Sourav Pan

The technique of homology modeling, which is also referred to as comparative modeling, is a robust computational approach that is widely employed in the domain of structural biology. The technique enables researchers to forecast the spatial arrangement of a protein or any other macromolecule by utilizing its amino acid sequence and the established configuration of … Read more

In a world dominated by technological advancements and an increasing knowledge of the intricacies of our planet’s natural environment scientists and researchers have launched an innovative project known as the Earth BioGenome Project (EBP). This ambitious global project aims to sequence and catalogue the genomes of every known species of Earth which will lead to a … Read more

The conventional approach to drug discovery and development in the pharmaceutical industry is frequently characterized by prolonged timelines, high expenses, and a propensity for setbacks. The drug discovery process has been revolutionized by the emergence of bioinformatics and advancements in computational technologies, leading to the development of a new approach known as in silico drug … Read more

A revolutionary discipline has emerged in the ever-evolving field of biology, promising to reveal the mysteries of life itself. Genomics, the study of an organism’s entire DNA sequence, contains the key to understanding the complex genetic code that shapes and regulates all living things. Genomics has transcended the boundaries of traditional biology, providing profound insights … Read more

The Human Genome Project (HGP) was an international scientific research endeavor with the objective of identifying, mapping, and sequencing all the genes of the human genome from a physical and functional standpoint. It began in 1990 and was finished in 2003.It remains the largest collaborative biological project in the globe.After its adoption by the US … Read more

What is Gene Prediction? Example Gene: A sequence of nucleotides coding for protein Gene Prediction Problem: Determine the beginning and end positions of genes in a genome atgcatgcggctatgctaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgggatccgatgacaatgcatgcggctatgctaatgaatggtcttgggatttaccttggaatgctaagctgggatccgatgacaatgcatgcggctatgctaatgaatggtcttgggatttaccttggaatatgctaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgcggctatgctaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatcctgcggctatgctaatgaatggtcttgggatttaccttggaatgctaagctgggatccgatgacaatgcatgcggctatgctaatgaatggtcttgggatttaccttggaatatgctaatgcatgcggctatgctaagctgggaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgcggctatgctaatgcatgcggctatgctaagctcatgcggctatgctaagctgggaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgcggctatgctaatgcatgcggctatgctaagctcggctatgctaatgaatggtcttgggatttaccttggaatgctaagctgggatccgatgacaatgcatgcggctatgctaatgaatggtcttgggatttaccttggaatatgctaatgcatgcggctatgctaagctgggaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgcggctatgctaatgcatgcggctatgctaagct Gene atgcatgcggctatgctaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgggatccgatgacaatgcatgcggctatgctaatgaatggtcttgggatttaccttggaatgctaagctgggatccgatgacaatgcatgcggctatgctaatgaatggtcttgggatttaccttggaatatgctaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgcggctatgctaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatcctgcggctatgctaatgaatggtcttgggatttaccttggaatgctaagctgggatccgatgacaatgcatgcggctatgctaatgaatggtcttgggatttaccttggaatatgctaatgcatgcggctatgctaagctgggaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgcggctatgctaatgcatgcggctatgctaagctcatgcggctatgctaagctgggaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgcggctatgctaatgcatgcggctatgctaagctcggctatgctaatgaatggtcttgggatttaccttggaatgctaagctgggatccgatgacaatgcatgcggctatgctaatgaatggtcttgggatttaccttggaatatgctaatgcatgcggctatgctaagctgggaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgcggctatgctaatgcatgcggctatgctaagct Bioinformatics and the Prediction of Genes Utilising computational algorithms and tools to analyse genomic data, bioinformatics plays an essential role in the prediction of genes. … Read more

What is FASTA format? FASTA format is a text-based format commonly used for representing nucleotide or protein sequences. It is named after the FASTA software package, which introduced this format. The FASTA format is widely used in bioinformatics and genomics for storing and exchanging sequence data. FASTA file looks like: A typical FASTA file consists … Read more

What is BLAST? BLAST, which stands for Basic Local Alignment Search Tool, is a widely used bioinformatics program and algorithm. It is designed to compare and analyze biological sequences such as DNA, RNA, and protein sequences. BLAST helps in identifying regions of similarity between different sequences, which can provide insights into their functional and evolutionary … Read more

What is Sequence Alignment? Sequence alignment is a computational technique used to compare and analyze the similarities and differences between two or more sequences of biological data, such as DNA, RNA, or protein sequences. By aligning sequences, researchers can identify conserved regions, detect mutations, infer evolutionary relationships, and predict functional elements. It involves arranging the … Read more

What is Programming Language? A programming language is a formal language that is used to write computer-executable instructions or code. It is a set of rules and syntax that enables programmers to communicate with computers and assign them specific instructions or tasks. Programming languages enable the creation of algorithms and software applications. They offer a … Read more