What is Gene Prediction? Example Gene: A sequence of nucleotides coding for protein Gene Prediction Problem: Determine the beginning and end positions of genes in a genome atgcatgcggctatgctaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgggatccgatgacaatgcatgcggctatgctaatgaatggtcttgggatttaccttggaatgctaagctgggatccgatgacaatgcatgcggctatgctaatgaatggtcttgggatttaccttggaatatgctaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgcggctatgctaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatcctgcggctatgctaatgaatggtcttgggatttaccttggaatgctaagctgggatccgatgacaatgcatgcggctatgctaatgaatggtcttgggatttaccttggaatatgctaatgcatgcggctatgctaagctgggaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgcggctatgctaatgcatgcggctatgctaagctcatgcggctatgctaagctgggaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgcggctatgctaatgcatgcggctatgctaagctcggctatgctaatgaatggtcttgggatttaccttggaatgctaagctgggatccgatgacaatgcatgcggctatgctaatgaatggtcttgggatttaccttggaatatgctaatgcatgcggctatgctaagctgggaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgcggctatgctaatgcatgcggctatgctaagct Gene atgcatgcggctatgctaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgggatccgatgacaatgcatgcggctatgctaatgaatggtcttgggatttaccttggaatgctaagctgggatccgatgacaatgcatgcggctatgctaatgaatggtcttgggatttaccttggaatatgctaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgcggctatgctaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatcctgcggctatgctaatgaatggtcttgggatttaccttggaatgctaagctgggatccgatgacaatgcatgcggctatgctaatgaatggtcttgggatttaccttggaatatgctaatgcatgcggctatgctaagctgggaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgcggctatgctaatgcatgcggctatgctaagctcatgcggctatgctaagctgggaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgcggctatgctaatgcatgcggctatgctaagctcggctatgctaatgaatggtcttgggatttaccttggaatgctaagctgggatccgatgacaatgcatgcggctatgctaatgaatggtcttgggatttaccttggaatatgctaatgcatgcggctatgctaagctgggaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgcggctatgctaatgcatgcggctatgctaagct Bioinformatics and the Prediction of Genes Utilising computational algorithms and tools to analyse genomic data, bioinformatics plays an essential role in the prediction of genes. … Read more
What is FASTA format? FASTA format is a text-based format commonly used for representing nucleotide or protein sequences. It is named after the FASTA software package, which introduced this format. The FASTA format is widely used in bioinformatics and genomics for storing and exchanging sequence data. FASTA file looks like: A typical FASTA file consists … Read more
What is BLAST? BLAST, which stands for Basic Local Alignment Search Tool, is a widely used bioinformatics program and algorithm. It is designed to compare and analyze biological sequences such as DNA, RNA, and protein sequences. BLAST helps in identifying regions of similarity between different sequences, which can provide insights into their functional and evolutionary … Read more
What is Sequence Alignment? Sequence alignment is a computational technique used to compare and analyze the similarities and differences between two or more sequences of biological data, such as DNA, RNA, or protein sequences. By aligning sequences, researchers can identify conserved regions, detect mutations, infer evolutionary relationships, and predict functional elements. It involves arranging the … Read more
What is Programming Language? A programming language is a formal language that is used to write computer-executable instructions or code. It is a set of rules and syntax that enables programmers to communicate with computers and assign them specific instructions or tasks. Programming languages enable the creation of algorithms and software applications. They offer a … Read more
What is R Programming Language? R is a programming language and environment developed in the early 1990s by Ross Ihaka and Robert Gentleman at University of Auckland as a free‑software implementation of the S language, intended for statistical computing, graphics, and data analysis, and now widely used across academia, finance, healthcare, data science and research, … Read more
A phylogenetic tree (also phylogeny or evolutionary tree) is a branching diagram or a tree that illustrates the evolutionary relationships between various biological species or other entities based on similarities and differences in their physical or genetic characteristics. All life on Earth belongs to a singular phylogenetic tree, indicating a shared ancestry. In a rooted … Read more
Ever wondered how scientists unravel the family ties between different species or genes? It often starts with building something called a phylogenetic tree. Think of it like sketching out a massive family tree, but for life itself. These trees are powerful diagrams that map out evolutionary relationships, showing us who shared a common ancestor and when … Read more
What is Agrobacterium? There are many types of Gram-negative bacteria in the genus Agrobacterium. They can be harmful to plants and are also useful for genetic engineering. It causes tumours in plants by moving a piece of DNA known as T-DNA from its Ti or Ri plasmid into the plant genome. This causes cells to … Read more
Industrial fermentation processes leverage a wide array of raw materials, with a significant emphasis on utilizing cost-effective and readily available sources. Among these, agricultural by-products stand out due to their abundance and potential for repurposing. The interest in these materials stems from several key factors: The concept of transforming ‘wastes into resources’ is not just … Read more
