crossing is a gene-cross between people who have homozygous or heterozygous genotypes that have two distinct characteristics or traits. Dihybrid crosses differ from the monohybrid crossing that only involves one genetic character or characteristic.

The DNA Data Bank of Japan (DDBJ) is a pivotal resource in the realm of genomics and bioinformatics, playing a crucial role in advancing scientific research and collaboration. Established in 1987, DDBJ was created to support the growing need for accessible, comprehensive genomic data. Its mission is to collect, maintain, and disseminate DNA sequence data, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is DNA Replication? Definition of DNA Replication DNA replication is the biological process by which a cell duplicates its DNA molecule, producing two identical copies from one original DNA strand, ensuring the transmission of genetic information during cell division. DNA Replication Enzymes and Proteins DNA replication is a fundamental biological process, relying on various ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The EMBL Nucleotide Sequence Database, commonly referred to as EMBL-Bank, is a pivotal resource in the realm of molecular biology. As an extensive repository of nucleotide sequences, EMBL-Bank plays a crucial role in biological research by providing a comprehensive and up-to-date collection of DNA sequences from a diverse range of organisms. This database is invaluable ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Entropy is among the most important concepts that students should be able to comprehend clearly when learning Chemistry as well as Physics. In addition, entropy may be described in a variety of ways, which means it can be used in a variety of stages or scenarios, like the thermodynamics stage, in cosmic cosmology, or even ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Ergonomic Pipetting? Ergonomic pipetting is the design and use of laboratory pipettes in a way that reduces the risk of injury or strain to the hands and wrists of the user. Pipetting is a repetitive task that, if not done properly, can lead to discomfort and even injury over time. Ergonomic pipetting involves ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is gene expression? Gene expression definition Gene expression is the process by which the genetic information encoded in a gene is used to produce a functional product, typically a protein or a specific RNA molecule. Stages in Gene Expression 1. Transcription 2. Translation What is gene expression profiling? Methods or Steps of gene expression ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

A revolutionary discipline has emerged in the ever-evolving field of biology, promising to reveal the mysteries of life itself. Genomics, the study of an organism’s entire DNA sequence, contains the key to understanding the complex genetic code that shapes and regulates all living things. Genomics has transcended the boundaries of traditional biology, providing profound insights ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Induced Fit Model? Evidences Supporting Induced Fit Model The Induced Fit Model has garnered significant attention in the realm of biochemistry, and various pieces of evidence support its validity. This model posits that proteins, including enzymes, are not static or rigid structures. Instead, they exhibit dynamic properties, allowing them to adapt and change ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Lock and Key Model? The Lock and Key Model Concept The “Lock and Key Model” is a fundamental concept in enzymology, introduced by Emil Fischer in 1899. This model provides an analogy to explain the specificity exhibited by enzymes during their interactions with substrates. In this analogy, the enzyme is likened to a ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Non-Mendelian Inheritance? Types of Non-Mendelian Inheritance Non-Mendelian inheritance patterns reveal a range of genetic mechanisms that extend beyond Mendel’s classical laws of inheritance. These patterns involve complex interactions between genes and their expression. The following are key types of non-Mendelian inheritance:

In some places, phycology is also called algology. It is the study of algae, which are part of the plant kingdom.

What is Phytogeography? What is the Meaning of Phytogeography? Phytogeography, combining the Greek words for “plant” (phytón) and “geography” (geographía), refers to the study of the geographic distribution of plant species. This field investigates where plants are found across the earth’s surface and examines the environmental and ecological factors influencing their distribution. Phytogeography encompasses all ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Plant Taxonomy? Plant taxonomy is the scientific discipline dedicated to finding, identifying, describing, classifying, and naming plants. Known also as systematic botany, it plays a crucial role in organizing the vast diversity of plant life on Earth. This field, a branch of biology, focuses on the similarities and differences among species to facilitate ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Plant-water Relations? Importance of water to plants Properties of Water Property Value and Units Cohesive Strength >25 MPa Surface Tension 0.073 N m⁻¹ at 20°C Viscosity 0.0018 Pa s at 0°C 0.0010 Pa s at 20°C Diffusion Coefficient of Small Solutes ∼1×10⁻⁹ m² s⁻¹ Molar Volume (Pure Water at 20°C) 1.81×10⁻⁵ m³ mol⁻¹ ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Proteins are fundamental to virtually all biological processes, serving as the building blocks of cells, enzymes catalyzing biochemical reactions, and key regulators of cellular functions. Understanding protein structures, functions, and interactions is essential for advancing biological research, drug development, and medical diagnostics. The sheer complexity and diversity of proteins, however, pose significant challenges for researchers ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Semiconductor Sequencing? Semiconductor sequencing is the integration of microchip technology with DNA sequencing where electrical signals replace the detection of light. This sequencing method is unique because it uses complementary metal-oxide semiconductor chips associated with sequencing by synthesis chemistry; so, in this respect, it opens up opportunities to make DNA analysis quicker and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Basidiomycetes? Basidiomycetes, belonging to the Basidiomycota division, represent a significant group within the fungi kingdom. Characterized by their unique reproductive structures, basidiomycetes are commonly known as club fungi, a name derived from the club-like shape of their spore-bearing cells, the basidia. These basidia are the defining feature of basidiomycetes, typically found on the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Cloaca? Characteristics Features of Cloaca The cloaca is a multifunctional anatomical feature present in various vertebrate animals, characterized by several distinct characteristics: What is Anus? Characteristics Features of Anus The cloaca is a distinctive anatomical structure found in various vertebrate species, encompassing several key characteristics: Difference Between Cloaca and Anus The cloaca and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Ebola ? Ebola is a virus that causes a severe and often fatal disease in humans and nonhuman primates (such as monkeys, gorillas, and chimpanzees). The virus is named after the Ebola River in the Democratic Republic of Congo (formerly Zaire), where it was first identified in 1976. Ebola is a viral hemorrhagic ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Holobasidium? What is Basidium? What is Phragmobasidium? Difference Between Holobasidium and Phragmobasidium Holobasidium and Phragmobasidium are two distinct types of basidia, which are reproductive structures found in fungi belonging to the division Basidiomycota. These structures play a crucial role in the life cycle of these fungi, particularly in spore production and dispersal. Understanding ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Neisseria Gonorrhoeae? Neisseria gonorrhoeae is a bacterium that can cause the sexually transmitted infection (STI) called gonorrhea. It is transmitted through sexual contact and can infect the genital tract, anus, and throat. Symptoms of gonorrhea can include painful urination, discharge from the genitals, and painful or swollen testicles in men, and abnormal vaginal ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

When it comes to molecular cloning and genetic engineering, vectors play a crucial role. These vectors act as carriers, transporting foreign genetic material into host cells, allowing for replication and expression. In this article, we will explore the different types of vectors, such as plasmids, viral vectors, cosmids, and artificial chromosomes, and their various applications. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Algae & Toxic Algae Algae are simple, photosynthetic organisms that inhabit aquatic habitats such as oceans, lakes, and wetlands. They appear in a variety of sizes, shapes, and hues and are a vital food source for aquatic animals and insects. They are also utilized in industries such as the culinary and fuel industries. Nevertheless, certain ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Viruses are extremely immunegenic and cause two kinds of immune responses: the humoral and the cellular. The range of specificities of B and T cells is derived from changes in the somatic genome and rearrangements. T B cells and T typically recognise the exact epitopes within the exact virus. B cells recognize the free proteins unaltered in their original 3-D configuration while T cells typically view Ag in a denatured form. Ag in a denatured state together in conjunction with MHC molecules. The features of an immune reaction for the exact virus can be different for different individuals based on their genetic makeup. It is responsible for preventing infection by this virus (neutralization). The IgG and IgM class are particularly relevant. IgM as well as the IgG class are especially important to protect against viral infections, which are often accompanied by viraemia. The antibodies from IgA class are particularly relevant for defense against viraemia. IgA class are essential for infections contracted through the mucosa. (the nose and the intestinal tract) However, the immune system kills the infected cells that express viruses' proteins onto their surface including glycoproteins that envelope viruses have and occasionally the essential proteins of these viruses.

What is Visceral Arches? Evolution of Visceral Arches Cyclostomes Elasmobranchs Bony fishes Amphibia Reptiles Birds Mammals Mammals, a diverse group of warm-blooded vertebrates, exhibit specific modifications in their skull, ear ossicles, and laryngeal structures that are distinct from other vertebrate groups. In mammals, the pterygoquadrate bone breaks into two parts: the alisphenoid, which becomes part ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Hepaticopsida (Liver Worts)? Hepaticopsida, commonly known as liverworts, are a class of bryophytes characterized by their liver-shaped thallus, which is a simple plant body. This group of plants possesses unique structural and reproductive features that distinguish them from other bryophytes. Plant Body Structure Sporophyte Dependence Reproductive Structures Examples of Liverworts What is Hepaticopsida ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What are Cereals? Cereals are among the most vital sources of plant-based food for humans and animals. They have held this significance since ancient times, with their cultivation dating back so far that their wild ancestors are no longer recognizable. Over centuries, numerous species and varieties have been developed, even before recorded history. The ancient ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Wheatley Trichrome Staining? In parasitology, intestinal protozoans are typically detected and identified from faeces samples using a specialised permanent technique called Wheatley Trichrome staining. Wheatley Trichrome Stain is suggested for use in qualitative methods for the detection, identification, and distinction of intestinal protozoa from background material. Typically, PVA-fixed or Schaudinn’s solution-preserved faecal specimens ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Immunogenicity? A. Properties of Immunogen 1. Foreignness 2. Molecular Size 3. Chemical Nature and Heterogeneity 4. Physical form 5. Susceptibility to antigen processing and presentation B. Biological System of Host FAQ

What is White Blood Cell (Leukocytes)? Dfinition of White Blood Cell (Leukocytes) White blood cells, or leukocytes, are immune system cells responsible for defending the body against infections, pathogens, and foreign invaders. They originate from the bone marrow and can be categorized into various subtypes based on their functions and characteristics. Formation of White Blood ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Whittaker’s Five Kingdom Classification brings evolutionary changes in classification system of organisms. Since the centuries, biologists are trying to classify organisms in different ways. Even, Greek philosopher and polymath Aristotle tried to classify organisms on the basis of their habitats, such as whether they lived on land, water, or air.  Then Carolus Linnaeus proposed a ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Whole Genome Sequencing? Principle of Whole Genome Sequencing The principle of whole genome sequencing (WGS) revolves around the complete sequencing of an organism’s DNA, encompassing both coding and non-coding regions. This method provides a thorough understanding of the genome, detailing the genes, regulatory elements, and variations present. WGS begins with the extraction of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

The Widal test is an agglutination test that determines any antibodies present in the patient's serum that are generated against the causal agents of the enteric febrile illness (Salmonella Typhi, and Salmonella paratyphi B, A as well as C).

Types of Wine Depending on the type of grape, yeast strain, fermentation process, etc., there are a variety of wines. There are so many differences amongst them that it becomes impossible to classify them accurately. However, the following are notable wine varieties: 1. Red wines 2. Dry wines 3. Sweet wines 4. Sparkling wines 5. ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Wood, or secondary xylem, is a complex tissue derived from the vascular cambium, primarily found in the stems and roots of both gymnosperm and angiosperm-dicotyledonous plants. The study of wood through microscopic observation is termed xylotomy. This narrative explores the intricate structure and classification of wood, detailing its components and their functions. Ray parenchyma Ray ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Working Distance? Working distance in an optical equipment such as a microscope is basically the space separating the lens and the thing you are viewing. You must pay close attention to the physical distance if you want to correctly see the specimen. This area is really important as it controls the proximity of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

This stain was discovered by German chemist Gustav Giemsa, that’s why its called Wright Giemsa Stain.

Wright’s stain is a modified Romanowsky stain. In hematology laboratory, it is used for the staining of peripheral blood smear, bone marrow aspirates, and urine samples.

Lymphatic filariasis is a parasitic disease caused by three microscopic, thread-like worms, called Wuchereria bancrofti, Brugia malayi and Brugia timori. These worms infect the lymphatic system and cause Lymphatic filariasis. The adult worm can be found in the human lymph system, this system helps to maintain the body’s fluid balance and fights against infections.

Some bacteria make substances that other bacteria need to grow. The X factor and the V factor are two such substances. The heat-stable X-factor can be protoporphyrin IX, hemin, or other iron-containing porphyrins. It can be found in red blood cells and outside of them in the blood. The heat-sensitive V-factor may be nicotinamide adenine dinucleotide (NAD) or nicotinamide adenine dinucleotide phosphate (NADP), and it is mostly found inside red blood cells. The X and V factor test or a disc test can be used to find out if a bacterium depends on its X factor or its V factor. The results can help identify the bacteria.

What is X-Ray Crystallography? Principles and Workings of X-Ray Crystallography What is Diffraction? Diffraction is a process that happens when light strikes an obstruction. Light waves can bend around the obstacle or, when a slit is present may pass between the slits. The resulting pattern of diffraction will reveal the areas that are subject to ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is X-Ray Spectroscopy? History of X-ray spectroscopy The history of X-ray spectroscopy dates back to the late 19th and early 20th centuries, with notable contributions from pioneering scientists. Here is an overview of the key milestones: The discoveries and advancements made by these scientists laid the foundation for X-ray spectroscopy and crystallography. Over the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Xanthophyta? Characteristics of Xanthophyceae Xanthophyceae, commonly known as yellow-green algae, is a diverse group that primarily inhabits freshwater environments, although some species can be found in marine and terrestrial habitats. This group exhibits a variety of morphological and physiological characteristics that distinguish it from other algal divisions. Below is a structured overview of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Proteins are polymers of amino acids. They are complex organic compounds containing nitrogen, hydrogen, carbon and oxygen. Proteins are abundant in our everyday food e.g. egg, soya bean, pulses, fish, milk etc. The presence of proteins can be confirmed qualitatively by usign several tests, Xanthoproteic test is one of them. Due to the presence of characteristic side chains in them, certain amino acids exhibit typical color reactions that form the basis for their identification.

What is xenopsylla cheopis? Classification of xenopsylla cheopis Scientific Name:  Xenopsylla cheopis (Rothschild, 1903) Kingdom: Animalia Phylum: Arthropoda Class: Insecta Order: Siphonaptera Family: Pulicidae Genus: Xenopsylla Habitat of xenopsylla cheopis Xenopsylla cheopis, commonly known as the Oriental rat flea, primarily inhabits tropical and subtropical environments, although it can also be found in temperate regions. This flea ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Xylem Parenchyma? Plant Tissues Plant tissues can be categorized based on their structure and the functions they perform. Understanding the classification of plant tissues is fundamental for students and educators in botany and plant biology. The two primary categories of plant tissues are meristematic tissues and permanent tissues. Xylem Xylem, derived from the ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Xylose Lysine Deoxycholate agar (XLD) is a selective medium that allows for the isolation and growth of Salmonella and Shigella species using clinical samples or food. Taylor developed XLD Agar to aid in the differentiation, isolation and identification of enteric disease agents and support the growth more specialized enteric organisms. XLD Agar is a well-proven medium that allows the growth of Shigella species. It is also an excellent medium to isolate Salmonella species. It has a pH value of 7.4, giving it a bright pink to red color due to the indicator phenol. 

What is Yeast? Definition of Yeast Cell A yeast cell is a single-celled, eukaryotic microorganism belonging to the fungus kingdom, characterized by its ability to ferment sugars into alcohol and carbon dioxide. It is widely used in baking, brewing, and biotechnological industries. Yeast cells vary in size and shape, reproduce mainly asexually through budding, and ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Yeast Artificial Chromosomes (YACs)? Yeast artificial chromosomes (YACs) are the result of a recombinant DNA cloning technique used to isolate and propagate extremely large DNA segments in a yeast host. The YAC cloning system enables the replication of exogenous DNA segments as linear molecules on a significantly larger scale than is possible with ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Yeast? Yeast are tiny, single-celled fungi that play a crucial role in creating everyday delights like bread, beer, and wine through a process called fermentation. These minuscule organisms have an impressive ability to multiply and adapt, making them essential for various culinary and scientific applications. These unicellular organisms, belonging to the Fungus Kingdom, ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Yeasts are eukaryotic, unicellular microorganisms that belong to the kingdom of fungi. The first yeast appeared hundreds of millions of years ago, and there are approximately 1,500 known kinds. Yeasts are unicellular organisms that developed from multicellular predecessors, with certain species able to acquire multicellular traits by generating pseudohyphae, which are strings of connected budding ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Yeasts, unicellular eukaryotes, are a well-studied model organism in molecular genomics. They are chemoorganotrophs because they use organic compounds for energy. Yeast extract peptone, or YEPD), Growth Agar is used to maintain and propagate yeasts. YPD is a complete medium that allows for yeast growth.

What is Yersinia enterocolitica? Characteristics of Yersinia enterocolitica Yersinia enterocolitica possesses several characteristic features: These characteristics collectively contribute to the identification and classification of Y. enterocolitica within the Yersinia genus and aid in understanding its behavior and survival in various environments. Contamination Source of Yersinia enterocolitica Food Poisoning Signs and Symptoms Yersinia enterocolitica Food Poisoning Pathogenic Mechanism Yersinia enterocolitica ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Yersinia Pestis? Yersinia Pestis Definition Yersinia pestis is a gram-negative coccobacillus bacterium responsible for causing the disease known as the plague, historically linked to significant pandemics such as the Black Death. This facultative anaerobic organism is an obligate parasite, primarily transmitted to humans through the bite of infected fleas. General characteristics of Yersinia ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Schiemann first described Yersinia selective agar as an alternative to MacConkey agar and other media commonly used for isolating Yersinia Enterocolitica, a causative organism of gastroenteritis. Yersinia Enterocolitica, a major food- or waterborne enteric pathogen, has been reported to cause epizootic outbreaks in animals such as diarrhea, lymphadenopathy and pneumonia. Yersinia Selective Agar, a selective and differentiated medium that supports the growth of Y. Enterocolitica and other Yersinia spp.

Ziehl Neelsen stinging method is used to differentiate between the acid-fast and non-acid fast bacteria.

Zika Virus (ZIKV) Characteristics of Zika Virus (ZIKV) Structure of Zika Virus Genome Structure of Zika Virus Zika Virus Replication Viruses cannot replicate until they infect and “reprogram” appropriate host cells to become virus-producing factories. The epidermis and dermis of the host skin contain fibroblast, keratinocytes, and immature dendritic cells where the Zika virus replicates. In ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Zonation? Definition of Zonation Zonation is the spatial arrangement of distinct ecological communities based on predominant flora and fauna across a gradient, influenced by both biotic and abiotic factors. How Does Zonation Works? Zonation in ecological contexts refers to the distinct stratification or partitioning of habitats or ecosystems into zones, each characterized by ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Zoogeographical Realms? Types of Zoogeographical Realms 1. Palaearctic Realm 2. Nearctic Realm 3. Neo-tropical Realm 4. Ethiopian Realm 5. Oriental Realm 6. Australian Realm FAQ

Continental Drift Theory Different Stages of Continental Drift Theory Different Forces Responsible for Continental Drift Note: It is important to mention that these factors were later found to be insufficient to fully explain continent drifting, which led to criticism of Wegener’s theory. Evidence Supporting Continental Drift Theory Evidence Supporting Continental Drift Theory: Criticisms of Continental ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Zoogeography? What is Zoogeographical realms? Zoogeographical realms, also known as biogeographical realms or ecozones, are large geographic regions characterized by distinctive combinations of animal species. These realms are defined based on similarities in the composition and distribution of animal taxa within their boundaries. Here are the main zoogeographical realms recognized by biogeographers: These ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Zooplankton? What exactly are Zooplanktons? Zooplankton, a subset of the broader planktonic community, are heterotrophic organisms that inhabit both freshwater and marine environments. The term “plankton” encompasses a diverse array of organisms that float or drift within aquatic realms. Among these, zooplankton are distinguished by their heterotrophic nature, signifying their reliance on external ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

What is Zwitterion? Zwitterion Definition A zwitterion is a molecule that contains both positively and negatively charged functional groups, resulting in an overall neutral charge. Properties of Zwitterion Zwitterions exhibit several distinct properties due to their unique structure and combination of positively and negatively charged ions. Here are some key properties of zwitterions: Zwitterion Structure ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Causative Agent Habitat Transmission Risk factors  Types of mucormycosis (Zygomycosis) Symptoms of Zygomycosis (Mucormycosis) The symptoms of mucormycosis vary on where the fungus is growing in the body. 1,4 Contact your healthcare practitioner if you believe you have mucormycosis-related symptoms. The following are symptoms of rhinocerebral (sinus and brain) mucormycosis: The following are symptoms of ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>

Zygomycota or zygote Zygomycota, also known as zygote is a previous division or phylum belonging to the kingdom of Fungi.

What is a Zygote? A zygote is a crucial concept in biology, representing the very first stage of a new organism’s development following the fertilization event. The term “zygote” (pronounced /ˈzaɪˌɡoʊt/) originates from the Ancient Greek word ζυγωτός (zygōtós), meaning ‘joined’ or ‘yoked,’ derived from ζυγοῦν (zygoun), which means ‘to join’ or ‘to yoke’. This ... <a title="All Biology Study Notes" class="read-more" href="https://biologynotesonline.com/all-biology-study-notes/" aria-label="Read more about All Biology Study Notes">Read more</a>