What is Genomics?

What is Genomics?

A revolutionary discipline has emerged in the ever-evolving field of biology, promising to reveal the mysteries of life itself. Genomics, the study of an organism’s entire DNA sequence, contains the key to understanding the complex genetic code that shapes and regulates all living things. Genomics has transcended the boundaries of traditional biology, providing profound insights … Read more

The Human Genome Project – An Overview

The Human Genome Project - An Overview

The Human Genome Project (HGP) was an international scientific research endeavor with the objective of identifying, mapping, and sequencing all the genes of the human genome from a physical and functional standpoint. It began in 1990 and was finished in 2003.It remains the largest collaborative biological project in the globe.After its adoption by the US … Read more

Gene Prediction – Definition, Methods, Importance

Gene Prediction - Definition, Methods, Importance

What is Gene Prediction? Example Gene: A sequence of nucleotides coding for protein Gene Prediction Problem: Determine the beginning and end positions of genes in a genome atgcatgcggctatgctaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgggatccgatgacaatgcatgcggctatgctaatgaatggtcttgggatttaccttggaatgctaagctgggatccgatgacaatgcatgcggctatgctaatgaatggtcttgggatttaccttggaatatgctaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgcggctatgctaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatcctgcggctatgctaatgaatggtcttgggatttaccttggaatgctaagctgggatccgatgacaatgcatgcggctatgctaatgaatggtcttgggatttaccttggaatatgctaatgcatgcggctatgctaagctgggaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgcggctatgctaatgcatgcggctatgctaagctcatgcggctatgctaagctgggaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgcggctatgctaatgcatgcggctatgctaagctcggctatgctaatgaatggtcttgggatttaccttggaatgctaagctgggatccgatgacaatgcatgcggctatgctaatgaatggtcttgggatttaccttggaatatgctaatgcatgcggctatgctaagctgggaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgcggctatgctaatgcatgcggctatgctaagct Gene atgcatgcggctatgctaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgggatccgatgacaatgcatgcggctatgctaatgaatggtcttgggatttaccttggaatgctaagctgggatccgatgacaatgcatgcggctatgctaatgaatggtcttgggatttaccttggaatatgctaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgcggctatgctaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatcctgcggctatgctaatgaatggtcttgggatttaccttggaatgctaagctgggatccgatgacaatgcatgcggctatgctaatgaatggtcttgggatttaccttggaatatgctaatgcatgcggctatgctaagctgggaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgcggctatgctaatgcatgcggctatgctaagctcatgcggctatgctaagctgggaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgcggctatgctaatgcatgcggctatgctaagctcggctatgctaatgaatggtcttgggatttaccttggaatgctaagctgggatccgatgacaatgcatgcggctatgctaatgaatggtcttgggatttaccttggaatatgctaatgcatgcggctatgctaagctgggaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgcggctatgctaatgcatgcggctatgctaagct Bioinformatics and the Prediction of Genes Utilising computational algorithms and tools to analyse genomic data, bioinformatics plays an essential role in the prediction of genes. … Read more

FASTA – Definition, Programs, Working, Steps, Applications

FASTA - Definition, Programs, Working, Steps, Applications

What is FASTA format? FASTA format is a text-based format commonly used for representing nucleotide or protein sequences. It is named after the FASTA software package, which introduced this format. The FASTA format is widely used in bioinformatics and genomics for storing and exchanging sequence data. FASTA file looks like: A typical FASTA file consists … Read more

BLAST – Definition, Types, Characteristics, Outputs, Applications

BLAST - Definition, Types, Characteristics, Outputs, Applications

What is BLAST? BLAST, which stands for Basic Local Alignment Search Tool, is a widely used bioinformatics program and algorithm. It is designed to compare and analyze biological sequences such as DNA, RNA, and protein sequences. BLAST helps in identifying regions of similarity between different sequences, which can provide insights into their functional and evolutionary … Read more

Sequence Alignment – Definition, Types, Tools, Applications

Sequence Alignment - Definition, Types, Tools, Applications

What is Sequence Alignment? Sequence alignment is a computational technique used to compare and analyze the similarities and differences between two or more sequences of biological data, such as DNA, RNA, or protein sequences. By aligning sequences, researchers can identify conserved regions, detect mutations, infer evolutionary relationships, and predict functional elements. It involves arranging the … Read more

Different Programming Language for Bioinformatics

Different Programming Language for Bioinformatics

What is Programming Language? A programming language is a formal language that is used to write computer-executable instructions or code. It is a set of rules and syntax that enables programmers to communicate with computers and assign them specific instructions or tasks. Programming languages enable the creation of algorithms and software applications. They offer a … Read more

R Programming Language in Bioinformatics

R Programming Language in Bioinformatics

What is R Programming Language? R is a programming language and environment developed in the early 1990s by Ross Ihaka and Robert Gentleman at University of Auckland as a free‑software implementation of the S language, intended for statistical computing, graphics, and data analysis, and now widely used across academia, finance, healthcare, data science and research, … Read more

Phylogenetic Tree – Definition, Types, Steps, Methods, Uses

Phylogenetic Tree - Definition, Types, Steps, Methods, Uses

A phylogenetic tree (also phylogeny or evolutionary tree) is a branching diagram or a tree that illustrates the evolutionary relationships between various biological species or other entities based on similarities and differences in their physical or genetic characteristics. All life on Earth belongs to a singular phylogenetic tree, indicating a shared ancestry. In a rooted … Read more

How to construct a Phylogenetic tree?

How to construct a Phylogenetic tree?

Ever wondered how scientists unravel the family ties between different species or genes? It often starts with building something called a phylogenetic tree. Think of it like sketching out a massive family tree, but for life itself. These trees are powerful diagrams that map out evolutionary relationships, showing us who shared a common ancestor and when … Read more

Ad Blocker Detected
We've detected that you're using an ad blocker. Some content may not display properly.
Why are you seeing this? Ad blockers can prevent certain content and features from loading correctly on our website.

To continue with the best experience: