Secondary Databases Definition Secondary databases are repositories or resources that are specialized in storing and providing access to specific types of biological data within the field of bioinformatics. The creation of these databases is commonly achieved through the curation, organization, and integration of data from diverse primary sources, including experimental studies, literature, and other primary … Read more
Hey there! Ever wondered how scientists keep track of all the proteins in our bodies? It’s all thanks to protein databases! These handy tools are like giant digital libraries where researchers can find detailed info about proteins. In this article, we’ll break down what protein databases are, explore the different types out there, and check … Read more
Welcome to the fascinating world of nucleotide databases, where the intricacies of genetic information come to life! Nucleotide databases are invaluable resources that house a vast collection of nucleotide sequences from various organisms, providing a wealth of information about DNA and RNA molecules. These databases serve as essential tools for scientists, researchers, and students delving … Read more
The technique of homology modeling, which is also referred to as comparative modeling, is a robust computational approach that is widely employed in the domain of structural biology. The technique enables researchers to forecast the spatial arrangement of a protein or any other macromolecule by utilizing its amino acid sequence and the established configuration of … Read more
In a world dominated by technological advancements and an increasing knowledge of the intricacies of our planet’s natural environment scientists and researchers have launched an innovative project known as the Earth BioGenome Project (EBP). This ambitious global project aims to sequence and catalogue the genomes of every known species of Earth which will lead to a … Read more
The conventional approach to drug discovery and development in the pharmaceutical industry is frequently characterized by prolonged timelines, high expenses, and a propensity for setbacks. The drug discovery process has been revolutionized by the emergence of bioinformatics and advancements in computational technologies, leading to the development of a new approach known as in silico drug … Read more
A revolutionary discipline has emerged in the ever-evolving field of biology, promising to reveal the mysteries of life itself. Genomics, the study of an organism’s entire DNA sequence, contains the key to understanding the complex genetic code that shapes and regulates all living things. Genomics has transcended the boundaries of traditional biology, providing profound insights … Read more
The Human Genome Project (HGP) was an international scientific research endeavor with the objective of identifying, mapping, and sequencing all the genes of the human genome from a physical and functional standpoint. It began in 1990 and was finished in 2003.It remains the largest collaborative biological project in the globe.After its adoption by the US … Read more
What is Gene Prediction? Example Gene: A sequence of nucleotides coding for protein Gene Prediction Problem: Determine the beginning and end positions of genes in a genome atgcatgcggctatgctaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgggatccgatgacaatgcatgcggctatgctaatgaatggtcttgggatttaccttggaatgctaagctgggatccgatgacaatgcatgcggctatgctaatgaatggtcttgggatttaccttggaatatgctaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgcggctatgctaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatcctgcggctatgctaatgaatggtcttgggatttaccttggaatgctaagctgggatccgatgacaatgcatgcggctatgctaatgaatggtcttgggatttaccttggaatatgctaatgcatgcggctatgctaagctgggaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgcggctatgctaatgcatgcggctatgctaagctcatgcggctatgctaagctgggaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgcggctatgctaatgcatgcggctatgctaagctcggctatgctaatgaatggtcttgggatttaccttggaatgctaagctgggatccgatgacaatgcatgcggctatgctaatgaatggtcttgggatttaccttggaatatgctaatgcatgcggctatgctaagctgggaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgcggctatgctaatgcatgcggctatgctaagct Gene atgcatgcggctatgctaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgggatccgatgacaatgcatgcggctatgctaatgaatggtcttgggatttaccttggaatgctaagctgggatccgatgacaatgcatgcggctatgctaatgaatggtcttgggatttaccttggaatatgctaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgcggctatgctaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatcctgcggctatgctaatgaatggtcttgggatttaccttggaatgctaagctgggatccgatgacaatgcatgcggctatgctaatgaatggtcttgggatttaccttggaatatgctaatgcatgcggctatgctaagctgggaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgcggctatgctaatgcatgcggctatgctaagctcatgcggctatgctaagctgggaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgcggctatgctaatgcatgcggctatgctaagctcggctatgctaatgaatggtcttgggatttaccttggaatgctaagctgggatccgatgacaatgcatgcggctatgctaatgaatggtcttgggatttaccttggaatatgctaatgcatgcggctatgctaagctgggaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgcggctatgctaatgcatgcggctatgctaagct Bioinformatics and the Prediction of Genes Utilising computational algorithms and tools to analyse genomic data, bioinformatics plays an essential role in the prediction of genes. … Read more
What is FASTA format? FASTA format is a text-based format commonly used for representing nucleotide or protein sequences. It is named after the FASTA software package, which introduced this format. The FASTA format is widely used in bioinformatics and genomics for storing and exchanging sequence data. FASTA file looks like: A typical FASTA file consists … Read more