Gene Prediction – Definition, Methods, Importance

Gene Prediction - Definition, Methods, Importance

What is Gene Prediction? Example Gene: A sequence of nucleotides coding for protein Gene Prediction Problem: Determine the beginning and end positions of genes in a genome atgcatgcggctatgctaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgggatccgatgacaatgcatgcggctatgctaatgaatggtcttgggatttaccttggaatgctaagctgggatccgatgacaatgcatgcggctatgctaatgaatggtcttgggatttaccttggaatatgctaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgcggctatgctaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatcctgcggctatgctaatgaatggtcttgggatttaccttggaatgctaagctgggatccgatgacaatgcatgcggctatgctaatgaatggtcttgggatttaccttggaatatgctaatgcatgcggctatgctaagctgggaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgcggctatgctaatgcatgcggctatgctaagctcatgcggctatgctaagctgggaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgcggctatgctaatgcatgcggctatgctaagctcggctatgctaatgaatggtcttgggatttaccttggaatgctaagctgggatccgatgacaatgcatgcggctatgctaatgaatggtcttgggatttaccttggaatatgctaatgcatgcggctatgctaagctgggaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgcggctatgctaatgcatgcggctatgctaagct Gene atgcatgcggctatgctaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgggatccgatgacaatgcatgcggctatgctaatgaatggtcttgggatttaccttggaatgctaagctgggatccgatgacaatgcatgcggctatgctaatgaatggtcttgggatttaccttggaatatgctaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgcggctatgctaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatcctgcggctatgctaatgaatggtcttgggatttaccttggaatgctaagctgggatccgatgacaatgcatgcggctatgctaatgaatggtcttgggatttaccttggaatatgctaatgcatgcggctatgctaagctgggaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgcggctatgctaatgcatgcggctatgctaagctcatgcggctatgctaagctgggaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgcggctatgctaatgcatgcggctatgctaagctcggctatgctaatgaatggtcttgggatttaccttggaatgctaagctgggatccgatgacaatgcatgcggctatgctaatgaatggtcttgggatttaccttggaatatgctaatgcatgcggctatgctaagctgggaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgcggctatgctaatgcatgcggctatgctaagct Bioinformatics and the Prediction of Genes Utilising computational algorithms and tools to analyse genomic data, bioinformatics plays an essential role in the prediction of genes. … Read more

FASTA – Definition, Programs, Working, Steps, Applications

FASTA - Definition, Programs, Working, Steps, Applications

What is FASTA format? FASTA format is a text-based format commonly used for representing nucleotide or protein sequences. It is named after the FASTA software package, which introduced this format. The FASTA format is widely used in bioinformatics and genomics for storing and exchanging sequence data. FASTA file looks like: A typical FASTA file consists … Read more

BLAST – Definition, Types, Characteristics, Outputs, Applications

BLAST - Definition, Types, Characteristics, Outputs, Applications

What is BLAST? BLAST, which stands for Basic Local Alignment Search Tool, is a widely used bioinformatics program and algorithm. It is designed to compare and analyze biological sequences such as DNA, RNA, and protein sequences. BLAST helps in identifying regions of similarity between different sequences, which can provide insights into their functional and evolutionary … Read more

Sequence Alignment – Definition, Types, Tools, Applications

Sequence Alignment - Definition, Types, Tools, Applications

What is Sequence Alignment? Sequence alignment is a computational technique used to compare and analyze the similarities and differences between two or more sequences of biological data, such as DNA, RNA, or protein sequences. By aligning sequences, researchers can identify conserved regions, detect mutations, infer evolutionary relationships, and predict functional elements. It involves arranging the … Read more

Different Programming Language for Bioinformatics

Different Programming Language for Bioinformatics

What is Programming Language? A programming language is a formal language that is used to write computer-executable instructions or code. It is a set of rules and syntax that enables programmers to communicate with computers and assign them specific instructions or tasks. Programming languages enable the creation of algorithms and software applications. They offer a … Read more

R Programming Language in Bioinformatics

R Programming Language in Bioinformatics

What is R Programming Language? R is a programming language and environment developed in the early 1990s by Ross Ihaka and Robert Gentleman at University of Auckland as a free‑software implementation of the S language, intended for statistical computing, graphics, and data analysis, and now widely used across academia, finance, healthcare, data science and research, … Read more

Phylogenetic Tree – Definition, Types, Steps, Methods, Uses

Phylogenetic Tree - Definition, Types, Steps, Methods, Uses

A phylogenetic tree (also phylogeny or evolutionary tree) is a branching diagram or a tree that illustrates the evolutionary relationships between various biological species or other entities based on similarities and differences in their physical or genetic characteristics. All life on Earth belongs to a singular phylogenetic tree, indicating a shared ancestry. In a rooted … Read more

How to construct a Phylogenetic tree?

How to construct a Phylogenetic tree?

Ever wondered how scientists unravel the family ties between different species or genes? It often starts with building something called a phylogenetic tree. Think of it like sketching out a massive family tree, but for life itself. These trees are powerful diagrams that map out evolutionary relationships, showing us who shared a common ancestor and when … Read more

Diaphragm of a Microscope – Definition, Types, Mechanism, Functions

Diaphragm of a Microscope - Definition, Types, Mechanism, Functions

What is Diaphragm of a Microscope? History of Diaphragm Definition of Diaphragm of a Microscope The diaphragm of a microscope is a component that controls the amount of light that passes through the specimen being observed. It is typically located between the light source and the stage, and consists of a series of adjustable blades … Read more

UV-Vis Spectroscopy – Principle, Instrumentation, Applications, Advantages, and Limitation

UV-Vis Spectroscopy - Principle, Instrumentation, Applications, Advantages, and Limitation

UV-Vis Spectroscopy, short for Ultraviolet-Visible Spectroscopy, is an analytical technique widely used in the fields of chemistry, physics, biochemistry, and molecular biology. It’s based on the absorption or transmission of UV and visible light by substances. At its core, UV-Vis Spectroscopy involves shining ultraviolet or visible light through a sample and measuring how much of … Read more