What is Gene Prediction? Example Gene: A sequence of nucleotides coding for protein Gene Prediction Problem: Determine the beginning and end positions of genes in a genome atgcatgcggctatgctaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgggatccgatgacaatgcatgcggctatgctaatgaatggtcttgggatttaccttggaatgctaagctgggatccgatgacaatgcatgcggctatgctaatgaatggtcttgggatttaccttggaatatgctaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgcggctatgctaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatcctgcggctatgctaatgaatggtcttgggatttaccttggaatgctaagctgggatccgatgacaatgcatgcggctatgctaatgaatggtcttgggatttaccttggaatatgctaatgcatgcggctatgctaagctgggaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgcggctatgctaatgcatgcggctatgctaagctcatgcggctatgctaagctgggaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgcggctatgctaatgcatgcggctatgctaagctcggctatgctaatgaatggtcttgggatttaccttggaatgctaagctgggatccgatgacaatgcatgcggctatgctaatgaatggtcttgggatttaccttggaatatgctaatgcatgcggctatgctaagctgggaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgcggctatgctaatgcatgcggctatgctaagct Gene atgcatgcggctatgctaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgggatccgatgacaatgcatgcggctatgctaatgaatggtcttgggatttaccttggaatgctaagctgggatccgatgacaatgcatgcggctatgctaatgaatggtcttgggatttaccttggaatatgctaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgcggctatgctaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatcctgcggctatgctaatgaatggtcttgggatttaccttggaatgctaagctgggatccgatgacaatgcatgcggctatgctaatgaatggtcttgggatttaccttggaatatgctaatgcatgcggctatgctaagctgggaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgcggctatgctaatgcatgcggctatgctaagctcatgcggctatgctaagctgggaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgcggctatgctaatgcatgcggctatgctaagctcggctatgctaatgaatggtcttgggatttaccttggaatgctaagctgggatccgatgacaatgcatgcggctatgctaatgaatggtcttgggatttaccttggaatatgctaatgcatgcggctatgctaagctgggaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgcggctatgctaatgcatgcggctatgctaagct Bioinformatics and the Prediction of Genes Utilising computational algorithms and tools to analyse genomic data, bioinformatics plays an essential role in the prediction of genes. … Read more
By Sourav Pan 0 revisions 27 min readby Sourav Pan
What is FASTA format? FASTA format is a text-based format commonly used for representing nucleotide or protein sequences. It is named after the FASTA software package, which introduced this format. The FASTA format is widely used in bioinformatics and genomics for storing and exchanging sequence data. FASTA file looks like: A typical FASTA file consists … Read more
By Sourav Pan 1 revisions 35 min readby Sourav Pan
What is BLAST? BLAST, which stands for Basic Local Alignment Search Tool, is a widely used bioinformatics program and algorithm. It is designed to compare and analyze biological sequences such as DNA, RNA, and protein sequences. BLAST helps in identifying regions of similarity between different sequences, which can provide insights into their functional and evolutionary … Read more
By Sourav Pan 0 revisions 23 min readby Sourav Pan
What is Sequence Alignment? Sequence alignment is a computational technique used to compare and analyze the similarities and differences between two or more sequences of biological data, such as DNA, RNA, or protein sequences. By aligning sequences, researchers can identify conserved regions, detect mutations, infer evolutionary relationships, and predict functional elements. It involves arranging the … Read more
What is Programming Language? A programming language is a formal language that is used to write computer-executable instructions or code. It is a set of rules and syntax that enables programmers to communicate with computers and assign them specific instructions or tasks. Programming languages enable the creation of algorithms and software applications. They offer a … Read more
What is R Programming Language? R is predominantly used for statistical computing and graphics. It was devised in the early 1990s at the University of Auckland in New Zealand by Ross Ihaka and Robert Gentleman. R offers a vast array of statistical and graphical techniques and is extensively utilised in a variety of fields, including … Read more
By Sourav Pan 0 revisions 35 min readby Sourav Pan
A phylogenetic tree (also phylogeny or evolutionary tree) is a branching diagram or a tree that illustrates the evolutionary relationships between various biological species or other entities based on similarities and differences in their physical or genetic characteristics. All life on Earth belongs to a singular phylogenetic tree, indicating a shared ancestry. In a rooted … Read more
Understanding the evolutionary connections and interdependence of various species is a fundamental aspect of biology. Phylogenetic trees, also known as evolutionary trees or cladograms, illustrate the common ancestry and divergence of species over time. Constructing a phylogenetic tree is an effective method for deciphering the intricate tapestry of life on Earth and obtaining insight into … Read more
What is Agrobacterium? Agrobacterium-mediated Gene Transfer Factors affecting Agrobacterium-mediated Gene Transfer Agrobacterium-mediated gene transfer is a widely used technique for introducing foreign DNA into plants. However, successful gene transfer depends on several factors, including: Why transform plants using Agrobacterium? Agrobacterium-mediated gene transfer is a preferred method for transforming plants for several reasons: Overall, Agrobacterium-mediated gene transfer is a … Read more
Organic waste adds to greenhouse gas emissions, soil and water contamination, and other environmental problems. Composting, anaerobic digestion, and vermicomposting are among the methods that can be used to manage organic waste. What is Organic waste? Organic waste refers to any waste material that originates from living organisms or their byproducts. This waste can be … Read more
⚠️
Click on your ad blocker icon in your browser's toolbar
Select "Pause" or "Disable" for this website
Refresh the page if it doesn't automatically reload